ID: 999296087

View in Genome Browser
Species Human (GRCh38)
Location 5:150460322-150460344
Sequence GAATATAATCTACAGTTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 139}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999296087_999296091 -7 Left 999296087 5:150460322-150460344 CCGGCCAACTGTAGATTATATTC 0: 1
1: 0
2: 0
3: 8
4: 139
Right 999296091 5:150460338-150460360 TATATTCTGATTGCATGGGAAGG 0: 1
1: 0
2: 0
3: 15
4: 160
999296087_999296093 15 Left 999296087 5:150460322-150460344 CCGGCCAACTGTAGATTATATTC 0: 1
1: 0
2: 0
3: 8
4: 139
Right 999296093 5:150460360-150460382 GCAGTGAAGAGCTTTAAGCAGGG 0: 1
1: 0
2: 0
3: 52
4: 334
999296087_999296092 14 Left 999296087 5:150460322-150460344 CCGGCCAACTGTAGATTATATTC 0: 1
1: 0
2: 0
3: 8
4: 139
Right 999296092 5:150460359-150460381 GGCAGTGAAGAGCTTTAAGCAGG 0: 1
1: 0
2: 0
3: 50
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999296087 Original CRISPR GAATATAATCTACAGTTGGC CGG (reversed) Intergenic
900775009 1:4576250-4576272 AAATAAGACCTACAGTTGGCCGG - Intergenic
901177046 1:7311627-7311649 GAATAAAATCCAAAATTGGCTGG - Intronic
905578577 1:39065799-39065821 GAATATAACCTAAGATTGGCTGG - Intergenic
912337503 1:108876697-108876719 AAATATTGTCTAGAGTTGGCCGG - Intronic
916272054 1:162953523-162953545 GAAAATCCACTACAGTTGGCTGG - Intergenic
916791771 1:168131302-168131324 GAATAAATTCTGCAGGTGGCAGG - Intronic
917360510 1:174170326-174170348 TAATATCATCTCCAGTTTGCAGG + Intronic
920091860 1:203459724-203459746 GAATATATTTTACATTTGACCGG + Intergenic
923052846 1:230401024-230401046 GCATATTATCTACAGTTACCTGG + Intronic
923322764 1:232852106-232852128 GCATATAATTGACAGTTGTCTGG - Intergenic
924511922 1:244734879-244734901 GAATTTGCACTACAGTTGGCTGG - Intergenic
1064823126 10:19362306-19362328 CAATATTATCTACAGTTACCAGG - Intronic
1067376708 10:45733931-45733953 GAATTGAACCTACAGTAGGCCGG + Intronic
1067884403 10:50074622-50074644 GAATTGAACCTACAGTAGGCCGG + Intronic
1069116879 10:64518047-64518069 GAAAGTAATGTACAGTTGACTGG + Intergenic
1069288316 10:66744044-66744066 GAATGTAAACTGCAGGTGGCAGG + Intronic
1071180808 10:82981278-82981300 GAATATTCTCTCCAGTTGCCTGG + Intronic
1071364928 10:84889939-84889961 GAAAATAATATACAGAAGGCCGG + Intergenic
1080551641 11:33377421-33377443 GTATATAATCCACTGTTTGCAGG + Intergenic
1084293413 11:68192385-68192407 GAATGTAAACTACAGAAGGCAGG + Intronic
1087633981 11:100682642-100682664 TAATAAAATCTAGATTTGGCAGG + Intergenic
1087760860 11:102103093-102103115 GAATAAAAGTAACAGTTGGCCGG - Intergenic
1091162813 11:133440428-133440450 GATTATTATCAACATTTGGCTGG + Intronic
1091543808 12:1486921-1486943 GAATATAAACTAGAATTGTCTGG + Intronic
1092666164 12:10801461-10801483 GAATCTTATGTACAGCTGGCTGG - Intergenic
1094636881 12:32235025-32235047 GTCTATAATCTACTGTAGGCTGG - Intronic
1096855243 12:54476724-54476746 GAATATAATCTATAGGAGGCTGG - Intergenic
1097070837 12:56353695-56353717 AAATATAATATACTGTTGGCCGG + Intronic
1098285499 12:68903325-68903347 GAACATAAGCTACAGTTTACGGG - Intronic
1103483637 12:121267788-121267810 GAAAATATTCTGCAGTTGGCCGG - Intronic
1104189841 12:126469710-126469732 CAATATAATCTTCAATTGTCAGG + Intergenic
1104488921 12:129177329-129177351 GCATATATTCTACAGAGGGCAGG + Intronic
1105395989 13:20035660-20035682 GAAGATAATTTTCAGTTGGAGGG + Intronic
1110814535 13:79846663-79846685 GAATATAATCTTTGGTTGGAGGG - Intergenic
1111623749 13:90756944-90756966 GGATATAATATACAGGTTGCTGG + Intergenic
1119596116 14:75935698-75935720 GAGCATAATCTACAGTGGGTTGG - Intronic
1119957066 14:78809910-78809932 GAATATAACCTGCATTTGGTGGG + Intronic
1120314096 14:82869782-82869804 GAAAAAAATCTTCACTTGGCAGG - Intergenic
1120970277 14:90201299-90201321 TAATATAATTTACAGTTGTCCGG + Intergenic
1123961659 15:25408997-25409019 GAAGACAATGTATAGTTGGCAGG - Intronic
1127797772 15:62453378-62453400 GAATATGATCTGCACATGGCAGG + Intronic
1129947509 15:79552474-79552496 GAATATAATTTACTGTTATCAGG + Intergenic
1138836258 16:60439260-60439282 GAAAATAATCTGGAGTAGGCTGG - Intergenic
1140903457 16:79391488-79391510 GATTATAATAAAGAGTTGGCAGG + Intergenic
1141016898 16:80459330-80459352 GAATCTGATCTGCATTTGGCTGG - Intergenic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1143073147 17:4315442-4315464 GAAAATAAGCTACTTTTGGCCGG + Intronic
1148141559 17:45332900-45332922 GCATATAATTTGCAGATGGCGGG + Intergenic
1149914954 17:60600318-60600340 GAAGATAAACAATAGTTGGCCGG + Exonic
1150700847 17:67445688-67445710 GGATAAAATGTACAGTTGCCAGG - Intronic
1151650036 17:75461625-75461647 AAATGTAATCCACAGTAGGCCGG + Intronic
1152853676 17:82651530-82651552 GAGAAGAATCTACAGTAGGCCGG + Intergenic
1153920495 18:9784847-9784869 CAATATCATCTAAAATTGGCTGG - Intronic
1157224157 18:45847598-45847620 GAATTTAATTTACACATGGCGGG - Exonic
1157287219 18:46385095-46385117 GAATATACGCCAGAGTTGGCTGG - Intronic
1158462611 18:57659565-57659587 GAAAATAAACTAGAGCTGGCTGG + Intronic
1159755761 18:72361711-72361733 AAATATATTTTACAGTTTGCTGG - Intergenic
1162669703 19:12245664-12245686 GAATATAATCTAGAGATGAGGGG + Intronic
1163161178 19:15464821-15464843 AACTCTAATCCACAGTTGGCCGG + Intergenic
1163912626 19:20210645-20210667 GTATATAGTATACAGTTGACAGG - Intergenic
1163956849 19:20650788-20650810 GCATATAATATAAAGTTGACAGG - Intronic
1164068764 19:21746210-21746232 GAATATAATTTACTTTTGGAGGG - Intronic
1164164031 19:22651989-22652011 GACTATAATTTACTTTTGGCTGG + Intronic
928016356 2:27661465-27661487 GCCTATAATCTAAAGTTGCCAGG - Intronic
930085135 2:47491382-47491404 GAATAAAATTTACAATTGGCTGG - Intronic
930316839 2:49807143-49807165 AAATATAATCTTCAGTTTTCTGG + Intergenic
930771989 2:55138201-55138223 GAAAGTAATCTGAAGTTGGCAGG + Intergenic
931448347 2:62346138-62346160 GAAAATGTTCTACAATTGGCCGG - Intergenic
933557879 2:83852787-83852809 AAATATAATCTGCAGTGGCCTGG - Intergenic
937501157 2:122480666-122480688 GAATATAAATGACATTTGGCTGG - Intergenic
937795437 2:126013039-126013061 GAACATAATATAGAATTGGCTGG + Intergenic
939072983 2:137566107-137566129 GAAGATGCTCTACAGTTGGAAGG - Intronic
941089234 2:161155592-161155614 GAATAACATCTACAGTTGCCTGG - Intronic
941327381 2:164133639-164133661 GAATAAAATGTACAATTGGGGGG - Intergenic
941509421 2:166387265-166387287 GAATCTAATCCATACTTGGCAGG - Intergenic
942117798 2:172745955-172745977 CAATATAATATACAGTTTTCAGG + Intronic
942535419 2:176957925-176957947 GAAGATGATGTGCAGTTGGCTGG + Intergenic
944925506 2:204459954-204459976 AAATATATTCTACACTTGGGGGG - Intergenic
945726869 2:213481022-213481044 TAATATATTCTTTAGTTGGCGGG - Intronic
945851540 2:215014212-215014234 TAATAAAATATATAGTTGGCTGG + Intronic
947281675 2:228462209-228462231 TGATGTAATCTACAGTTGACTGG + Intergenic
1169277027 20:4240496-4240518 CAAAATAATCTACAGTGGCCGGG + Intronic
1169672887 20:8123810-8123832 GAATATAATCTTTAGTTGTATGG - Intergenic
1169930207 20:10824300-10824322 GAATATAAGCTCCTGATGGCAGG + Intergenic
1173446577 20:43124364-43124386 GAATCTAATTTATAGTTGACTGG - Intronic
1173634367 20:44541983-44542005 GAAAATAAGCTATACTTGGCCGG - Intronic
1174845646 20:53940627-53940649 GACTATAATTTCCAGTGGGCCGG + Intronic
1176729299 21:10475511-10475533 GGAAATATTCTACAGTTAGCAGG + Intergenic
1177000084 21:15601540-15601562 GATTAACATCTACAATTGGCTGG + Intergenic
1177841473 21:26238845-26238867 TAATATGTTCTCCAGTTGGCTGG + Intergenic
956001204 3:64731761-64731783 GAATATGATCTAAAGCTGTCAGG - Intergenic
959501818 3:107115203-107115225 AAAAATAATCTACAATTGACTGG + Intergenic
960465653 3:117994132-117994154 TAATATAAACTACAGTTGCCAGG + Intergenic
963469174 3:145716697-145716719 GAATATATTCTACACATGGGAGG - Intergenic
965110695 3:164417757-164417779 GAATATAATACACAGTTGTGTGG + Intergenic
965531221 3:169772847-169772869 GAAGCTGAGCTACAGTTGGCTGG + Exonic
967246230 3:187489810-187489832 GAATAATACTTACAGTTGGCTGG - Intergenic
970352018 4:15211173-15211195 GAATAAAATGTACAGCGGGCCGG + Intergenic
971030515 4:22632129-22632151 GCATATAACTTACATTTGGCTGG + Intergenic
974604338 4:64131034-64131056 AAATATAATTTCCAGTTGACTGG + Intergenic
976052598 4:81026912-81026934 GAATATCATCTACACTTAGGTGG - Intergenic
976306351 4:83563775-83563797 GAAAATAATAAACACTTGGCCGG - Intronic
977789616 4:101084342-101084364 TAAGATAACATACAGTTGGCCGG + Intronic
979265985 4:118703546-118703568 GAATAGAATATTGAGTTGGCAGG + Intronic
982486316 4:155969534-155969556 GAAAATCTTCTACAGTTGTCAGG + Intergenic
984482022 4:180317435-180317457 GAAAAAAATCTACATTTGCCAGG - Intergenic
989072945 5:37531253-37531275 GAATATATTCTGCAGTTGTTGGG + Intronic
997609793 5:135207743-135207765 GAGTATCATCTTCAGTTTGCAGG - Intronic
999212956 5:149906210-149906232 GATTTTAATCTACAGGTGACAGG - Intronic
999296087 5:150460322-150460344 GAATATAATCTACAGTTGGCCGG - Intergenic
1001040022 5:168327810-168327832 GAATATAAGCTCGTGTTGGCAGG + Intronic
1004980838 6:21021957-21021979 AAATATAATTTACCTTTGGCTGG + Intronic
1005590248 6:27317186-27317208 GAATGGAATCTACAGTTGAGAGG + Intergenic
1007467865 6:42067509-42067531 GAAAATACTCTAGAATTGGCTGG - Intronic
1010969570 6:82248894-82248916 GAAAATAAGCTTAAGTTGGCCGG + Intergenic
1013812269 6:114058549-114058571 GATTATAATCTTCAGCTGGGAGG + Intronic
1015979187 6:138821764-138821786 GAATATAAACTGCAGTGGGCAGG - Intronic
1016145705 6:140670145-140670167 TAATTTAATCTTCATTTGGCAGG - Intergenic
1016384147 6:143514716-143514738 GAATGGAATCTACAGCAGGCAGG - Intergenic
1016390793 6:143572847-143572869 GAAAATAAACCACTGTTGGCTGG - Intronic
1019486974 7:1293929-1293951 AAATATAATTTACAGTGGGAAGG + Intergenic
1020146585 7:5648801-5648823 GAATGTCTTCTAGAGTTGGCTGG - Intronic
1028311490 7:89343245-89343267 TAATATAATCTACTTTCGGCCGG - Intergenic
1029978537 7:104856542-104856564 TAAAATATTCTAGAGTTGGCCGG - Intronic
1030207573 7:106965852-106965874 AAATATAAGGAACAGTTGGCAGG - Intergenic
1032918630 7:136520641-136520663 AAATATATACTACTGTTGGCCGG + Intergenic
1033794328 7:144830099-144830121 GACTTTAACCTACAGTTGGTTGG + Intronic
1034600292 7:152246086-152246108 GGAAATATTCTACAGTTAGCAGG - Intronic
1034674348 7:152881884-152881906 GACTACAATCTAGGGTTGGCAGG - Intergenic
1041308022 8:56483796-56483818 GAATATATTCTCCACTTGGAAGG + Intergenic
1042639437 8:70917368-70917390 GAATATAAGCCACAGTAGTCAGG + Intergenic
1042791166 8:72608023-72608045 GAATATAAGCTCCATTAGGCAGG - Intronic
1047845286 8:128799131-128799153 GAAGACAATCTCCAGGTGGCAGG + Intergenic
1050539380 9:6657221-6657243 GATTTTAATGTACAGCTGGCCGG + Intergenic
1050977348 9:11956950-11956972 GAATATAATTTTCAGATGGGTGG + Intergenic
1051904282 9:22076995-22077017 TAATATTAACTATAGTTGGCAGG + Intergenic
1052801026 9:32968321-32968343 AAATAGACTCTAAAGTTGGCTGG - Intergenic
1053254786 9:36607284-36607306 GAAAATAATTTCCAGTAGGCTGG - Intronic
1055170509 9:73252772-73252794 GAAAATAATGTGTAGTTGGCTGG - Intergenic
1059185151 9:112261691-112261713 GAATGTAATATACAGTTATCTGG - Intronic
1203584962 Un_KI270746v1:58568-58590 GGAAATATTCTACAGTTAGCAGG - Intergenic
1190067678 X:47252935-47252957 AAATAAAACCAACAGTTGGCTGG - Intergenic
1191838838 X:65494484-65494506 GTATAAAATATAAAGTTGGCTGG + Intronic
1192167471 X:68834906-68834928 GAATACAATTTACAGGGGGCAGG - Intronic
1192460074 X:71309575-71309597 AGATAGAATCTACATTTGGCCGG - Intergenic
1195089272 X:101442834-101442856 AAATATAATCCCCAATTGGCCGG + Intronic
1195271305 X:103233700-103233722 GACTGTAATCCACAGTTGGGAGG + Intergenic
1201381535 Y:13385139-13385161 GTATATAAGAAACAGTTGGCTGG - Intronic