ID: 999317068

View in Genome Browser
Species Human (GRCh38)
Location 5:150591053-150591075
Sequence AGGTGCCAGGCCTGGGATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999317058_999317068 14 Left 999317058 5:150591016-150591038 CCTCAGGGTTAGAGGGGGTGGGG No data
Right 999317068 5:150591053-150591075 AGGTGCCAGGCCTGGGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999317068 Original CRISPR AGGTGCCAGGCCTGGGATGG GGG Intergenic
No off target data available for this crispr