ID: 999309888

View in Genome Browser
Species Human (GRCh38)
Location 5:150545159-150545181
Sequence AACAAGGACTTGCCTCCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 83}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999309888_999309894 13 Left 999309888 5:150545159-150545181 CCCACTGGAGGCAAGTCCTTGTT 0: 1
1: 0
2: 0
3: 12
4: 83
Right 999309894 5:150545195-150545217 AGCTTCCCACTTGCTCTCTGAGG 0: 1
1: 0
2: 3
3: 24
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999309888 Original CRISPR AACAAGGACTTGCCTCCAGT GGG (reversed) Intronic
900322531 1:2092221-2092243 ATCAAGGATTCGCCTCCCGTAGG - Intronic
905877194 1:41439815-41439837 CACAAGGTCTTGCTTCCAGCTGG - Intergenic
907078848 1:51602804-51602826 CACAAGGACTAGCATGCAGTGGG + Intronic
917669154 1:177256353-177256375 AACAAGCACTTGCCAGCAGGGGG + Intronic
918590815 1:186238936-186238958 AACAAGGACTTCCATCAAGAAGG - Intergenic
922192158 1:223328842-223328864 AGCCAGGACTTGCCTCCACTAGG - Intronic
1065685762 10:28283028-28283050 AACAATGTCATGCCTGCAGTGGG + Intronic
1069994345 10:72333336-72333358 AAACAGCACTTGCCGCCAGTGGG - Exonic
1070676826 10:78417674-78417696 GACAAGGACTTGCCACCACTGGG - Intergenic
1071436842 10:85655290-85655312 CACAGGGACTTGGATCCAGTGGG - Intronic
1071928180 10:90435599-90435621 AACAAGGTGGTGCCTCCAGAAGG + Intergenic
1076138440 10:128060964-128060986 AACAGGGAATTCCATCCAGTTGG - Exonic
1078490540 11:11764022-11764044 AACAAGCACCTGCCTCCACGGGG + Intergenic
1078717422 11:13853470-13853492 AACAATGCCTGGCATCCAGTAGG + Intergenic
1081282239 11:41223933-41223955 ATCAAGCACTGGCCTCCAGAAGG - Intronic
1084103901 11:66968120-66968142 AACAAGGTCTTGCCCACAGCAGG + Intergenic
1085159978 11:74331600-74331622 CTCAAGGACTTGCCTCCACTGGG + Exonic
1085230566 11:74965644-74965666 ACCAAGTAGTTCCCTCCAGTTGG - Intronic
1091099887 11:132861924-132861946 AACAAGTACCAGCATCCAGTAGG - Intronic
1092803181 12:12191933-12191955 AACAAGGAAATGACTCCAGATGG + Intronic
1093378324 12:18458683-18458705 AGCAAAGATTTGCCTCCAGCTGG + Intronic
1095558367 12:43535921-43535943 AACAAGGACTTGCACTCTGTTGG + Intronic
1096760445 12:53837092-53837114 AACCAGGATTTGCATCCAGGAGG - Intergenic
1098279769 12:68850599-68850621 ACAAAGAATTTGCCTCCAGTAGG - Exonic
1102694724 12:114789866-114789888 CTCAAGGAGCTGCCTCCAGTGGG - Intergenic
1110851262 13:80247495-80247517 AACAAGTTTTTGCCTCCAGTGGG - Intergenic
1111584699 13:90269264-90269286 AACAAGTACTTGCCACTAGAAGG - Intergenic
1113283784 13:108822418-108822440 AAGAAGCAGCTGCCTCCAGTAGG + Intronic
1117228373 14:53687593-53687615 AACAAGGACTTGGGTACAGATGG - Intergenic
1121308906 14:92924137-92924159 AGAAAGGACTGGCCTCCACTTGG + Intronic
1123672398 15:22672444-22672466 AAGAAGCACTTGCCTCAACTAGG + Intergenic
1124433887 15:29632013-29632035 AAAAAGGACTTCCGTCCTGTGGG + Intergenic
1129723026 15:77888284-77888306 AACATTGAGTTGCCTCCAATAGG + Intergenic
1132128097 15:99247698-99247720 AACCAGGACTTGCCTGCAAATGG + Intronic
1132215811 15:100060900-100060922 AAAAAGGCCTTGTCTCCACTCGG - Intronic
1133609531 16:7419823-7419845 AAAAAGGACATGCCTCCATTAGG - Intronic
1134262025 16:12658904-12658926 AAAAAGGAATTGACTCCAGCTGG - Intergenic
1135044254 16:19141857-19141879 AACAAGGTCTTGCTCACAGTAGG + Intronic
1138034492 16:53590689-53590711 AACAAGGGCTTGCATGCAGGTGG + Intergenic
1139613033 16:68072582-68072604 GTCAAGGACTTGCCACCAGCCGG + Intronic
1140700797 16:77579930-77579952 AATGATGGCTTGCCTCCAGTTGG + Intergenic
1148560952 17:48605705-48605727 AACCTGGACTTGCCTGCATTTGG - Intergenic
1148584694 17:48769087-48769109 TACAAGGCCTTGGATCCAGTTGG + Exonic
1150851065 17:68704121-68704143 CTCAAGGGCTTGACTCCAGTAGG + Intergenic
1155788524 18:29933397-29933419 AACAAGGACAGGGCTACAGTGGG + Intergenic
1156191761 18:34728605-34728627 AACAAGGACTTGGGTACAGTTGG + Intronic
1157083162 18:44550296-44550318 ATCAAGAAATTGCCTCCATTTGG + Intergenic
1158028987 18:52939453-52939475 AATAAGGACTTCACTCCAGTGGG - Intronic
1160845408 19:1164028-1164050 ACCAAGGACCTCCCTCCAGGTGG + Intronic
1161394072 19:4035418-4035440 AACCAGGGCCTGCCTCCAGTTGG + Intronic
1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG + Exonic
1162602828 19:11682320-11682342 AACAAGGACATGCCTCTCATTGG - Intergenic
1162757010 19:12866573-12866595 AACCAGGACTGGGCTCCTGTGGG + Intronic
1168515686 19:57008812-57008834 AAATAGGACTTCCCACCAGTGGG + Intergenic
926046815 2:9716093-9716115 AGCATGGACTTGCTTCCACTGGG - Intergenic
928944270 2:36758269-36758291 AAAAATGACTTGCCTTCAGGGGG + Intronic
933199178 2:79429022-79429044 AACAATGAGGTGCCTCCAGCTGG - Intronic
942144592 2:173014279-173014301 AACAAGGAATTGCATGCATTCGG + Intronic
947282965 2:228476847-228476869 AAGAAGGACATACCTCCTGTTGG + Intergenic
948394321 2:237633118-237633140 AACAACATCCTGCCTCCAGTTGG + Intronic
1176138141 20:63534009-63534031 ACCATGGGCTTCCCTCCAGTGGG + Intronic
1181237484 22:21456440-21456462 AACAATGAGTTGCCTCCTGCAGG + Intergenic
1181952268 22:26563182-26563204 AACAAGGCCTGGCACCCAGTAGG - Intronic
1182446003 22:30390061-30390083 AACAAGGACCTGCATCTGGTTGG - Intronic
951710014 3:25577632-25577654 ACCCAGGAGCTGCCTCCAGTGGG + Intronic
953731624 3:45454627-45454649 AACATGGAATTGGCTTCAGTAGG + Intronic
956728374 3:72175485-72175507 CACAAGGACAAGCCTCAAGTTGG + Intergenic
964049652 3:152374798-152374820 ACAAAGGATTTGCCGCCAGTGGG - Intronic
967403674 3:189092822-189092844 AACAGGGCCTTGCATGCAGTAGG - Intronic
970429614 4:15976825-15976847 AGGAATGACTTGCCTCCAGCTGG + Intronic
974711990 4:65609299-65609321 AAAAAAGACTTGCATCAAGTAGG + Intronic
978988071 4:115040903-115040925 AACAAGTAATTGCCCACAGTTGG + Intronic
981832583 4:149019520-149019542 AACAATGACTTGCCCCAAATGGG - Intergenic
985756557 5:1723013-1723035 AACATGGACTTCCCTCCATGTGG - Intergenic
986471796 5:8083411-8083433 AACAAGCACTGGCCTCGAGATGG - Intergenic
988321681 5:29705715-29705737 AACAAGGACTTCCATCAAGAAGG - Intergenic
998432522 5:142078455-142078477 AAGAAGGGCTGGCCTCCAGTTGG - Intergenic
999309888 5:150545159-150545181 AACAAGGACTTGCCTCCAGTGGG - Intronic
1003129946 6:3386838-3386860 AACAAGGACTTGCTTCCACAGGG + Intronic
1011111087 6:83837287-83837309 AACAAGGACTTGTGTACAGGAGG + Intergenic
1013976794 6:116088216-116088238 GACAAGGACTTGGCTGCAGGTGG - Intergenic
1015615852 6:135074185-135074207 AACAAAGACATGCCTGCAGAAGG + Intronic
1031979245 7:128113932-128113954 ACCAAGGACATGGCTCAAGTGGG - Intergenic
1036583384 8:10099782-10099804 AACAAGGACTTGCCTGGTGTGGG + Intronic
1038583656 8:28770977-28770999 AACAAGCACTTGCTTCAGGTAGG - Exonic
1045104350 8:98876687-98876709 AACAATGACTTGCTCCTAGTAGG + Intronic
1048840208 8:138558950-138558972 AACAAGGCCATGCCTCCAACAGG + Intergenic
1050283279 9:4074806-4074828 AACGAGATCTTGCCTCCATTTGG + Intronic
1054948519 9:70823247-70823269 AACAAGGAAATGCCTTCAGGAGG - Intronic
1055922243 9:81473129-81473151 AAAAAGGATTTGCCTTCAGAAGG + Intergenic
1061490366 9:130940762-130940784 AACAAGGACTTGCCTATTGGTGG + Intergenic
1193764664 X:85512547-85512569 AAAAATGCCTTGCTTCCAGTAGG - Intergenic
1196019117 X:110971265-110971287 AACAACCACTAGTCTCCAGTTGG + Intronic
1198140555 X:133798461-133798483 TACAAGCACTTGTCTCCCGTGGG + Intronic
1198442301 X:136675002-136675024 AACAAGGCCATGGCTCAAGTAGG - Exonic
1198933025 X:141880123-141880145 CACAGGGAGCTGCCTCCAGTTGG + Intronic