ID: 999305990

View in Genome Browser
Species Human (GRCh38)
Location 5:150519950-150519972
Sequence CTGGGTGGACAGAAGGTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 252}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999305984_999305990 -6 Left 999305984 5:150519933-150519955 CCCAGAGTTATGGCTGCCTGGGT 0: 1
1: 0
2: 0
3: 8
4: 129
Right 999305990 5:150519950-150519972 CTGGGTGGACAGAAGGTCCAGGG 0: 1
1: 0
2: 2
3: 32
4: 252
999305985_999305990 -7 Left 999305985 5:150519934-150519956 CCAGAGTTATGGCTGCCTGGGTG 0: 1
1: 0
2: 0
3: 20
4: 151
Right 999305990 5:150519950-150519972 CTGGGTGGACAGAAGGTCCAGGG 0: 1
1: 0
2: 2
3: 32
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999305990 Original CRISPR CTGGGTGGACAGAAGGTCCA GGG Intronic
900308942 1:2024302-2024324 CGGGGTAGACAGCAGGGCCATGG - Intronic
900862406 1:5242978-5243000 CTGGGTGGGCCGAGGCTCCATGG + Intergenic
901091566 1:6645127-6645149 CTGGGGAGACAGAGGGTGCAAGG + Intronic
902400046 1:16152637-16152659 CTGGGTGGGTAGAAGGACAAAGG + Intronic
904001073 1:27339115-27339137 CAGGGAGCACAGAAGGCCCAGGG + Intergenic
905016898 1:34783947-34783969 CTGGGAGGACACTAGATCCAGGG - Intronic
905865540 1:41374405-41374427 ATGGGTGGACACAAGATGCAGGG + Intronic
906252493 1:44321452-44321474 CTTGGGGAACAGAAGGTCCAGGG - Intronic
907271928 1:53296367-53296389 CTGGGTGCACAGAAGGGACTTGG + Intronic
908128506 1:61052397-61052419 CGGGGTTGACAGCAGGTCAAGGG + Intronic
910615642 1:89195318-89195340 CTCGGTGTCCAGAAGGACCAGGG + Exonic
915962344 1:160277692-160277714 CTGGTAGGACAGAAGGCACAAGG + Exonic
916004464 1:160646784-160646806 GTGGATGGAGAGAAGGTGCAGGG - Intronic
917501621 1:175590996-175591018 CTGAGAGGACAGCAGTTCCAAGG + Intronic
918557629 1:185822298-185822320 CGGGGTGGGCAGGAGGTACATGG + Intronic
919736502 1:200955718-200955740 TTGGGTTGACAGAAGGTCCTAGG - Intergenic
919745827 1:201008712-201008734 CTTGGTGGACAACAGGACCATGG - Intronic
919785026 1:201253386-201253408 TTAGGTGGACAGGAGGTGCAGGG + Intergenic
919824211 1:201492341-201492363 CTGGGAGAACAGAAGGGCCAAGG - Intronic
920050582 1:203162354-203162376 CTGGGTGGTCAGAAGGGTGAGGG + Intronic
920219431 1:204385746-204385768 CTGAGTGGTGAGAAAGTCCAAGG - Intergenic
920845099 1:209587104-209587126 CTGGCTGGAGAGAAACTCCAAGG - Intronic
921091383 1:211847162-211847184 CTGGGTGGTGACCAGGTCCAAGG - Intergenic
922185631 1:223271801-223271823 TTCTGTGGAAAGAAGGTCCATGG - Intronic
923260826 1:232266310-232266332 CTGCTTGGAGAGAAGGTGCAAGG + Intergenic
924928037 1:248702581-248702603 CTGGGAGAACAGAAGGGCTATGG - Intergenic
1063362138 10:5467703-5467725 CTGGCTGGTCAGAAGATTCAAGG - Intergenic
1066442718 10:35454233-35454255 CTGGGTGGCCCCCAGGTCCAGGG + Intronic
1067171682 10:43912175-43912197 CTGGGGGGACAAACAGTCCATGG + Intergenic
1067258559 10:44666501-44666523 CTGGGTCCCCAGAAGGGCCATGG + Intergenic
1067533228 10:47089566-47089588 CTGTGTGCACTGCAGGTCCATGG + Intergenic
1068611185 10:59062102-59062124 TTGGGAGGACAGAAGGCCCATGG + Intergenic
1070378547 10:75858173-75858195 CTGAGTAGACAGAGGGGCCAGGG - Intronic
1070425072 10:76278891-76278913 CTGGGTAGAGAGAAGCTTCAAGG + Intronic
1073309222 10:102527843-102527865 GTGGGTGGACAAAAGGCCCTTGG + Intronic
1073480858 10:103785343-103785365 CTGACTGGACAGAGGGTCCCCGG - Intronic
1073604475 10:104880073-104880095 CTGGTTGGACAGGTGGTACATGG - Intronic
1075734332 10:124654757-124654779 CTGGGGGAGCAGAAGGTCCCAGG - Intronic
1076371024 10:129953736-129953758 CTGGGTGGATGGAAGGTGCAAGG - Intronic
1076470220 10:130713555-130713577 CTGTGTGGACAGAAGGACAAGGG + Intergenic
1076516356 10:131046887-131046909 CTGGGTGAGCAGGAGGGCCAGGG + Intergenic
1076696177 10:132248471-132248493 CTAGGTGGACAGAGGGTCCTTGG - Intronic
1076782284 10:132730999-132731021 CTGGCTGGACAGCAAGTCCACGG - Intronic
1076978732 11:194055-194077 CTCGGTGGACAGGAGGTCTGGGG - Intronic
1077375164 11:2202304-2202326 CTGGGTGGAGTGTAGGCCCAGGG - Intergenic
1077415669 11:2423198-2423220 CTGGCTGGAGAGAAGGTCCCTGG - Intergenic
1077491566 11:2863103-2863125 CTGGTTGGTCAGAAAGTCCGGGG - Intergenic
1079929260 11:26537579-26537601 ATGGGGAGACAGAAGGCCCATGG - Intronic
1081717522 11:45260948-45260970 CTGAGTGGACAGAGTGTCCCTGG - Intronic
1082883912 11:58064575-58064597 CTGATTGGACAGCAGGGCCAGGG + Intronic
1083892020 11:65600184-65600206 GTGGGTGGGCAGAAGGGGCAGGG - Intronic
1084586835 11:70067282-70067304 CTCGCTGGACAGCAGCTCCAAGG + Intergenic
1087235850 11:95717909-95717931 CTGGGTGAATAGAAGGTAGATGG - Intergenic
1090849550 11:130560281-130560303 CTGGATGGAGAGAAGCCCCAGGG + Intergenic
1091079344 11:132652105-132652127 CTGGATCCACAGAGGGTCCAGGG + Intronic
1091216806 11:133907232-133907254 CTGGGTGAAAGGAAGGACCAGGG + Intergenic
1092532868 12:9360012-9360034 CTCTGTGGACAGGGGGTCCAGGG - Intergenic
1094147015 12:27239668-27239690 CTTGGTGGACATAAGGGTCATGG + Intergenic
1096844954 12:54401381-54401403 CATGGTGGACAGCAGGTCCCAGG + Exonic
1097195195 12:57239150-57239172 CTGGCTGCACAGAGGGTCAAAGG + Intronic
1099512694 12:83556548-83556570 CTGATTGGACAGTGGGTCCACGG - Intergenic
1100385961 12:94104847-94104869 TTGGGTGGACAGAAGTCCGAGGG + Intergenic
1101217741 12:102601757-102601779 TTAGGTGGACAGATGGCCCAGGG + Intergenic
1102252792 12:111398808-111398830 CTGGGTGGGCAGAACTCCCAAGG - Intergenic
1103955551 12:124574569-124574591 CTTGGTGGACATAAGGCGCATGG - Intergenic
1104964361 12:132502357-132502379 CTGGGTGGCCATAAGGGCCGGGG - Intronic
1105751437 13:23425306-23425328 CCAGGTGGACACAAGGTCCCAGG - Intronic
1108532875 13:51343879-51343901 CTGGGAAAACAGCAGGTCCAGGG - Intronic
1108579289 13:51815069-51815091 TGGGGTGGACAGGAGTTCCATGG - Intergenic
1108929825 13:55805085-55805107 TTGGCTGGGGAGAAGGTCCATGG - Intergenic
1110818490 13:79887148-79887170 CTGGTTGGACAGTGGGTCCACGG + Intergenic
1112074367 13:95893891-95893913 CTGCGTGGACCAAGGGTCCAAGG - Intronic
1112569827 13:100583951-100583973 CAGGGTGACCAGAAAGTCCATGG + Exonic
1113280113 13:108779532-108779554 CAGGGTGGCCAGAAGCTTCAGGG + Intronic
1113460307 13:110478052-110478074 CTGGCTGGCCGGAAGGTCCTGGG - Exonic
1113693615 13:112329179-112329201 CAGGGTGGACAGAAGGACCCAGG - Intergenic
1113800570 13:113084344-113084366 CTGGGGGTACAGAAGGTTCTGGG - Intronic
1114032479 14:18588796-18588818 CCAGGTGGACACCAGGTCCAAGG + Intergenic
1114077261 14:19167822-19167844 CCAGGTGGACACCAGGTCCAAGG + Intergenic
1114084903 14:19231742-19231764 CCAGGTGGACACCAGGTCCAAGG - Intergenic
1114629709 14:24151254-24151276 CTGGCTGGACAGCAGGACCCTGG + Exonic
1116457709 14:45138030-45138052 CTGGGTGGAGAGCAGGTTTAGGG + Intronic
1116692376 14:48125832-48125854 CTGTGTGGACAGCTGGTTCAGGG + Intergenic
1117852107 14:59984621-59984643 GTAGGAGGACAGAAGGTCAAAGG - Intronic
1118873939 14:69767056-69767078 CGGGGTGGACCCAAGGCCCAGGG + Exonic
1120645468 14:87069244-87069266 CTGGGTGGTCAGAGGGCCCCGGG - Intergenic
1121729144 14:96174220-96174242 CCGGGTAGACAGAAGGGCCTGGG + Intergenic
1122121106 14:99553917-99553939 CTTGGGGGACAGAGGGTCCAGGG + Intronic
1122479944 14:102040609-102040631 CTGGCTGGACAGCAGCTCCCCGG + Exonic
1122767881 14:104084425-104084447 CCAGGTGGACAGAAGATCCGCGG - Intergenic
1202896505 14_GL000194v1_random:13553-13575 CCAGGTGGACACCAGGTCCAAGG - Intergenic
1123451095 15:20359004-20359026 CTGCTTGGACGGAAGGTGCATGG + Intergenic
1124164362 15:27311122-27311144 CAGGGTGGAAGGAAGGTCCAGGG - Intronic
1129114178 15:73355980-73356002 GTGGGAGGACAGAAGGTTCCTGG - Intronic
1129727554 15:77909291-77909313 CTGGGCGGTGAGAATGTCCAGGG - Intergenic
1129944142 15:79524590-79524612 CTGGGGGAACACAAGGTCAATGG - Intergenic
1132678509 16:1130450-1130472 CTGAGGGGCCAGAAGGTCCCCGG + Intergenic
1133673558 16:8047744-8047766 CTGGATGGACGCAAGGTCCAGGG - Intergenic
1135653246 16:24225518-24225540 CTGGTTGATCAGAAGTTCCAGGG + Intergenic
1138306268 16:55978630-55978652 CTGGTTGGTCACAAAGTCCAAGG - Intergenic
1139374358 16:66487544-66487566 CTGGCTGGGCAGAGGGTCCCAGG - Intronic
1140853252 16:78954301-78954323 CTGAGTGGATAGAAGGTGGATGG + Intronic
1142466161 17:138546-138568 CTCGGTGGACAGGAGGTCTGGGG - Intronic
1142747370 17:1966624-1966646 CTGTGTGGCCCGAAGTTCCAGGG + Intronic
1142890758 17:2940990-2941012 CTGGCTGGTCACAAGGTCCCCGG - Intronic
1143203828 17:5129854-5129876 CTGGTTAGACTGAAGGGCCATGG + Intronic
1143484181 17:7244006-7244028 CTGGATGGACACATGGGCCAGGG - Exonic
1143670533 17:8393033-8393055 CAGGCTGGGCAGCAGGTCCAGGG + Exonic
1143870387 17:9954018-9954040 CTGGAAGGACTGAGGGTCCAGGG + Intronic
1143975393 17:10825568-10825590 CTGGCTGGGCAGCAGGTCCTTGG + Exonic
1144795480 17:17888545-17888567 CTGTGTGGACAGCAGCTCCCTGG - Intronic
1144875008 17:18392966-18392988 CTGGTTAGACTGAAGGGCCATGG + Intergenic
1145101274 17:20079862-20079884 CTGGGTGGGCAGGAGGCGCAAGG + Intronic
1145157216 17:20551455-20551477 CTGGTTAGACTGAAGGGCCATGG - Intergenic
1145302980 17:21653734-21653756 CTAGGTAGACAGCAGGTTCAAGG + Intergenic
1145347060 17:22048107-22048129 CTAGGTAGACAGCAGGTTCAAGG - Intergenic
1146482187 17:33213705-33213727 CTGGGTGGAAAGAAGGGGAAAGG - Intronic
1147390614 17:40106980-40107002 CTGAGTGGAAAGAAGGAACAAGG + Intergenic
1147907284 17:43831643-43831665 CTGGGAGGTCAGCAGGGCCAGGG + Exonic
1148150994 17:45396385-45396407 CTGGATGGACGCAGGGTCCAGGG - Intronic
1149691951 17:58584782-58584804 ATGGGTGGGCAGATGATCCAGGG - Intronic
1150227694 17:63532763-63532785 CTGGTGGGAGAGGAGGTCCATGG + Intronic
1151268251 17:72973257-72973279 CTGGGTCAGCAGAAGGACCAGGG + Intronic
1151499856 17:74481703-74481725 CTGGGTGGGCAGGAGGTCCCAGG - Intronic
1151767421 17:76139572-76139594 CTGCGTGGACAGAATCTCCTTGG - Intronic
1151885095 17:76918737-76918759 CTGGGGAGACAGAACGTCCCAGG + Intronic
1152352726 17:79792440-79792462 CTGGCTGGAAAGAAGGTCCAAGG + Exonic
1152407294 17:80104959-80104981 CTGGGTGGGAAGAAGCACCAGGG - Intergenic
1152588112 17:81198072-81198094 GTGGGTGGACAGACTGTGCAGGG + Intronic
1152798937 17:82322191-82322213 TTGGGGGGACAGCAGCTCCAGGG + Exonic
1152944210 17:83190343-83190365 CCAGGTGGACAGAAGGACAAAGG - Intergenic
1153660943 18:7325732-7325754 CTGAGGGAACAGAAGGTGCAAGG + Intergenic
1155390683 18:25333382-25333404 GAGGGTGGGCAGAAGGGCCAGGG + Intronic
1157584694 18:48793599-48793621 CTGGGTGGCCACAGGCTCCAGGG + Intronic
1159570825 18:70110382-70110404 CTGGTTGGACAGTGGGTGCAGGG + Intronic
1162327107 19:10005986-10006008 CTGGGTGGGCAGAGGGAACAAGG + Intronic
1162439420 19:10683372-10683394 GTGGATGGACAGAAGTTCCAAGG + Exonic
1163426272 19:17242670-17242692 CTGGGTGGTGGGAGGGTCCAGGG + Intronic
1163455653 19:17404397-17404419 CTGGATGCAGAGAAGGCCCAAGG - Exonic
1163626363 19:18392126-18392148 CTGGGGGGACAGACAGACCAGGG + Intronic
1164169205 19:22709458-22709480 CGGGGAGGACAGAAGGACCCAGG + Intergenic
1165474804 19:36024388-36024410 CTGGATGGCCAGAAGGTCAGGGG - Exonic
1166309682 19:41955977-41955999 CTGGGTGCACAGTTGGTCCTTGG + Intergenic
1167208045 19:48115752-48115774 CGGGGTGGTCAGAAGCTCCCTGG + Intronic
925009400 2:470907-470929 CTGGGTGGATGGGAGCTCCAGGG - Intergenic
927990154 2:27442099-27442121 CTGTGTGGAAAGGAGGCCCACGG + Exonic
930237435 2:48901527-48901549 CTGGATGGTCAGAAGGAGCAGGG - Intergenic
930730551 2:54724219-54724241 CTCGGTGAAGAGAAGGTTCACGG + Intronic
932572501 2:72945451-72945473 CTGGGTGGTCATCAGGTCCAGGG - Intronic
938146726 2:128840609-128840631 CTGAGTTGACAGAAGGGGCATGG + Intergenic
938943535 2:136190265-136190287 CTTGGGGGACAGAGGGTCCATGG - Intergenic
942798373 2:179847960-179847982 CAGCTTGGACAGAGGGTCCATGG + Intronic
943768737 2:191692228-191692250 CTGGGTGCACAGCAATTCCAAGG - Intronic
944911122 2:204311359-204311381 CTGGGTGAGCAGCAGGTCTAGGG - Intergenic
945119104 2:206440562-206440584 GCAGGTGGCCAGAAGGTCCATGG - Intergenic
946016666 2:216609571-216609593 CTGGCAGGAATGAAGGTCCAAGG - Intergenic
946147893 2:217744557-217744579 TTGGGGGGACAGAATGTCAAAGG + Intronic
948063557 2:235060280-235060302 CTGGGCACACAGAGGGTCCAAGG + Intergenic
948762566 2:240201344-240201366 CTGGGAGGACGGGAGGTCCTGGG - Intergenic
1169711774 20:8572573-8572595 TCGGGTGCACAGAATGTCCATGG - Intronic
1171255356 20:23685920-23685942 CTGGGAGGACAGAATGTCCCTGG - Exonic
1171258665 20:23711340-23711362 TTGGGAGGACAGAATGTCCTTGG - Intergenic
1171262697 20:23747842-23747864 CTGGGAGAACAGAAGGTCCCTGG - Exonic
1171265987 20:23772802-23772824 TTGGGAGGACAGAATGTCCTTGG - Intergenic
1171271837 20:23824046-23824068 CTGGGAGGACAGAATGTCCCTGG - Exonic
1171289616 20:23974704-23974726 ATGGGTGGACAGATGGACAATGG - Intergenic
1171520501 20:25771426-25771448 CTAGGTAGACAGCAGGTTCAAGG + Intronic
1171556418 20:26085067-26085089 CTAGGTAGACAGCAGGTTCAAGG - Intergenic
1172128001 20:32636674-32636696 CGGGGAGGACAGAGGTTCCATGG - Intergenic
1172496885 20:35393640-35393662 CAGGAGGGACACAAGGTCCAAGG + Intronic
1172870897 20:38134974-38134996 AGGGGAGGACAGAAGGTCCTGGG - Intronic
1173608659 20:44350700-44350722 CTGGGGGGACAGGAGGAGCACGG - Exonic
1173938713 20:46891748-46891770 CTGGGTGCACAGAATCTCCAGGG - Intergenic
1174264908 20:49324280-49324302 CTGGCTGGACAGCTGGACCAAGG - Intergenic
1174507338 20:51024908-51024930 CTAGGTGGACAGAACATCAAAGG + Intergenic
1175760569 20:61559978-61560000 GTCGATGGACAGAGGGTCCATGG - Intronic
1175804674 20:61820861-61820883 CCAGGTGGACAGAGGGTCCTGGG - Intronic
1175988191 20:62774722-62774744 CTGTGTGAACAGAAGACCCAAGG + Intergenic
1176138918 20:63536762-63536784 CAGGGAGGACAGAGGGTCCAGGG - Intronic
1176616191 21:9029549-9029571 CCAGGTGGACACCAGGTCCAAGG - Intergenic
1176708966 21:10134188-10134210 CCAGGTGGACACCAGGTCCAAGG + Intergenic
1177241897 21:18469074-18469096 CCGGGTGGACATAAGAGCCAAGG - Intronic
1177761971 21:25412281-25412303 CTGTGTGGACAGATGGCTCAAGG + Intergenic
1178127275 21:29528617-29528639 CTGAGTGGAGGGTAGGTCCAAGG - Intronic
1179306402 21:40157371-40157393 CTGGGTGTGCTGCAGGTCCAAGG + Intronic
1179808398 21:43854612-43854634 CTGGGTGCACAGAAGGGCCAAGG + Intergenic
1180137257 21:45869695-45869717 CTCGGTGGACAGAAGGGCAGTGG + Intronic
1180293067 22:10861451-10861473 CCAGGTGGACACCAGGTCCAAGG + Intergenic
1180456590 22:15515853-15515875 CCAGGTGGACACCAGGTCCAAGG + Intergenic
1180495872 22:15890873-15890895 CCAGGTGGACACCAGGTCCAAGG + Intergenic
1181678255 22:24472089-24472111 CTGGGTAGGCAGAAGGCCTAGGG - Intergenic
1182358940 22:29735384-29735406 CTGGGTGGCCAGAGGGACAATGG + Intronic
1182476661 22:30580244-30580266 CTGGGTGGCCAGCAGGTCCCAGG - Intronic
1183467298 22:37986193-37986215 CTGGATGGACAGAGGGACGAGGG + Intronic
1184334838 22:43847076-43847098 CAGGCTGGAGAGAAGGGCCACGG - Intronic
1184651153 22:45920037-45920059 CTGCGGGGACAGGAGGGCCATGG - Intergenic
1184859704 22:47166195-47166217 CAGTGTGCACAGAGGGTCCAGGG + Intronic
1185285943 22:49999929-49999951 CTGGGTGGACCGGAGGCGCAAGG - Exonic
1185402461 22:50626017-50626039 CAGGGTAGGCAGCAGGTCCAGGG + Exonic
950955058 3:17044160-17044182 CTGTGTGCAGAGAATGTCCATGG + Intronic
951891951 3:27575788-27575810 CTGGTTGGTCAGATGTTCCAGGG - Intergenic
952043472 3:29288410-29288432 GTGGGTGGATAGAAGTTCCCAGG + Intronic
952842850 3:37662821-37662843 CTGTGTAGACAGTTGGTCCATGG + Intronic
954705603 3:52479028-52479050 TTGGGAGAACAGAAGGTCCAAGG - Intronic
956617337 3:71185582-71185604 CTGGGTAGACAGATAGTCCCAGG + Intronic
960248151 3:115422374-115422396 CAGGATGGACAGAAGGGCAAAGG + Intergenic
965066284 3:163854680-163854702 CTGGGTGGACAAGTGGTGCATGG + Intergenic
966883820 3:184363621-184363643 CTGGGTGGACACGGGGCCCAGGG - Intronic
968726650 4:2251000-2251022 CTGGGTGGAGAGGAGGTGCCTGG - Intronic
970205909 4:13655212-13655234 CAGGCTGGACAGAAGTTCCAGGG - Intergenic
973918689 4:55662724-55662746 CTGGGTGAAGAGCAGGACCAGGG - Intergenic
974810545 4:66940307-66940329 CTGGGTGGAAAGAAGCTAGAAGG + Intergenic
975895048 4:79079038-79079060 CTGGTTGATCAGAAGTTCCAGGG - Intergenic
978843932 4:113249486-113249508 CTGTGTGGACAGAGGGTCAATGG - Intronic
981632679 4:146838976-146838998 CTGGCTGGACAGAGGGGTCAGGG - Intronic
982453929 4:155585423-155585445 CTGGATGGAGACTAGGTCCATGG + Intergenic
983804367 4:171975616-171975638 CTGGGTGGACAAAAGGGCAAGGG + Intronic
985542397 5:492956-492978 AAGGGTGGACAGCAGGTCCTGGG + Intronic
985630756 5:1012786-1012808 CTGGGTGGCCAGGAGGGGCAGGG - Intronic
985898686 5:2767566-2767588 CTGGGTGGCAAGAAAGTACATGG - Intergenic
986705750 5:10453332-10453354 CTGGGTAGACAGGAGGTGCTCGG + Intronic
990714229 5:58618621-58618643 CTATGTGGATAGCAGGTCCAAGG + Intronic
992048844 5:72925549-72925571 CTGGGTGGGCACAGGGTCCACGG + Intergenic
994690295 5:103010457-103010479 CTGAGAAGACAGAAGGGCCATGG - Intronic
995341952 5:111070473-111070495 CTGGGTGTAGAGAGGGCCCAGGG + Intronic
995793340 5:115916945-115916967 TGGGGTGAAGAGAAGGTCCAAGG - Intergenic
995836745 5:116407013-116407035 TTAGGTGCACAGAAGGGCCAAGG - Intronic
995993333 5:118269231-118269253 CAGGAAGGACAGAAGGTTCAAGG - Intergenic
997672093 5:135683596-135683618 CTGGGTGGTCAGCAGCACCAAGG + Intergenic
999134323 5:149307719-149307741 CTGTGTGCACAGAAGCTCAAAGG + Intronic
999305990 5:150519950-150519972 CTGGGTGGACAGAAGGTCCAGGG + Intronic
1002235642 5:177800578-177800600 CTGGGTGGACATAGGCCCCAGGG + Intergenic
1002804661 6:561313-561335 CTGGCTGGATAGAGAGTCCAAGG + Intronic
1003973240 6:11319147-11319169 CTGAGTGGGCAGAAGAGCCAGGG - Intronic
1004128117 6:12893570-12893592 CTAGGGGTACAGCAGGTCCAAGG - Intronic
1012424268 6:99096727-99096749 CTGGGAGGAGGGAAGGTCTAGGG + Intergenic
1015769023 6:136750058-136750080 CTGGAAGGACAGAAGGCCAATGG - Intronic
1018379301 6:163243279-163243301 CTGTGAGGACAGAAGTTCCACGG + Intronic
1019210953 6:170404198-170404220 CTGTGTTGGCAGAACGTCCATGG + Intronic
1019215264 6:170439040-170439062 CTGGGGGGACAGAAGGCTGAGGG + Intergenic
1024689287 7:51781691-51781713 CTGGGTGGACTGACTGTCAAAGG + Intergenic
1024743683 7:52383069-52383091 CTGGGTGGTCAGAAGTTCTCCGG + Intergenic
1025280991 7:57626390-57626412 CTAGGTAGACAGCAGGTTCAAGG + Intergenic
1025303738 7:57839117-57839139 CTAGGTAGACAGCAGGTTCAAGG - Intergenic
1026907813 7:74072793-74072815 CTGAGTGGAGAGAAGGCCGAAGG - Intergenic
1027421485 7:78021147-78021169 CTTAGTGGCCAGAAGCTCCAGGG - Intronic
1028648244 7:93121472-93121494 CTGAAAGGTCAGAAGGTCCAGGG - Intergenic
1029176045 7:98665147-98665169 CAGGGAGGCCAGAAGGTCCCAGG - Intergenic
1029424274 7:100486672-100486694 CAGGGTTGCCAGAAGGTCCAGGG - Intronic
1030087874 7:105832573-105832595 GTTGGTGCACAGAAGGTGCAGGG - Intronic
1030290876 7:107871566-107871588 CTGTGTGGAGAGAAAGGCCATGG + Intergenic
1030372251 7:108713665-108713687 CTGGGTGGAAGAAAGGTCGAGGG + Intergenic
1033447612 7:141436499-141436521 ATGGGTGGAGAGAGGGCCCAGGG + Intronic
1034970160 7:155413680-155413702 CTGGGTGGGGAGCAAGTCCACGG + Intergenic
1035132569 7:156669463-156669485 CTGCCTGGACAGAGGTTCCAGGG - Intronic
1039438947 8:37581394-37581416 CTGGGGGCACAGAAGGAACATGG - Intergenic
1039484706 8:37901291-37901313 CTGGGTGCACAGTAGGTACCCGG + Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1046271957 8:111908008-111908030 CTGGGTAAATAAAAGGTCCAAGG - Intergenic
1048349450 8:133604177-133604199 CTGGGTGAACAGACAGTCCCAGG - Intergenic
1048617700 8:136095887-136095909 AAGTGTGGGCAGAAGGTCCATGG + Intergenic
1048801044 8:138193992-138194014 CTGGGTAGACAGGAGGCCCTGGG - Intronic
1049016170 8:139921717-139921739 CTGAGTGGACAGAGGGGCCGGGG + Intronic
1049658300 8:143808550-143808572 CTGGGTGCCCAGGAGGGCCAGGG + Intronic
1049853677 8:144848579-144848601 CAGGGTGGACAGAAACTTCATGG + Intronic
1049967482 9:792411-792433 CTGGCGGAACAGAAGCTCCATGG - Intergenic
1053203837 9:36170352-36170374 CTCGGTGGCCAGAAGGCCCACGG + Exonic
1057392709 9:94652901-94652923 CTGGGGGGCCAGATGGTGCAGGG - Intergenic
1057942054 9:99293798-99293820 CTGGGAGGAAAGATGGTCCCGGG - Intergenic
1058634573 9:107024023-107024045 TTGTGTAGACAGATGGTCCATGG - Intergenic
1061715301 9:132514984-132515006 CTGGGAGGACAGAAGTGCCGGGG + Intronic
1062076534 9:134592952-134592974 CTGGGTGGTCCAAAGTTCCAGGG - Intergenic
1062383549 9:136299172-136299194 CTGGATGGACAGGAGTTCCCCGG + Intronic
1062464837 9:136676372-136676394 CTGTGTGGGCAAAAGGCCCAAGG + Intronic
1062585905 9:137249919-137249941 CTAGTTGGTCAGAAGTTCCAGGG + Intergenic
1202793727 9_KI270719v1_random:103158-103180 CCAGGTGGACACCAGGTCCAAGG + Intergenic
1187103997 X:16221761-16221783 CTGGTTGGTCAGAGGGCCCAAGG + Intergenic
1187429787 X:19211467-19211489 CTGACTGGACAGGGGGTCCAAGG + Intergenic
1189217737 X:39341623-39341645 CTGGGTGGGCAGAAGGGATATGG - Intergenic
1192150279 X:68707831-68707853 CTGAGTGACCAGAAGGTACAAGG + Intronic
1194187538 X:90791853-90791875 TTGGGTGGAGAGAAGGTGAAAGG - Intergenic
1195338117 X:103877320-103877342 ATGGGAGGACAAATGGTCCAAGG - Intergenic
1198110701 X:133500349-133500371 CTTGTTGGACAACAGGTCCAAGG + Intergenic
1199178823 X:144827700-144827722 CTGAGTGGAAAGATTGTCCATGG - Intergenic
1199671944 X:150155010-150155032 CAGGATGCACAGAAGGACCAGGG - Intergenic
1199976353 X:152897146-152897168 GTGGGTGGACTGGAGGGCCATGG + Intergenic
1200534128 Y:4373807-4373829 TTGGGTGGAGAGAAGGTGAAAGG - Intergenic