ID: 999291184

View in Genome Browser
Species Human (GRCh38)
Location 5:150427597-150427619
Sequence ACCAAGAAGGAGAATGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999291184_999291193 12 Left 999291184 5:150427597-150427619 CCTTCCCCATTCTCCTTCTTGGT No data
Right 999291193 5:150427632-150427654 GATGAGCTGCCTCAAGAAGCAGG No data
999291184_999291194 16 Left 999291184 5:150427597-150427619 CCTTCCCCATTCTCCTTCTTGGT No data
Right 999291194 5:150427636-150427658 AGCTGCCTCAAGAAGCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999291184 Original CRISPR ACCAAGAAGGAGAATGGGGA AGG (reversed) Intergenic
No off target data available for this crispr