ID: 999309115

View in Genome Browser
Species Human (GRCh38)
Location 5:150540192-150540214
Sequence GACACTGCCCCCTGTGCAGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 175}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999309108_999309115 19 Left 999309108 5:150540150-150540172 CCTGGTGCGCTTCCTGCACTCCT 0: 1
1: 0
2: 1
3: 15
4: 198
Right 999309115 5:150540192-150540214 GACACTGCCCCCTGTGCAGTTGG 0: 1
1: 0
2: 0
3: 14
4: 175
999309112_999309115 -1 Left 999309112 5:150540170-150540192 CCTGGACGAACCTCCGGCTGCAG 0: 1
1: 0
2: 0
3: 7
4: 76
Right 999309115 5:150540192-150540214 GACACTGCCCCCTGTGCAGTTGG 0: 1
1: 0
2: 0
3: 14
4: 175
999309110_999309115 7 Left 999309110 5:150540162-150540184 CCTGCACTCCTGGACGAACCTCC 0: 1
1: 0
2: 0
3: 6
4: 143
Right 999309115 5:150540192-150540214 GACACTGCCCCCTGTGCAGTTGG 0: 1
1: 0
2: 0
3: 14
4: 175
999309107_999309115 29 Left 999309107 5:150540140-150540162 CCTTCAAGCACCTGGTGCGCTTC 0: 1
1: 0
2: 1
3: 7
4: 66
Right 999309115 5:150540192-150540214 GACACTGCCCCCTGTGCAGTTGG 0: 1
1: 0
2: 0
3: 14
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999309115 Original CRISPR GACACTGCCCCCTGTGCAGT TGG Exonic
900354957 1:2256576-2256598 GCCACAGCACACTGTGCAGTTGG + Intronic
900611759 1:3547222-3547244 GACAATGTCCCCTGTGCTGTGGG - Intronic
901638301 1:10680484-10680506 GGCACTGCCCCCTCTGCCCTAGG + Intronic
904379620 1:30102001-30102023 GACACTGCACCTTGTCCAGGAGG + Intergenic
905283182 1:36861989-36862011 TTCACAGCCCCCTGTGAAGTAGG + Intronic
905584494 1:39105899-39105921 GAAACCGCCCCCGGGGCAGTCGG + Intronic
906204951 1:43981670-43981692 GACACTGTCCTGTCTGCAGTGGG + Exonic
906452056 1:45958668-45958690 GACACTGCCTAGTGTGTAGTAGG + Intronic
907668252 1:56451795-56451817 GGCAATGCCCTCTGTGCAGGAGG - Intergenic
909447955 1:75768388-75768410 GACTCAGCCCCCTGTGTAGCTGG - Intronic
912482731 1:109996374-109996396 GACGCTGCACCCTGAGCAGATGG - Intronic
915412707 1:155715086-155715108 GACACAGCCTCCTGAGCAGCTGG - Intronic
916215009 1:162386589-162386611 TACACTTCCCTCTGTGCAGGGGG - Intronic
918464018 1:184803608-184803630 CACACTTCCCACTGTGCAGAAGG - Exonic
920404986 1:205702302-205702324 GACACTGCCACATGTCCACTGGG - Intergenic
924366932 1:243304100-243304122 GTCATTGACCCCTGTACAGTTGG - Intronic
1064130825 10:12708196-12708218 CACTCTGCCACCTGTGCTGTGGG + Intronic
1069443949 10:68455704-68455726 GACACAGCCCCCTGAGTAGCTGG - Intronic
1071497616 10:86179625-86179647 GACACTGTCCCGTGGCCAGTTGG - Intronic
1074552696 10:114459570-114459592 TACACTGCTCCCTGTGGAGCAGG + Intronic
1076410440 10:130245210-130245232 TACACTGCCCCATGGGCAGGTGG + Intergenic
1076567669 10:131410006-131410028 GAAACTGCCCCCACTGCAGCGGG + Intergenic
1076692345 10:132230304-132230326 GACTCTGCCCCGTTGGCAGTGGG - Intronic
1076849732 10:133087003-133087025 GACACTGGCGCCTGTTCAGGGGG - Intronic
1087082389 11:94184079-94184101 GAAACTTCCACCTGTACAGTGGG + Intergenic
1087317759 11:96624085-96624107 GAAAATGCCTCCTGTGCAGATGG - Intergenic
1088062746 11:105676310-105676332 GAAACTGCCTCCTGTGTACTTGG - Intronic
1089291114 11:117438439-117438461 GACACGGCCCCCTGAGCAGCAGG + Intronic
1090435581 11:126684071-126684093 GACCCTGCCACCTGCTCAGTGGG + Intronic
1093092065 12:14933142-14933164 AACAGTGCCTGCTGTGCAGTAGG - Intronic
1101158193 12:101947325-101947347 GACACTGCCTTCAGTGCTGTGGG + Intronic
1101870700 12:108562984-108563006 GACCCTGCCTCCTGGGCTGTTGG - Intronic
1103522899 12:121548323-121548345 GACAGTGCCCTCTGAGCAGGAGG - Intronic
1103918228 12:124386745-124386767 GGCACTGCCTCCGGTGCAGCAGG - Intronic
1103984751 12:124759891-124759913 GACACTGCCACCTGTGCCATGGG - Intergenic
1104880814 12:132069214-132069236 GACACTGCTCCCTGAATAGTCGG - Intronic
1104901455 12:132191455-132191477 GAGAGCGCCCGCTGTGCAGTGGG + Intergenic
1105468842 13:20673387-20673409 GACACTGTCCCCTGGGCTCTGGG - Intronic
1105724027 13:23142836-23142858 GTCACTGCCACCAGTGCAGCCGG - Intergenic
1113834347 13:113319006-113319028 GACACTGCTCCCTGAGCTGTCGG - Intronic
1114505452 14:23208871-23208893 GACTCAGCCCCCTGAGTAGTTGG + Intronic
1119378076 14:74210940-74210962 GGCACTGCCTCCTGAGCAGCAGG - Intergenic
1122341570 14:101031800-101031822 CACAATGCCACCTGTGCAGAGGG + Intergenic
1122429511 14:101631036-101631058 CATACTTCCCCCTGTGCAGAAGG - Intergenic
1122753138 14:103954455-103954477 GACAGTGCCTTTTGTGCAGTAGG + Intronic
1122861659 14:104585228-104585250 CACACTGCCCCCTATCCAGCTGG + Intronic
1122893051 14:104741872-104741894 CACACCGCCCACGGTGCAGTTGG - Exonic
1127857688 15:62966238-62966260 GACATTGCCCCCTGTGGACAGGG + Intergenic
1131154641 15:90067431-90067453 GACGCGGCCACCTGTGCGGTTGG + Exonic
1132777280 16:1602032-1602054 GACACTGCCCCATGTCCCCTGGG + Intronic
1134213452 16:12297218-12297240 CACACTGCCCCGTGTGTGGTGGG - Intronic
1135206102 16:20485254-20485276 GACACTGCACACTGTGTGGTAGG - Intronic
1136561166 16:31039999-31040021 CACACTGGCCCCTATGCAGAAGG + Exonic
1137581693 16:49637514-49637536 GGCACTGCCCACACTGCAGTGGG + Exonic
1139019532 16:62730090-62730112 GACACAGCTTTCTGTGCAGTGGG - Intergenic
1139353178 16:66350732-66350754 GAGCATGCACCCTGTGCAGTAGG + Intergenic
1141443825 16:84045584-84045606 GACACTGGCTCCAGTGCAGCAGG + Intergenic
1141543028 16:84741522-84741544 CACCCTCCTCCCTGTGCAGTGGG + Intronic
1142116047 16:88356729-88356751 GACGCAGCCCCATGTGCAGAGGG + Intergenic
1142432899 16:90040156-90040178 CACACTGACCCCGGTGCTGTGGG + Intronic
1146456507 17:33013583-33013605 CACACTGCTGCCCGTGCAGTGGG - Exonic
1147567307 17:41545807-41545829 CTCACTGCTCCCTGTGCGGTGGG + Intergenic
1149922452 17:60672526-60672548 GCCACTGCGCCCGGTGCATTTGG + Intergenic
1151477105 17:74350408-74350430 CACCCTGCCCGCTGTGCAGCTGG - Exonic
1151655506 17:75494013-75494035 GCCACTGCCCCCTTTGCTGTGGG - Intronic
1151727217 17:75892128-75892150 GCCACTGACCCCTCTGCAGTGGG - Exonic
1153992341 18:10411583-10411605 CACACTGATCACTGTGCAGTGGG + Intergenic
1154386286 18:13895382-13895404 GACACTTCCCCCTGTCTAGGAGG - Intronic
1154949817 18:21198820-21198842 GCCACAGCCTCCTGTGTAGTTGG + Intergenic
1156608426 18:38696988-38697010 GACATTGCCCCCTATTCAGACGG + Intergenic
1161044596 19:2128481-2128503 GACACTGCACCCCGTGGAGCCGG + Intronic
1161044608 19:2128520-2128542 GACACTGCACCCCGTGGAGCCGG + Intronic
1161044620 19:2128559-2128581 GACACTGCACCCCGTGGAGCCGG + Intronic
1161044634 19:2128599-2128621 GACACTGCACCCCGTGGAGCCGG + Intronic
1161044648 19:2128639-2128661 GACACTGCACCCCGTGGAGCCGG + Intronic
1161044660 19:2128678-2128700 GACACTGCACCCCGTGGAGCCGG + Intronic
1161044674 19:2128718-2128740 GACACTGCACCCCGTGGAGCCGG + Intronic
1161044686 19:2128757-2128779 GACACTGCACCCCGTGGAGCCGG + Intronic
1161044700 19:2128797-2128819 GACACTGCACCCCGTGGAGCCGG + Intronic
1161044712 19:2128836-2128858 GACACTGCACCCCGTGGAGCCGG + Intronic
1161044726 19:2128876-2128898 GACACTGCACCCCGTGGAGCCGG + Intronic
1161044754 19:2128956-2128978 GACACTGCACCCCGTGGAGCCGG + Intronic
1161044768 19:2128996-2129018 GACACTGCACCCCGTGGAGCCGG + Intronic
1161044782 19:2129036-2129058 GACACTGCACCCCGTGGAGCCGG + Intronic
1162729005 19:12706415-12706437 GACACTGGGCCATGGGCAGTTGG + Intronic
1164933715 19:32195230-32195252 GACCCTGCACACTGTGCAGGTGG + Intergenic
1165142966 19:33713413-33713435 GCCACTGCAGCCTGGGCAGTTGG + Intronic
1165633065 19:37317928-37317950 CACACTGGCCACTGTGCACTCGG - Intronic
1167136660 19:47620378-47620400 GCCACTGCGCCCTGGCCAGTGGG - Intronic
1167677693 19:50897713-50897735 GGCACTGCCCTGTGTGCTGTAGG + Intergenic
927113107 2:19878307-19878329 GACACTGGCACCTGAGCCGTAGG + Intergenic
928344141 2:30474761-30474783 GGCACAGCCTCCTGTGTAGTTGG + Intronic
928554692 2:32411591-32411613 GCCACAGCCTCCTGAGCAGTGGG + Intronic
935476194 2:103527110-103527132 GACACTGGGGCCTGTGCAGCAGG - Intergenic
936243919 2:110810127-110810149 GACACTTCCTCCTGAGCAGAAGG + Intronic
938384049 2:130852237-130852259 GACAGCGTCACCTGTGCAGTGGG + Intronic
939940150 2:148339593-148339615 AACACTGGCCCCTGAGCAGAAGG + Intronic
948460709 2:238128695-238128717 GTCTCTGTCCCCTGTGCAGAAGG - Exonic
948647088 2:239412114-239412136 GCAACTGCCCCCTGTGGAGCAGG + Intergenic
1170011326 20:11727332-11727354 ACTACTGCCCCCTGTGCACTAGG + Intergenic
1170183852 20:13564889-13564911 GCCACAGCCTCCTGTGTAGTTGG - Intronic
1170705263 20:18738710-18738732 GACATTGCCACCTCTGAAGTAGG + Intronic
1171459141 20:25288737-25288759 GACACTGCCCTCTCTGAGGTGGG - Intronic
1175264082 20:57692178-57692200 TACGATGCCCCCTGTGTAGTGGG + Intronic
1175300905 20:57942121-57942143 CACACTGCCTCCCCTGCAGTGGG - Intergenic
1175320836 20:58087117-58087139 GGTACTGCCCCTGGTGCAGTGGG - Intergenic
1176102441 20:63370597-63370619 GACTTTGCCCCCTGAGCAGGAGG + Intronic
1176369417 21:6053487-6053509 GACTTTGCCCCCTGCGCACTTGG + Intergenic
1179584312 21:42365247-42365269 AGCTCTGCCCCCTGTGCTGTGGG - Intronic
1179754102 21:43485054-43485076 GACTTTGCCCCCTGCGCACTTGG - Intergenic
1180732651 22:17993693-17993715 GACTCTGCCCCCTGAGAAGCAGG + Intronic
1183714363 22:39525147-39525169 GACACTGGCCCATGGGCAGGTGG + Intergenic
1184535521 22:45084111-45084133 GTCACTGCTGCCTGTGCAGGGGG - Intergenic
1185181747 22:49367538-49367560 GAAATTGCCCTCTGTGCTGTGGG - Intergenic
949586725 3:5447396-5447418 GTCTCTGCCCCCTGAGTAGTTGG - Intergenic
950095003 3:10323884-10323906 GAGACTGCCCGCTGAGCTGTGGG + Intergenic
950447695 3:13047752-13047774 CCCACTGCCCCCTGTTCAGATGG + Intronic
951406527 3:22306545-22306567 GACACTGCCGTCTATGCAGTGGG + Intronic
952950926 3:38524568-38524590 GCCTCTGCCCCCTGAGCAGCTGG + Exonic
953665895 3:44926252-44926274 GCCACTGCCTCCTGGGCAGTGGG + Exonic
954218517 3:49138019-49138041 GACCCTGCCCACTGTTCAGTGGG - Intergenic
954603950 3:51894430-51894452 GACATAGCCCCCAGTGCAGCAGG + Intergenic
961203008 3:125059186-125059208 TTCCCAGCCCCCTGTGCAGTTGG - Intergenic
961297683 3:125900003-125900025 GACCCAGCCCACTGTGTAGTGGG + Intergenic
964372496 3:156015575-156015597 GACCCCCTCCCCTGTGCAGTTGG + Intergenic
969228251 4:5812826-5812848 GACACTGCCCCGTGTCCATGGGG + Exonic
969636012 4:8369937-8369959 GACACAGCCCCATAAGCAGTGGG + Intronic
969755686 4:9148799-9148821 GACACTGCCCTCTGTGGTGGTGG - Intergenic
969884590 4:10204050-10204072 CACACTGGCCCCAGTGCTGTTGG - Intergenic
970700101 4:18726387-18726409 GATAATGCTCCCTGTGCAATTGG - Intergenic
976941351 4:90705692-90705714 CTCACTGCCTCCTTTGCAGTTGG + Intronic
979863564 4:125724328-125724350 GACATTGCCCCCAGCACAGTGGG - Intergenic
982020562 4:151199570-151199592 GCCTATGCCCCCTGTGCAGCAGG - Intronic
985635569 5:1034160-1034182 GATCCTTCCCCCTGTGGAGTTGG + Intronic
990958007 5:61363142-61363164 GGCAGTGCCCCCTGTGGGGTGGG - Intronic
991931396 5:71756378-71756400 GGCTCTGCCCCCTGTGCAGGCGG + Intergenic
992911656 5:81401232-81401254 GACACTGCCCTGAGTCCAGTGGG - Intergenic
994267882 5:97739338-97739360 GCCACTGCCTCCTGGGCAGTGGG - Intergenic
995206250 5:109484875-109484897 GGCTCTGCCCCTTGTGCAGTCGG + Intergenic
995780866 5:115774080-115774102 GACTCTGCCTCCTGAGCAGCTGG + Intergenic
996702902 5:126467440-126467462 GACACTGGCCCCTGTGGACAGGG - Intronic
997214887 5:132102213-132102235 GACCCTGGCCCCTGTGCTGCAGG - Intergenic
998313812 5:141160698-141160720 CAAACTGCCAGCTGTGCAGTAGG - Intergenic
999309115 5:150540192-150540214 GACACTGCCCCCTGTGCAGTTGG + Exonic
1004098915 6:12588012-12588034 GACACTTCCTCCTTTGCAGGTGG - Intergenic
1005252387 6:23962336-23962358 GACACTGAGCCAGGTGCAGTGGG + Intergenic
1006521285 6:34572683-34572705 GTGCCTGCCCCCTGTGCGGTAGG - Intergenic
1007292427 6:40797720-40797742 GACACTGCTCCCAGTGCTGAGGG - Intergenic
1007507372 6:42346346-42346368 GAGTCGGCCCCCTGTGCAGGAGG - Intronic
1009614961 6:65991848-65991870 TTCACTGTCTCCTGTGCAGTTGG - Intergenic
1009969533 6:70612319-70612341 CACACCACCCCCTCTGCAGTCGG + Intergenic
1011297688 6:85841212-85841234 GACAGTGCTCCCTGTGGGGTGGG + Intergenic
1015880410 6:137866269-137866291 GATGCAGCCCCCTGGGCAGTGGG - Intergenic
1018484309 6:164225497-164225519 GTCTCAGCCGCCTGTGCAGTTGG + Intergenic
1018815217 6:167325294-167325316 GACCCTGGCCCCTGTGCTCTCGG - Intronic
1019925576 7:4190162-4190184 GACAGTGCAGCCTGTGGAGTCGG - Intronic
1021840372 7:24717390-24717412 CACACTCCCACCTGTGCACTCGG + Intronic
1022887190 7:34658420-34658442 GAAGCTGCCCTCTGTGAAGTTGG - Exonic
1023999896 7:45183270-45183292 GACCCTGTCCACGGTGCAGTTGG - Exonic
1024249326 7:47494531-47494553 GAAACTGCCCCCTGTTCAGAAGG - Intronic
1025022509 7:55490558-55490580 CCCACTGCCCCCAGTGCAGAAGG - Intronic
1025148096 7:56522571-56522593 GCCTCTGCCCCCTGAGTAGTTGG - Intergenic
1026324805 7:69299820-69299842 GACACTGGCCCCTCTGCCATGGG - Intergenic
1029316700 7:99722220-99722242 GAGACTATCCTCTGTGCAGTGGG + Intronic
1029322592 7:99777952-99777974 GAGACTGTCCTCTGTGCAGTGGG + Intronic
1032708218 7:134440558-134440580 GACATTTGCCCCTGTGAAGTTGG - Intergenic
1033756864 7:144403477-144403499 CTCACTGCCCCCTGTGCTTTGGG - Intronic
1035914892 8:3608232-3608254 GACACTACCTCCTCTGCAGGTGG - Intronic
1038010991 8:23475648-23475670 CGCACTGCCCCCTGGGCAATAGG - Intergenic
1039595585 8:38787603-38787625 GATCCTGTCCCCCGTGCAGTGGG + Exonic
1040412097 8:47164799-47164821 AAAAGTGGCCCCTGTGCAGTGGG + Intergenic
1042637485 8:70894524-70894546 CACACTGCCCCCTGGGGAATTGG - Intergenic
1043956006 8:86360490-86360512 GGTTCTGCCCCCTATGCAGTAGG + Intronic
1043979261 8:86619133-86619155 GAAACAGCCCCCAGTTCAGTAGG - Intronic
1045191510 8:99888868-99888890 GAAGCTGCACCTTGTGCAGTGGG + Intronic
1047638975 8:126797781-126797803 GACACTGCCCAATGTCCACTGGG + Intergenic
1048499231 8:134960691-134960713 CACAATGCCCAGTGTGCAGTAGG - Intergenic
1048793092 8:138122439-138122461 CTCATTGCCCCCTCTGCAGTCGG + Intergenic
1052019771 9:23512159-23512181 AACTCTGCCCCTTGAGCAGTTGG - Intergenic
1054455377 9:65427581-65427603 GCCACTGCCCCCCGTGCCCTTGG + Intergenic
1055504349 9:76932543-76932565 GACACTTCCCCCTCTCCATTTGG - Intergenic
1059295297 9:113264988-113265010 GACCCTGTCTCCTGTGCAGAAGG - Intronic
1059713602 9:116892679-116892701 TACAGTGCCCTCTCTGCAGTGGG - Intronic
1061503070 9:131014624-131014646 TACCCAGCACCCTGTGCAGTGGG - Intronic
1062283718 9:135763639-135763661 GCCTCTGCCCCGTGTGCACTTGG + Intronic
1187799382 X:23043434-23043456 GACATTGAGCACTGTGCAGTTGG - Intergenic
1190311053 X:49117278-49117300 GACTCTGACCCCTGAGAAGTGGG + Intronic
1192208789 X:69113670-69113692 CACCATGCCCCCTGTGAAGTAGG - Intergenic
1199685192 X:150259118-150259140 GGCACTGCTCCCTAGGCAGTTGG + Intergenic
1201962993 Y:19702672-19702694 GGCAATGCACCCTGTGAAGTAGG + Intergenic