ID: 999297101

View in Genome Browser
Species Human (GRCh38)
Location 5:150466459-150466481
Sequence TAGACATGAACCACCATGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102311
Summary {0: 9, 1: 181, 2: 3482, 3: 24786, 4: 73853}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999297101_999297107 27 Left 999297101 5:150466459-150466481 CCAGGCATGGTGGTTCATGTCTA 0: 9
1: 181
2: 3482
3: 24786
4: 73853
Right 999297107 5:150466509-150466531 TAGGAGCATTGCTGAAGCCCAGG No data
999297101_999297106 8 Left 999297101 5:150466459-150466481 CCAGGCATGGTGGTTCATGTCTA 0: 9
1: 181
2: 3482
3: 24786
4: 73853
Right 999297106 5:150466490-150466512 ACACTTTGGAAGGCTGAGATAGG 0: 14
1: 525
2: 8232
3: 59442
4: 172814
999297101_999297103 -2 Left 999297101 5:150466459-150466481 CCAGGCATGGTGGTTCATGTCTA 0: 9
1: 181
2: 3482
3: 24786
4: 73853
Right 999297103 5:150466480-150466502 TATAATCCCAACACTTTGGAAGG 0: 120
1: 4405
2: 63406
3: 355561
4: 240924
999297101_999297102 -6 Left 999297101 5:150466459-150466481 CCAGGCATGGTGGTTCATGTCTA 0: 9
1: 181
2: 3482
3: 24786
4: 73853
Right 999297102 5:150466476-150466498 TGTCTATAATCCCAACACTTTGG 0: 57
1: 1907
2: 26643
3: 146994
4: 265942

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999297101 Original CRISPR TAGACATGAACCACCATGCC TGG (reversed) Intergenic
Too many off-targets to display for this crispr