ID: 999320807

View in Genome Browser
Species Human (GRCh38)
Location 5:150613952-150613974
Sequence ATGGGGAATCAGAAGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999320798_999320807 -2 Left 999320798 5:150613931-150613953 CCCATGGGGACCCTGCAGATGAT 0: 1
1: 0
2: 0
3: 5
4: 122
Right 999320807 5:150613952-150613974 ATGGGGAATCAGAAGGAGGCTGG No data
999320799_999320807 -3 Left 999320799 5:150613932-150613954 CCATGGGGACCCTGCAGATGATG 0: 1
1: 0
2: 3
3: 17
4: 212
Right 999320807 5:150613952-150613974 ATGGGGAATCAGAAGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999320807 Original CRISPR ATGGGGAATCAGAAGGAGGC TGG Intronic
No off target data available for this crispr