ID: 999292941

View in Genome Browser
Species Human (GRCh38)
Location 5:150439308-150439330
Sequence CTGCACCAAGAGATTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999292931_999292941 18 Left 999292931 5:150439267-150439289 CCCTCCTTTGCAGCCACATCTTG No data
Right 999292941 5:150439308-150439330 CTGCACCAAGAGATTGAGGATGG No data
999292937_999292941 5 Left 999292937 5:150439280-150439302 CCACATCTTGGGAAAGGTTTTCC No data
Right 999292941 5:150439308-150439330 CTGCACCAAGAGATTGAGGATGG No data
999292935_999292941 14 Left 999292935 5:150439271-150439293 CCTTTGCAGCCACATCTTGGGAA No data
Right 999292941 5:150439308-150439330 CTGCACCAAGAGATTGAGGATGG No data
999292932_999292941 17 Left 999292932 5:150439268-150439290 CCTCCTTTGCAGCCACATCTTGG No data
Right 999292941 5:150439308-150439330 CTGCACCAAGAGATTGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999292941 Original CRISPR CTGCACCAAGAGATTGAGGA TGG Intergenic
No off target data available for this crispr