ID: 999302518

View in Genome Browser
Species Human (GRCh38)
Location 5:150500040-150500062
Sequence CGGGACAGACAGTTGGACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 103}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999302518_999302525 25 Left 999302518 5:150500040-150500062 CCCTTGTCCAACTGTCTGTCCCG 0: 1
1: 0
2: 0
3: 6
4: 103
Right 999302525 5:150500088-150500110 TGAAATCTTAAGTATTCCCTGGG 0: 1
1: 0
2: 1
3: 18
4: 183
999302518_999302526 26 Left 999302518 5:150500040-150500062 CCCTTGTCCAACTGTCTGTCCCG 0: 1
1: 0
2: 0
3: 6
4: 103
Right 999302526 5:150500089-150500111 GAAATCTTAAGTATTCCCTGGGG 0: 1
1: 0
2: 2
3: 15
4: 216
999302518_999302524 24 Left 999302518 5:150500040-150500062 CCCTTGTCCAACTGTCTGTCCCG 0: 1
1: 0
2: 0
3: 6
4: 103
Right 999302524 5:150500087-150500109 TTGAAATCTTAAGTATTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999302518 Original CRISPR CGGGACAGACAGTTGGACAA GGG (reversed) Intronic
900329475 1:2126858-2126880 AGGGACAGGCAGGTGGATAAGGG - Intronic
900485769 1:2921986-2922008 CTGGATAGACAGATGGACAGAGG - Intergenic
900492433 1:2958940-2958962 CAGGATAGACACATGGACAAAGG + Intergenic
900949052 1:5847356-5847378 AGGGACAGACATCAGGACAAAGG + Intergenic
901077061 1:6561810-6561832 TAGGACAGAGAGGTGGACAAGGG + Intronic
903467525 1:23562392-23562414 CGGGACCCACAGCTGGGCAAAGG - Intergenic
903818838 1:26085418-26085440 CGGATCAGACAGTTGGAGACAGG - Intergenic
913530174 1:119728377-119728399 CTGGAAGGACAGATGGACAATGG - Intronic
915724721 1:158009091-158009113 TTGGACACACAGTTGGACCAGGG + Intronic
915737797 1:158095542-158095564 TGGCACAGACAGGTGGAAAACGG + Exonic
916492744 1:165316232-165316254 AAGGACAGACAGGTGGACACTGG + Intronic
917632746 1:176905925-176905947 TGGTACAGACAGCTGGACATGGG + Intronic
919617010 1:199820430-199820452 AGGGAGAGACAGAAGGACAATGG + Intergenic
919644476 1:200080107-200080129 GAGAACAGACAGTTGGAAAAAGG + Intronic
920215095 1:204357369-204357391 CTGAACAGACAGATGGTCAAGGG + Intronic
923142708 1:231174647-231174669 CGGGACAGACTGTTGGGGAAAGG - Intronic
923334210 1:232952858-232952880 GGGTACAGACAGTTGGAAATCGG - Intronic
1062912041 10:1217621-1217643 CGGGACTGACACCTGGACCAGGG - Intronic
1066039091 10:31526958-31526980 CGAGAGAGAGAGTTTGACAAGGG + Exonic
1067162606 10:43840088-43840110 CTGGTCAGAGAGGTGGACAACGG + Intergenic
1071590245 10:86865769-86865791 CAGGACATACAGTTTGACCAGGG - Intronic
1072539777 10:96389621-96389643 TGGGAGAGACAGATAGACAAAGG + Intronic
1084434987 11:69134135-69134157 GAGGACAAACAGTTGGGCAAAGG - Intergenic
1085242351 11:75068587-75068609 AGGGACAGACAGTAGAGCAATGG - Intergenic
1086339463 11:85833509-85833531 CGGGAAAGCCATTTGGACACTGG + Intergenic
1089647786 11:119891613-119891635 CGTGCCAGACAGCTGTACAATGG - Intergenic
1090005406 11:122998091-122998113 CTGGAAAGAAAGTTGAACAAGGG + Intergenic
1096492206 12:52019060-52019082 GGGGACAGACTGGTGGCCAAGGG - Intergenic
1098990373 12:77059299-77059321 CAGGACAGACAGATGGAGCAAGG - Intronic
1104748190 12:131222952-131222974 GGGGACAGACAGTAGGGCAGAGG - Intergenic
1106343340 13:28852275-28852297 CTGGAGAGACAGATGAACAAAGG - Intronic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1112946253 13:104930662-104930684 CTGGACAGCCAATAGGACAATGG - Intergenic
1114223787 14:20720502-20720524 CGGTACACACAGTTGGGCATTGG - Intergenic
1115741099 14:36389867-36389889 CAGGAAAGACACTAGGACAAAGG - Intergenic
1125681884 15:41536118-41536140 CGGGACACACAGGTAGGCAAGGG - Exonic
1129113673 15:73352930-73352952 GGGAACACACAGTTGGGCAAGGG + Intronic
1134066223 16:11230159-11230181 AGGGACAGTCAAGTGGACAAAGG + Intergenic
1136105928 16:28030484-28030506 GGAGACAGACAGAAGGACAATGG + Intronic
1138111244 16:54325817-54325839 CCTGACTGACAGTTGGACACAGG + Intergenic
1138386823 16:56641159-56641181 TGTGACAGACAGTTCTACAAAGG - Intronic
1138490848 16:57375655-57375677 CAGGACACACAGCTGGGCAATGG + Intronic
1139668111 16:68472437-68472459 TGGGAAAGACAGCTGGACATGGG + Intergenic
1145070535 17:19801820-19801842 CAGCACAGACAGTTGGACGAAGG - Exonic
1147299825 17:39517455-39517477 CAGGCCACACAGCTGGACAAGGG - Exonic
1157307759 18:46529344-46529366 TGGGACAGACAGACAGACAAAGG + Intronic
1159012416 18:63070374-63070396 AGTGACAGACATTTGGACAGAGG + Intergenic
1161233503 19:3187033-3187055 CGGGACAGAAAGGGGGTCAAAGG - Intronic
1162068747 19:8141389-8141411 AGAGACAGACAGCTGAACAAGGG + Intronic
925909845 2:8566440-8566462 TGGGAGAGACAGATGGACATAGG - Intergenic
927078026 2:19599610-19599632 AGGAACAGAGAGTTGAACAATGG + Intergenic
929424755 2:41832618-41832640 TGGGACAGACTTCTGGACAATGG + Intergenic
932800647 2:74739686-74739708 CAGGACAGACATTTGGGGAAGGG + Intergenic
940031865 2:149272121-149272143 CGGGACAGACTGTTGGGGAGGGG + Intergenic
940318632 2:152350492-152350514 TGGGACAGACTGTTTGAGAATGG + Intronic
947971949 2:234332155-234332177 CGGGACAGACAGAGAGACATGGG - Intergenic
1168845672 20:942904-942926 AAGGACAGACAGCTGGAAAATGG - Intergenic
1173939995 20:46902581-46902603 CAGGGCAGACAGATGGAGAAAGG - Intronic
1176084927 20:63291513-63291535 CGGGACAGCCAGTTGGTGGATGG + Intergenic
1176966870 21:15220956-15220978 AGGTACATACAGTTGGACAATGG - Intergenic
1179219065 21:39390356-39390378 CGGGACAGCCAGTGAGAGAAAGG + Intronic
1179367561 21:40772610-40772632 CAAGACAGGCAGTTGGACATGGG - Intronic
1182695942 22:32199413-32199435 CTGGACAGACAGTGGGACTTGGG + Intronic
1182972625 22:34592073-34592095 AGGGACACAGAGTTGGATAAAGG - Intergenic
1183711175 22:39504381-39504403 CGGGAGAGGCAGCTGGAGAAGGG + Exonic
950421574 3:12902736-12902758 CAGGACAGCCAGCTGGACAGAGG + Intronic
954910806 3:54105955-54105977 CGAGTCAGACAGTGAGACAAGGG + Intergenic
961061814 3:123834955-123834977 CTGGACAGAGAGCTGGGCAATGG + Intronic
963392084 3:144677735-144677757 CAGGACAGCCTGTTGGATAACGG + Intergenic
964381738 3:156104453-156104475 CAGGACTGACATGTGGACAAGGG - Intronic
964761191 3:160136363-160136385 AGGGACAGAGAGTTGGTGAAGGG - Intergenic
967824986 3:193870486-193870508 CGTGACTGACAGGTGGAGAAGGG + Intergenic
969500685 4:7550857-7550879 CGGGTGAGACAGATGGAAAAAGG - Intronic
969694916 4:8729108-8729130 CTAGACAGACAGATGGACACTGG + Intergenic
971444675 4:26730790-26730812 CAGGACAGAGAGGTGGCCAAAGG - Intronic
974350735 4:60742827-60742849 CAGGACAGAGAGATAGACAAAGG + Intergenic
980750011 4:137076618-137076640 CAGGACAGAAACTTGGGCAAAGG - Intergenic
985549515 5:525870-525892 AAGGACAGATAGGTGGACAAAGG + Intergenic
986142143 5:5040832-5040854 TCGAAAAGACAGTTGGACAAAGG + Intergenic
987736214 5:21846938-21846960 CGGGACTGGCAGATGAACAATGG + Intronic
989090559 5:37725878-37725900 CTGGAAAGACAATTGGACAGTGG - Intronic
992483486 5:77174033-77174055 CTGAACAGAGAGTAGGACAAAGG - Intergenic
992778068 5:80105423-80105445 GGGGACAGGGAGTTGGAGAATGG + Intergenic
992874849 5:81043815-81043837 AGGAACAGACAGATGGAGAAGGG - Intronic
999302518 5:150500040-150500062 CGGGACAGACAGTTGGACAAGGG - Intronic
1002599625 5:180346753-180346775 GGGGACGGAAAGTTGGAAAAAGG - Intronic
1004001794 6:11602893-11602915 CGGGAAACACAGTTTGAAAAAGG - Intergenic
1004294404 6:14397177-14397199 TGGGACAGACAGTGGGGCAAGGG - Intergenic
1005687862 6:28272387-28272409 CTGGCCAGACAGGTGGACATGGG + Intronic
1009791993 6:68415085-68415107 TGCGACAAACAGTTGTACAAAGG - Intergenic
1010626767 6:78146271-78146293 ACGGACAGACAGTAGAACAATGG + Intergenic
1012101435 6:95091968-95091990 AGGTACAGACAGTTTGAAAATGG - Intergenic
1016683071 6:146852835-146852857 CAGGACAGACAGTTGTGCAGGGG - Intergenic
1017791309 6:157802031-157802053 GGGGACAGAAACTTGGCCAATGG + Intronic
1018860732 6:167709094-167709116 CACAACAGACAGATGGACAAAGG + Intergenic
1025713510 7:63932181-63932203 CGGGCCAGACAAGTGGACACAGG - Intergenic
1026009799 7:66628266-66628288 CGGGACACACAGATGGAGACAGG - Intergenic
1029482764 7:100823165-100823187 CGAGACAGGCAGGTGGACAGAGG + Intronic
1035421219 7:158730205-158730227 ATGGACAGACAGATGGACAAAGG + Intergenic
1035828967 8:2674377-2674399 CGAGACAGACAGCAGGACAGAGG + Intergenic
1037666338 8:20973233-20973255 CTGGGCCGGCAGTTGGACAATGG + Intergenic
1039467679 8:37796201-37796223 GGGGACAGTGAGTGGGACAAGGG - Intronic
1049687888 8:143946252-143946274 CGGCACAGAACGGTGGACAACGG + Intronic
1056031140 9:82554630-82554652 GGGGACAGACAGCAGGACTATGG - Intergenic
1059100833 9:111470188-111470210 GGGGACAGACTGGTGGACTAGGG - Intronic
1059764936 9:117375146-117375168 AAGGACAGAGAGATGGACAAGGG + Intronic
1060867773 9:127013537-127013559 GGGGACAGACAGGTGGAAAAGGG - Intronic
1187291206 X:17955139-17955161 GGGGGCAGACAGGGGGACAAAGG + Intergenic
1197873512 X:131082175-131082197 AGGGACAGACAAGTGGACAGAGG + Intronic
1201569708 Y:15400636-15400658 CAAGACAGAAAGTTGGACCAGGG - Intergenic