ID: 999297105

View in Genome Browser
Species Human (GRCh38)
Location 5:150466487-150466509
Sequence ATCTCAGCCTTCCAAAGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 227901
Summary {0: 14, 1: 481, 2: 7615, 3: 56053, 4: 163738}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999297105_999297107 -1 Left 999297105 5:150466487-150466509 CCAACACTTTGGAAGGCTGAGAT 0: 14
1: 481
2: 7615
3: 56053
4: 163738
Right 999297107 5:150466509-150466531 TAGGAGCATTGCTGAAGCCCAGG No data
999297105_999297110 17 Left 999297105 5:150466487-150466509 CCAACACTTTGGAAGGCTGAGAT 0: 14
1: 481
2: 7615
3: 56053
4: 163738
Right 999297110 5:150466527-150466549 CCAGGAGTTCAAGACCAGCCTGG 0: 17471
1: 86795
2: 157073
3: 181920
4: 169992
999297105_999297111 18 Left 999297105 5:150466487-150466509 CCAACACTTTGGAAGGCTGAGAT 0: 14
1: 481
2: 7615
3: 56053
4: 163738
Right 999297111 5:150466528-150466550 CAGGAGTTCAAGACCAGCCTGGG 0: 17736
1: 36982
2: 56675
3: 51242
4: 33219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999297105 Original CRISPR ATCTCAGCCTTCCAAAGTGT TGG (reversed) Intergenic
Too many off-targets to display for this crispr