ID: 999314247

View in Genome Browser
Species Human (GRCh38)
Location 5:150574049-150574071
Sequence TTTCAGCTCCTCCGCGGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999314247_999314261 22 Left 999314247 5:150574049-150574071 CCAGCGCCGCGGAGGAGCTGAAA No data
Right 999314261 5:150574094-150574116 TTAGGGGCAGGGGTGCAGCAGGG No data
999314247_999314251 -4 Left 999314247 5:150574049-150574071 CCAGCGCCGCGGAGGAGCTGAAA No data
Right 999314251 5:150574068-150574090 GAAAGCCTTAGTCTGCAGGGTGG No data
999314247_999314254 4 Left 999314247 5:150574049-150574071 CCAGCGCCGCGGAGGAGCTGAAA No data
Right 999314254 5:150574076-150574098 TAGTCTGCAGGGTGGAGGTTAGG No data
999314247_999314259 12 Left 999314247 5:150574049-150574071 CCAGCGCCGCGGAGGAGCTGAAA No data
Right 999314259 5:150574084-150574106 AGGGTGGAGGTTAGGGGCAGGGG No data
999314247_999314256 6 Left 999314247 5:150574049-150574071 CCAGCGCCGCGGAGGAGCTGAAA No data
Right 999314256 5:150574078-150574100 GTCTGCAGGGTGGAGGTTAGGGG No data
999314247_999314252 -1 Left 999314247 5:150574049-150574071 CCAGCGCCGCGGAGGAGCTGAAA No data
Right 999314252 5:150574071-150574093 AGCCTTAGTCTGCAGGGTGGAGG No data
999314247_999314260 21 Left 999314247 5:150574049-150574071 CCAGCGCCGCGGAGGAGCTGAAA No data
Right 999314260 5:150574093-150574115 GTTAGGGGCAGGGGTGCAGCAGG No data
999314247_999314249 -8 Left 999314247 5:150574049-150574071 CCAGCGCCGCGGAGGAGCTGAAA No data
Right 999314249 5:150574064-150574086 AGCTGAAAGCCTTAGTCTGCAGG No data
999314247_999314255 5 Left 999314247 5:150574049-150574071 CCAGCGCCGCGGAGGAGCTGAAA No data
Right 999314255 5:150574077-150574099 AGTCTGCAGGGTGGAGGTTAGGG No data
999314247_999314250 -7 Left 999314247 5:150574049-150574071 CCAGCGCCGCGGAGGAGCTGAAA No data
Right 999314250 5:150574065-150574087 GCTGAAAGCCTTAGTCTGCAGGG No data
999314247_999314262 23 Left 999314247 5:150574049-150574071 CCAGCGCCGCGGAGGAGCTGAAA No data
Right 999314262 5:150574095-150574117 TAGGGGCAGGGGTGCAGCAGGGG No data
999314247_999314257 10 Left 999314247 5:150574049-150574071 CCAGCGCCGCGGAGGAGCTGAAA No data
Right 999314257 5:150574082-150574104 GCAGGGTGGAGGTTAGGGGCAGG No data
999314247_999314263 30 Left 999314247 5:150574049-150574071 CCAGCGCCGCGGAGGAGCTGAAA No data
Right 999314263 5:150574102-150574124 AGGGGTGCAGCAGGGGTTACAGG No data
999314247_999314258 11 Left 999314247 5:150574049-150574071 CCAGCGCCGCGGAGGAGCTGAAA No data
Right 999314258 5:150574083-150574105 CAGGGTGGAGGTTAGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999314247 Original CRISPR TTTCAGCTCCTCCGCGGCGC TGG (reversed) Intergenic
No off target data available for this crispr