ID: 999317058

View in Genome Browser
Species Human (GRCh38)
Location 5:150591016-150591038
Sequence CCCCACCCCCTCTAACCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999317058_999317067 13 Left 999317058 5:150591016-150591038 CCTCAGGGTTAGAGGGGGTGGGG No data
Right 999317067 5:150591052-150591074 AAGGTGCCAGGCCTGGGATGGGG No data
999317058_999317064 7 Left 999317058 5:150591016-150591038 CCTCAGGGTTAGAGGGGGTGGGG No data
Right 999317064 5:150591046-150591068 GAGGCAAAGGTGCCAGGCCTGGG No data
999317058_999317072 30 Left 999317058 5:150591016-150591038 CCTCAGGGTTAGAGGGGGTGGGG No data
Right 999317072 5:150591069-150591091 ATGGGGGCACTAATGGTGTCTGG No data
999317058_999317062 1 Left 999317058 5:150591016-150591038 CCTCAGGGTTAGAGGGGGTGGGG No data
Right 999317062 5:150591040-150591062 ACAGATGAGGCAAAGGTGCCAGG No data
999317058_999317070 23 Left 999317058 5:150591016-150591038 CCTCAGGGTTAGAGGGGGTGGGG No data
Right 999317070 5:150591062-150591084 GCCTGGGATGGGGGCACTAATGG No data
999317058_999317061 -6 Left 999317058 5:150591016-150591038 CCTCAGGGTTAGAGGGGGTGGGG No data
Right 999317061 5:150591033-150591055 GTGGGGAACAGATGAGGCAAAGG No data
999317058_999317063 6 Left 999317058 5:150591016-150591038 CCTCAGGGTTAGAGGGGGTGGGG No data
Right 999317063 5:150591045-150591067 TGAGGCAAAGGTGCCAGGCCTGG No data
999317058_999317065 11 Left 999317058 5:150591016-150591038 CCTCAGGGTTAGAGGGGGTGGGG No data
Right 999317065 5:150591050-150591072 CAAAGGTGCCAGGCCTGGGATGG No data
999317058_999317068 14 Left 999317058 5:150591016-150591038 CCTCAGGGTTAGAGGGGGTGGGG No data
Right 999317068 5:150591053-150591075 AGGTGCCAGGCCTGGGATGGGGG No data
999317058_999317066 12 Left 999317058 5:150591016-150591038 CCTCAGGGTTAGAGGGGGTGGGG No data
Right 999317066 5:150591051-150591073 AAAGGTGCCAGGCCTGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999317058 Original CRISPR CCCCACCCCCTCTAACCCTG AGG (reversed) Intergenic