ID: 999297107

View in Genome Browser
Species Human (GRCh38)
Location 5:150466509-150466531
Sequence TAGGAGCATTGCTGAAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999297104_999297107 0 Left 999297104 5:150466486-150466508 CCCAACACTTTGGAAGGCTGAGA 0: 25
1: 1137
2: 18680
3: 131334
4: 244514
Right 999297107 5:150466509-150466531 TAGGAGCATTGCTGAAGCCCAGG No data
999297101_999297107 27 Left 999297101 5:150466459-150466481 CCAGGCATGGTGGTTCATGTCTA 0: 9
1: 181
2: 3482
3: 24786
4: 73853
Right 999297107 5:150466509-150466531 TAGGAGCATTGCTGAAGCCCAGG No data
999297105_999297107 -1 Left 999297105 5:150466487-150466509 CCAACACTTTGGAAGGCTGAGAT 0: 14
1: 481
2: 7615
3: 56053
4: 163738
Right 999297107 5:150466509-150466531 TAGGAGCATTGCTGAAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999297107 Original CRISPR TAGGAGCATTGCTGAAGCCC AGG Intergenic
No off target data available for this crispr