ID: 999319106

View in Genome Browser
Species Human (GRCh38)
Location 5:150602224-150602246
Sequence CAGGCTCTGGGTTCTGGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999319100_999319106 -10 Left 999319100 5:150602211-150602233 CCTTACTGGGCGCCAGGCTCTGG 0: 1
1: 0
2: 1
3: 43
4: 272
Right 999319106 5:150602224-150602246 CAGGCTCTGGGTTCTGGTGGTGG No data
999319093_999319106 25 Left 999319093 5:150602176-150602198 CCTGAGTCCTGGATCATCTCTCC 0: 1
1: 0
2: 1
3: 17
4: 234
Right 999319106 5:150602224-150602246 CAGGCTCTGGGTTCTGGTGGTGG No data
999319095_999319106 18 Left 999319095 5:150602183-150602205 CCTGGATCATCTCTCCTTAAGGA 0: 1
1: 0
2: 1
3: 11
4: 162
Right 999319106 5:150602224-150602246 CAGGCTCTGGGTTCTGGTGGTGG No data
999319096_999319106 4 Left 999319096 5:150602197-150602219 CCTTAAGGAATGAGCCTTACTGG 0: 1
1: 0
2: 1
3: 11
4: 72
Right 999319106 5:150602224-150602246 CAGGCTCTGGGTTCTGGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999319106 Original CRISPR CAGGCTCTGGGTTCTGGTGG TGG Intronic
No off target data available for this crispr