ID: 999297104

View in Genome Browser
Species Human (GRCh38)
Location 5:150466486-150466508
Sequence TCTCAGCCTTCCAAAGTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 395690
Summary {0: 25, 1: 1137, 2: 18680, 3: 131334, 4: 244514}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999297104_999297107 0 Left 999297104 5:150466486-150466508 CCCAACACTTTGGAAGGCTGAGA 0: 25
1: 1137
2: 18680
3: 131334
4: 244514
Right 999297107 5:150466509-150466531 TAGGAGCATTGCTGAAGCCCAGG No data
999297104_999297110 18 Left 999297104 5:150466486-150466508 CCCAACACTTTGGAAGGCTGAGA 0: 25
1: 1137
2: 18680
3: 131334
4: 244514
Right 999297110 5:150466527-150466549 CCAGGAGTTCAAGACCAGCCTGG 0: 17471
1: 86795
2: 157073
3: 181920
4: 169992
999297104_999297111 19 Left 999297104 5:150466486-150466508 CCCAACACTTTGGAAGGCTGAGA 0: 25
1: 1137
2: 18680
3: 131334
4: 244514
Right 999297111 5:150466528-150466550 CAGGAGTTCAAGACCAGCCTGGG 0: 17736
1: 36982
2: 56675
3: 51242
4: 33219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999297104 Original CRISPR TCTCAGCCTTCCAAAGTGTT GGG (reversed) Intergenic
Too many off-targets to display for this crispr