ID: 999321285

View in Genome Browser
Species Human (GRCh38)
Location 5:150616677-150616699
Sequence GAGATCAGGAATAAATGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 444
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 412}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999321285_999321291 28 Left 999321285 5:150616677-150616699 CCTTCTCATTTATTCCTGATCTC 0: 1
1: 0
2: 2
3: 29
4: 412
Right 999321291 5:150616728-150616750 AGGAACCTGGGCTGCATCCTAGG 0: 1
1: 0
2: 1
3: 30
4: 277
999321285_999321289 16 Left 999321285 5:150616677-150616699 CCTTCTCATTTATTCCTGATCTC 0: 1
1: 0
2: 2
3: 29
4: 412
Right 999321289 5:150616716-150616738 GTCACCAGAGCTAGGAACCTGGG 0: 1
1: 0
2: 2
3: 15
4: 137
999321285_999321287 8 Left 999321285 5:150616677-150616699 CCTTCTCATTTATTCCTGATCTC 0: 1
1: 0
2: 2
3: 29
4: 412
Right 999321287 5:150616708-150616730 AAATCTCTGTCACCAGAGCTAGG No data
999321285_999321288 15 Left 999321285 5:150616677-150616699 CCTTCTCATTTATTCCTGATCTC 0: 1
1: 0
2: 2
3: 29
4: 412
Right 999321288 5:150616715-150616737 TGTCACCAGAGCTAGGAACCTGG 0: 1
1: 0
2: 1
3: 10
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999321285 Original CRISPR GAGATCAGGAATAAATGAGA AGG (reversed) Intronic
901150145 1:7095885-7095907 GGGAGCAGGAATAAATGATTGGG - Intronic
901942747 1:12676252-12676274 GAAAACAGGAAAAGATGAGATGG - Intergenic
902250518 1:15152132-15152154 GTTATGAGGATTAAATGAGATGG + Intergenic
902652559 1:17846062-17846084 GAGATCAGGCATACCTGAGCTGG + Intergenic
904539652 1:31224286-31224308 GAGTTCATGAATAAATGAACAGG + Intronic
905158469 1:36009781-36009803 AAGCTCAGGGTTAAATGAGAAGG - Intronic
905424997 1:37876423-37876445 TAGATAATAAATAAATGAGAAGG + Intronic
906116724 1:43361935-43361957 TAGATGAGGAATCAATCAGAAGG - Intronic
906164350 1:43674807-43674829 GACATCAAGAGTAAATGAGTAGG - Intronic
907013923 1:50992492-50992514 GAGATGAAGAATAAAGGAGGTGG - Intergenic
908033660 1:60029093-60029115 CAGAAAAGGAATAATTGAGAGGG - Intronic
908281623 1:62543860-62543882 GAGATGAGCAATAAAATAGATGG - Intronic
908311219 1:62886486-62886508 GAGATGAGGAGAAATTGAGAAGG - Intergenic
908921810 1:69203419-69203441 GAGCTCAGGAAAAAATTAGCTGG + Intergenic
909804408 1:79857118-79857140 GAAATCAAGACTAAATTAGAAGG + Intergenic
909857616 1:80558915-80558937 GAGATTAGGACTAAATCAAAAGG - Intergenic
911781566 1:101886162-101886184 GAGTTCATGCAAAAATGAGAAGG + Intronic
912161298 1:106987805-106987827 GACATCTGGTAAAAATGAGAGGG - Intergenic
912314065 1:108650767-108650789 GAGATGAGGAACAAAACAGAGGG - Intronic
912405121 1:109431219-109431241 GAGATCAGGAAGACATAAGATGG + Intergenic
912631089 1:111247417-111247439 GAGATCAGGAATAAAGGGATAGG - Intergenic
913037039 1:114979293-114979315 GTTATGAGGATTAAATGAGATGG + Intronic
913332236 1:117677194-117677216 GAGTTCAGGAAACACTGAGAAGG - Intergenic
915589440 1:156862278-156862300 GAGACCAGGAGTAGAGGAGATGG + Intronic
915663242 1:157421128-157421150 GGCATCTGGAATAAATAAGAAGG - Intergenic
916501307 1:165389674-165389696 GAGATCAGGCAGAAGTAAGAAGG + Intergenic
917464188 1:175260660-175260682 GAAATAAGGAATAAATGTTAAGG - Intergenic
918237829 1:182597625-182597647 GTAATCAGAAAAAAATGAGAGGG + Intergenic
918520297 1:185407586-185407608 GAGAGCAGAAATAAGAGAGAGGG + Intergenic
919003401 1:191863847-191863869 TAGAACAGAAATAAATGAAATGG + Intergenic
919517931 1:198550399-198550421 GAGATAAGGTATCAAAGAGAAGG + Intergenic
920805360 1:209228746-209228768 GAGAACAGAACTAAATGAAATGG + Intergenic
921967283 1:221103887-221103909 GAAAAGAGGAATAAAAGAGAAGG - Intergenic
923271688 1:232360485-232360507 GAGAGCCAGAATAAGTGAGATGG - Intergenic
924068556 1:240252863-240252885 AAGATGAAGAATAAATGAAAGGG - Intronic
924702422 1:246467360-246467382 AAGAGCAGAAATAAATGAAATGG + Intronic
1064348464 10:14554560-14554582 GGGATCTGGTACAAATGAGAGGG + Intronic
1064567812 10:16660621-16660643 GAGTTCAAGAATAAATGAACTGG - Intronic
1064787333 10:18912769-18912791 ATGATCCAGAATAAATGAGAGGG + Intergenic
1064808533 10:19166116-19166138 GAGATAAGAAATGAATAAGATGG + Intronic
1066377714 10:34872733-34872755 GAAATTAGGAATAAATTTGATGG + Intergenic
1066532921 10:36359984-36360006 GAGATCAGAAATACAGGAAATGG + Intergenic
1067487969 10:46669991-46670013 GAGAACAGAAATAAGTAAGAAGG + Intergenic
1067606837 10:47672028-47672050 GAGAACAGAAATAAGTAAGAAGG - Intergenic
1068073420 10:52224170-52224192 GAGAAGAGGAAGCAATGAGATGG - Intronic
1068102709 10:52575910-52575932 GAGATAAATAATAAATGTGAGGG - Intergenic
1068301188 10:55142854-55142876 GAGTGAAGAAATAAATGAGAAGG + Intronic
1068742175 10:60485933-60485955 AAGATGATGAATGAATGAGATGG + Intronic
1070080790 10:73185025-73185047 ATGATCAGGAATGAAAGAGAGGG + Intronic
1070091648 10:73291844-73291866 GAGATGAGGAATCAGTGGGAAGG - Intronic
1070519315 10:77238068-77238090 GAGGTCAGGAAGAAATCTGAAGG + Intronic
1071622398 10:87133377-87133399 GAGAACAGAAATAAGTAAGAAGG - Intronic
1073371798 10:102996120-102996142 AACATCAGGAATAAAAAAGAGGG - Intronic
1073545333 10:104343454-104343476 GATATGAGGATTAAATGAGTTGG - Intergenic
1073964220 10:108969906-108969928 CAGATCATGAATATATGAAAGGG - Intergenic
1073971483 10:109048808-109048830 GAGACCAGGAACCCATGAGAAGG + Intergenic
1074842098 10:117364774-117364796 GAGAAAAGCAGTAAATGAGATGG + Intronic
1074877394 10:117624457-117624479 GACACCATGAAGAAATGAGAAGG - Intergenic
1076203081 10:128573323-128573345 GAGATGGGGAATTAATGAGGTGG + Intergenic
1076281742 10:129252221-129252243 GATGTCGGGAAAAAATGAGAAGG + Intergenic
1077849939 11:6066493-6066515 GAGATCAGAAAGAGATGAGCTGG - Intergenic
1077979858 11:7288675-7288697 AAGAACAAGTATAAATGAGAAGG - Intronic
1078633585 11:13028568-13028590 GAGATAAGGAATACAGGAGGAGG + Intergenic
1079175191 11:18133592-18133614 GAGAGCAGGAGTAAGAGAGAGGG - Intronic
1079435868 11:20449000-20449022 GATATCAGTAATAAATGACTTGG + Intronic
1080315564 11:30944202-30944224 GAGTTGATGAATAAAGGAGAAGG - Intronic
1081504712 11:43703894-43703916 CAGAGCAGAAATAAATGAAATGG - Intronic
1081696861 11:45118103-45118125 AAGATCATGAAAAAAAGAGAAGG + Intronic
1083670562 11:64297684-64297706 CTGATCAGGAATAAAGTAGATGG - Intronic
1084335002 11:68451908-68451930 CAGAGCAGAAATAAATGAAATGG + Intergenic
1086499221 11:87435164-87435186 GAGATGAGAAAGAAATGAGAGGG + Intergenic
1087489386 11:98803998-98804020 GAAATCAAAAATAAATCAGAAGG + Intergenic
1087594976 11:100242260-100242282 GAGTTGAGAAATAAATAAGAAGG - Intronic
1087674452 11:101143497-101143519 GTAAACAGGAATAAAAGAGAAGG + Intergenic
1087882239 11:103430927-103430949 GAAATCAACAATAAAAGAGATGG - Intronic
1088007442 11:104960152-104960174 GAAAACAAGAATGAATGAGAAGG - Intronic
1088443465 11:109897762-109897784 GAGATTAATGATAAATGAGAAGG - Intergenic
1088937876 11:114422242-114422264 CAGAGCAGAAATAAATGAAATGG - Intronic
1089191959 11:116659988-116660010 TAGACCAGAAATAAATGAGTGGG - Intergenic
1089414223 11:118273515-118273537 GAGAGTGGGAATAGATGAGATGG + Intergenic
1089710140 11:120308631-120308653 GAGGACAGGAAGAAATGACAAGG + Intronic
1090002347 11:122972560-122972582 GAGAACAGGCATAAATGAAATGG + Intergenic
1091200642 11:133777925-133777947 GAGATCAGGTATCAATAAGAGGG + Intergenic
1091563899 12:1633866-1633888 GAGGTCTGGAATAAGTGGGAGGG - Intronic
1092094652 12:5831596-5831618 GACATGAGGACTCAATGAGAGGG + Intronic
1092571684 12:9731492-9731514 GAGATCAGGAACAATTGTGTAGG + Intronic
1093778289 12:23103319-23103341 GGGGTCAGGATTAATTGAGATGG - Intergenic
1096890474 12:54765666-54765688 GAGATAAGGAATTAATCATATGG + Intergenic
1098304527 12:69089451-69089473 GAGAGCAGGAATAATTTAAAAGG + Intergenic
1098458662 12:70706351-70706373 GAGAACTGAAATAAATGAGTAGG + Intronic
1098636585 12:72791739-72791761 GAGAACAGGATTAGATGAGTGGG - Intergenic
1099063285 12:77940286-77940308 GAGAGAAGGAAAAAGTGAGATGG - Intronic
1099147805 12:79068874-79068896 GACATTAGGAAGAAATGAGAAGG - Intronic
1100202164 12:92310823-92310845 GAAATCACTAATAATTGAGAAGG - Intergenic
1100290316 12:93207548-93207570 GAGAGCAGGAGTAAGAGAGAGGG - Intergenic
1100412999 12:94340871-94340893 GAGAGGAGGAATAAAAGAAAAGG + Intronic
1103157499 12:118698663-118698685 GAGAACAGAATTATATGAGAGGG + Intergenic
1103226342 12:119291198-119291220 GAGCTCAGGCAGTAATGAGAGGG - Intergenic
1105037290 12:132935030-132935052 AAGTTCAGGAATATAAGAGAGGG + Intronic
1106979464 13:35260449-35260471 GAGAACAGAAATAATTGAGTTGG + Intronic
1109268466 13:60228160-60228182 GAGAGCAGGAACAAAGGAGAAGG - Intergenic
1110403569 13:75122474-75122496 GAGAGGAGGAACAAATGAGGAGG - Intergenic
1110790316 13:79580607-79580629 GAAATCAGGAAAAAATGTTAAGG - Intergenic
1110820520 13:79910083-79910105 GTGATGAGGATTAAATGAAATGG - Intergenic
1112242106 13:97692620-97692642 GAGTTCTGGAATAAATGTGGAGG - Intergenic
1114406678 14:22463409-22463431 GAGATGAGGAAGAAATAAGATGG - Intergenic
1114761984 14:25326145-25326167 GAGAGCAGGAAAAAAGGAGCTGG - Intergenic
1115275032 14:31598767-31598789 TAGATCTGGCATAAATGAGATGG - Intronic
1115522451 14:34246445-34246467 GAGATCAGGAATACTGGAGAAGG - Intronic
1115810790 14:37104870-37104892 GAGATCACAGATAAATGAGATGG - Intronic
1116530422 14:45966001-45966023 GAGAGCAGGAGAAAATGATATGG + Intergenic
1116733830 14:48662499-48662521 GAAAACACAAATAAATGAGAAGG + Intergenic
1116779812 14:49224662-49224684 GAGTGAAGGAATGAATGAGAGGG + Intergenic
1117050980 14:51859558-51859580 AATATGAGGATTAAATGAGATGG - Intronic
1117477463 14:56110939-56110961 CAGAACAGAAATAAATGAAATGG + Intergenic
1117637220 14:57756067-57756089 CAGAGCAGGAATTAATGAAATGG - Intronic
1118366271 14:65099982-65100004 AAGAGCAGGTATAACTGAGATGG + Intronic
1118573322 14:67216394-67216416 CAGAGCAGAAATAAATGAAATGG - Intronic
1118698512 14:68409977-68409999 AGGAACAGGAATGAATGAGATGG - Intronic
1119949442 14:78729358-78729380 GAGAGCTGTAAGAAATGAGATGG + Intronic
1120114771 14:80602315-80602337 AAGATCAGCAAGTAATGAGAAGG + Intronic
1120770783 14:88377567-88377589 CAGAACAGAAATAAATGAAATGG - Intergenic
1121475779 14:94200820-94200842 CAGAACAGGACTAAATGAAAGGG - Intronic
1121938613 14:98045037-98045059 GGGCTCAGGAATCAAGGAGAAGG - Intergenic
1122260871 14:100522031-100522053 GAGCTCAGAAAAAAATGAAATGG - Intronic
1125462032 15:39916789-39916811 TAGATTAGGAATAAAAGAAAAGG - Intronic
1125871113 15:43102777-43102799 GAGAACAGGAATGATTGAAACGG - Intronic
1125930572 15:43596792-43596814 CAAAGAAGGAATAAATGAGATGG + Intronic
1126498288 15:49316878-49316900 AAGATCAGCAATAGATGGGAGGG - Intronic
1126886593 15:53157813-53157835 AAGATCAGGAATACCTGTGAGGG - Intergenic
1127045011 15:55016563-55016585 GAGAAAGGGAAGAAATGAGAGGG - Intergenic
1127578340 15:60314138-60314160 GAAAGCAGGAACAAAAGAGAGGG - Intergenic
1128113998 15:65094248-65094270 GAGATCAGGAAGAGGTGGGACGG - Intronic
1128212417 15:65912023-65912045 GAGGTGAGGGTTAAATGAGAGGG + Intronic
1130141563 15:81230408-81230430 GAAATAAGGAAGAAAGGAGAAGG - Intronic
1130173470 15:81542813-81542835 AAAATCAGAAATAAATAAGATGG + Intergenic
1130516270 15:84628317-84628339 GCTGTCAGGATTAAATGAGATGG - Intergenic
1131675349 15:94665520-94665542 GACACCAAGAATACATGAGATGG - Intergenic
1131897753 15:97052313-97052335 GAGACCAGGAATACCTGAGAGGG - Intergenic
1135931029 16:26736860-26736882 GAGTACAGGAAAAAAAGAGAGGG - Intergenic
1138913566 16:61433356-61433378 GATATGAGGATTCAATGAGAAGG - Intergenic
1139034159 16:62922990-62923012 GTAAACAGGAATAAAGGAGATGG - Intergenic
1139423276 16:66862364-66862386 GTGAGCAAAAATAAATGAGAGGG + Intronic
1139561371 16:67744467-67744489 GAGAGCAGCAATAACTGAGTAGG + Intronic
1139756062 16:69144597-69144619 GAGATAAAGAATAAAGGAGCTGG - Intronic
1144148518 17:12421017-12421039 GAGAGCAGGAAGAGCTGAGAAGG + Intergenic
1145112746 17:20178338-20178360 GAGCCCAGGAGTAAATGAAAGGG - Intronic
1146245446 17:31277869-31277891 GAGATTATGTATAAAGGAGAAGG - Intronic
1148058872 17:44820761-44820783 GAGACCAGGAATCAATTAAAGGG + Intronic
1148510451 17:48164672-48164694 GAGTTCAGGAATCCAGGAGATGG + Intronic
1148671536 17:49414384-49414406 GAGCTCTGGAATAACTGGGAGGG + Intronic
1149075344 17:52590852-52590874 CAGAGCAGAAATAAATGAAATGG - Intergenic
1150621940 17:66814300-66814322 GTCATGAGGATTAAATGAGATGG - Intergenic
1152320457 17:79606146-79606168 GAGACCAGGAAGAAACCAGAAGG + Intergenic
1153150167 18:2083600-2083622 AGGAACAGGAATAAAGGAGATGG + Intergenic
1153151806 18:2104756-2104778 GAGAGCAGGACAAAGTGAGAGGG + Intergenic
1153415991 18:4846185-4846207 GGGAACAGGAAAATATGAGAAGG + Intergenic
1153435818 18:5066921-5066943 CAGAACAGGAATTAATTAGAAGG - Intergenic
1153753277 18:8255675-8255697 GATATCAGGAACAAATAGGAAGG + Intronic
1153801334 18:8673179-8673201 GAGATTAATAATAAATGAAATGG - Intergenic
1153913514 18:9724619-9724641 AACATCAGGAATGATTGAGAAGG + Intronic
1155155927 18:23157416-23157438 GGTATGAGGAATAAGTGAGATGG - Intronic
1156826284 18:41434061-41434083 GAGAACAGGATTTAAGGAGAAGG + Intergenic
1156828939 18:41467384-41467406 GGGGTCAGGAACAAATGAGAGGG - Intergenic
1156912220 18:42424606-42424628 CAGAGCAGAAATAAATGAAATGG - Intergenic
1156917502 18:42478846-42478868 AAGGTAAGGAATAAATGGGATGG + Intergenic
1156992031 18:43420462-43420484 AAGATCAGGAAGAAAGCAGAGGG - Intergenic
1158324335 18:56297892-56297914 CAGCTTAGGAATAGATGAGATGG + Intergenic
1159070893 18:63622909-63622931 GAGATCAGGCAGAAAAGAGTTGG - Intergenic
1159697735 18:71581747-71581769 AAGATAAGGAATGAAGGAGATGG + Intergenic
1159743493 18:72202744-72202766 TAGAGCAGTAATACATGAGAGGG - Intergenic
1159858570 18:73618581-73618603 GATAGCAGAAATACATGAGAAGG - Intergenic
1160087486 18:75790268-75790290 GAGACCAGGAATGAATGAATTGG + Intergenic
1162058375 19:8079506-8079528 GAGTTCAGGAAAGAAGGAGAGGG - Intronic
1162257580 19:9503990-9504012 GAGATCAAGAACAAATTACAAGG - Intergenic
1162469557 19:10864362-10864384 GAGATCAGGAAAGTCTGAGATGG + Intronic
1163543572 19:17927020-17927042 GAGATCAGAAAGAAAAGAAAGGG + Intergenic
1163995867 19:21046758-21046780 AAATTCAGGAATAAATGATAAGG - Intronic
1164899143 19:31903463-31903485 GAGAACCAGATTAAATGAGAAGG - Intergenic
1167346342 19:48947784-48947806 CTGCTGAGGAATAAATGAGATGG + Intergenic
1168608211 19:57776712-57776734 GAGATAAGGCATAAAGGTGAGGG - Intronic
925621681 2:5799771-5799793 GAAATCAGGAATAAAGAATATGG - Intergenic
926094895 2:10074752-10074774 GAGAGCAGAAACCAATGAGACGG - Intronic
926494758 2:13572402-13572424 GAAATCATGAAGAAATGACATGG - Intergenic
927620827 2:24656185-24656207 GAGACAAGAAATACATGAGAAGG + Intronic
928551710 2:32378257-32378279 GAGAACAAGAACAAATGAGTAGG - Intronic
929102884 2:38333834-38333856 GGAATCAGAAATAAACGAGATGG - Intronic
929281367 2:40083721-40083743 CAGAGCAGAAATAAATGAAAAGG - Intergenic
929982771 2:46697559-46697581 AAGATAAGGAACAGATGAGAAGG + Intergenic
930154357 2:48090734-48090756 GAGAAAAGGTATAAATGAAATGG + Intergenic
930831641 2:55749981-55750003 AAGTTCAGGAATACATGTGAAGG - Intergenic
931146974 2:59529856-59529878 GAGAACAGGAAGGAATGAGCTGG + Intergenic
932220583 2:69995948-69995970 GAGATTTGGAATAAAGGAGGAGG - Intergenic
932623726 2:73282826-73282848 CAGATCAGGCAAAATTGAGAAGG + Intronic
932639894 2:73433950-73433972 AAAATCAGGAATGAAAGAGAGGG - Intronic
935251535 2:101266231-101266253 GAGACCAGAAATACCTGAGAAGG - Intronic
935496335 2:103786513-103786535 GATATCAAGAATAAATGGCATGG - Intergenic
936070039 2:109361920-109361942 AATATCAGGAATAAAAGAGGGGG - Intronic
936082348 2:109441398-109441420 GAGATCAAGAATATACTAGATGG + Intronic
936696408 2:114954608-114954630 AAGAGCAGTAATAAATGAAATGG + Intronic
937409202 2:121658234-121658256 TATATCAAGAAAAAATGAGATGG - Intergenic
937920089 2:127122661-127122683 GAGATCAGTGATAAATAAGGCGG - Intergenic
938094532 2:128452788-128452810 GAGCTCAGGCAAAAATGATATGG - Intergenic
938936093 2:136128785-136128807 GACCTCAGAAATAAAAGAGAAGG - Intergenic
940107470 2:150115550-150115572 GTGATCAGGTTTTAATGAGATGG - Intergenic
940578925 2:155550948-155550970 GATAGCAGGAAGATATGAGAAGG - Intergenic
941433599 2:165440685-165440707 TAGATCAGCAGTAAATGTGAAGG + Intergenic
941476225 2:165954055-165954077 GAATTCAGGAATAAAGGAAACGG + Intergenic
941519013 2:166514711-166514733 GAAATCAAGAAGAAATGTGAAGG + Intergenic
941801074 2:169660449-169660471 CAGAGCAGAAATAAATGAAATGG - Intronic
942496887 2:176549331-176549353 GATATCAGCAATGAAGGAGACGG - Intergenic
942533658 2:176939913-176939935 AAGAGCAGGAATAACTGAGCAGG + Intergenic
942938975 2:181594035-181594057 GTGATAAGGATTAAATGAGTTGG + Intronic
943244542 2:185429799-185429821 AATATCTGAAATAAATGAGAGGG + Intergenic
943482302 2:188435316-188435338 GAGATCAGCAGTAATTGAAAGGG - Intronic
943813491 2:192220973-192220995 GAGATCAGAAATAAAATAGTAGG - Intergenic
943845118 2:192635313-192635335 TAGATCAGTAAGAAAGGAGAAGG + Intergenic
944294630 2:198048585-198048607 GAGATAAGGAACAACAGAGAGGG + Intronic
945710211 2:213285251-213285273 GATATTAGGAATAAAGCAGATGG + Intronic
946995564 2:225387343-225387365 GAGACCAGCAATAAATCTGAAGG - Intergenic
948247583 2:236499398-236499420 GAGAGCAGGCATGGATGAGAGGG - Intronic
948288969 2:236810236-236810258 GCATTCATGAATAAATGAGAAGG + Intergenic
948442151 2:238000287-238000309 AAGAGCAGAAATAAATGAAATGG - Intronic
1169126900 20:3135337-3135359 GAGAACATGAACAAAAGAGAAGG + Intronic
1169205414 20:3737355-3737377 GAAATCAGGAATACATGTGAGGG - Intronic
1169552756 20:6718037-6718059 GAGATATGGAATATAAGAGAAGG - Intergenic
1170371040 20:15648422-15648444 GAGATGAGAAATAAATGAGGAGG - Intronic
1170865628 20:20153371-20153393 CAGAACAGGACTAAATGAAACGG + Intronic
1172404883 20:34680582-34680604 GGGATCATGAAGAAATTAGAGGG + Intergenic
1173232535 20:41211548-41211570 AATATCTGGACTAAATGAGAAGG - Intronic
1175393644 20:58643794-58643816 AAGATAAGGAATAGAGGAGAAGG + Intergenic
1175672726 20:60919987-60920009 GAGCACAGGAAACAATGAGAGGG - Intergenic
1176937887 21:14887585-14887607 GAGGTCAGGAAGGAATGATAAGG + Intergenic
1182324373 22:29501078-29501100 AAAATCAAGAATAAAAGAGAAGG + Intergenic
1182714995 22:32351357-32351379 GAGATGAGGAAAAAATCAGTTGG - Intergenic
1182955005 22:34415881-34415903 AAGAACAGGAATAAATGTGTTGG + Intergenic
1183094986 22:35546630-35546652 GAGGGCATGAATGAATGAGAGGG + Intronic
1184718410 22:46295281-46295303 GAGAGCAGGAGTAAGAGAGAAGG + Intergenic
949958666 3:9292469-9292491 AAGAATAGGAATCAATGAGATGG - Intronic
950105109 3:10383708-10383730 GTCATGAGGATTAAATGAGATGG + Intronic
950827301 3:15837928-15837950 AAAATCAGGAATGAAAGAGAGGG + Intronic
951107811 3:18765853-18765875 GACATGAGCATTAAATGAGATGG + Intergenic
952469379 3:33629887-33629909 GAAATCAAGCATAGATGAGAAGG + Intronic
953078471 3:39593438-39593460 GAGAGTAGGAAAAAATGTGAAGG + Intergenic
953297134 3:41730293-41730315 CAGAGCAGAAATAAATGAAATGG + Intronic
953308497 3:41853365-41853387 GAGATATGGATTAAATGATATGG + Intronic
953383548 3:42492130-42492152 GAGAGAAGAAAAAAATGAGAGGG - Intronic
954789728 3:53123380-53123402 AAGATTAGGAATAAAAAAGATGG + Intronic
954829630 3:53409030-53409052 GAGATCAGGACTGACTGGGAAGG - Intergenic
954902825 3:54034580-54034602 AATTTCAGGAATAAATTAGAAGG - Intergenic
955958484 3:64314868-64314890 GAGTTAAGGATTAAATGAGATGG + Intronic
956312544 3:67897318-67897340 GTGATCATGAATAAAATAGATGG - Intergenic
957354991 3:79071180-79071202 CATATCAGAAATAAATGAAAGGG - Intronic
959401708 3:105910627-105910649 GAGATCAGGAATAAAGGCTGAGG + Intergenic
959812042 3:110630651-110630673 GAGATGAGAAATAAATGAGGTGG - Intergenic
959853753 3:111122915-111122937 GTGAACAGGAATAAAAAAGAGGG - Intronic
960198962 3:114808377-114808399 GAGATCAGGAATGAGAGAGAAGG + Intronic
960357107 3:116667207-116667229 AAGATTAGGAATACATGAGAGGG - Intronic
960826340 3:121789069-121789091 GAGATGGGGAATAAAGGAAAAGG + Intronic
962078445 3:132111081-132111103 GAGAGCAGAAATACATGAAATGG - Intronic
963189206 3:142450634-142450656 AAGGTCAGGAATAAATTAGATGG + Intronic
963374404 3:144445502-144445524 GATATGGGGAATAAAAGAGAAGG + Intergenic
963880343 3:150521361-150521383 GAAATCAATAATAAGTGAGAAGG - Intergenic
964257259 3:154790126-154790148 GAGTTCTGGAATCAATGAGGTGG - Intergenic
964527319 3:157629494-157629516 GAGAACAGGAAGAAAGGAGGGGG + Intronic
964726844 3:159822518-159822540 GGGAGCAGGTATAATTGAGATGG + Intronic
966521777 3:180881422-180881444 GAGATCTGGAAAAAAAAAGAAGG - Intronic
967163957 3:186763874-186763896 GATATCAGGATTAAAGGAAACGG - Intergenic
967724339 3:192847513-192847535 AACATGAGGATTAAATGAGATGG + Intronic
968125996 3:196160693-196160715 GTGATCAGGAGTAAATCAGCTGG + Intergenic
968341994 3:197963842-197963864 AAGATCAGGAACAAATGGCAAGG - Intronic
969591338 4:8123466-8123488 CAGATCAGGAGAACATGAGAAGG - Intronic
970246129 4:14065849-14065871 GAAATGAGAAACAAATGAGAAGG + Intergenic
971062411 4:22987351-22987373 GAGCTCAGAAATAAAAGTGAAGG - Intergenic
972509415 4:39753618-39753640 TAGATCAGGAAGAAGTGATATGG + Intronic
975224285 4:71852485-71852507 AAGATCAATAATAATTGAGAAGG - Intergenic
975617036 4:76256850-76256872 GAGAGGAGGAAACAATGAGAGGG + Intronic
975699033 4:77044082-77044104 GAGTTAAGGATGAAATGAGAAGG - Intergenic
975894217 4:79067250-79067272 CAGAGCAGAAATAAATGAAATGG + Intergenic
976723178 4:88190228-88190250 GAGATTAGGCATCAAAGAGAAGG - Intronic
977034966 4:91938603-91938625 CAGAGCAGAAATAAATGAAATGG + Intergenic
977261362 4:94800936-94800958 GAAATCAGGAAAAGAAGAGATGG + Intronic
977544204 4:98356854-98356876 GACATCAAGTATAAATGGGAAGG + Intronic
978639969 4:110858776-110858798 GGGGTCAGGAAAGAATGAGAGGG - Intergenic
979638416 4:122983298-122983320 CAGAGCAGAAATAAATGAAATGG - Intronic
979684010 4:123491051-123491073 GATATTAGGAATACATGAAAAGG - Intergenic
980023873 4:127741285-127741307 GAGATCAGGAATAAGACAAAGGG - Intronic
981550064 4:145935034-145935056 GAGATCTTGAAGGAATGAGAGGG - Intronic
981879036 4:149586449-149586471 AATATCAGGAATGAAAGAGAGGG - Intergenic
982415950 4:155132154-155132176 TAGATCAGGAATACATGTGTAGG - Intergenic
982587688 4:157263215-157263237 GAAAACAGGAATAAAAAAGAAGG - Intronic
982777484 4:159456987-159457009 GAAAACAGGAAAAATTGAGAAGG + Intergenic
983337694 4:166417511-166417533 CAGAGCAGAAATAAATGAAATGG - Intergenic
983748808 4:171236883-171236905 AAGATCTGGAATTAATGAGAAGG + Intergenic
985007154 4:185545244-185545266 GAGAGCAGGAATCAATGGAAGGG - Intergenic
986150683 5:5127294-5127316 GAGATTAAGAAAATATGAGAAGG - Intergenic
987513049 5:18866903-18866925 GAGTTCAGGAATGAAAGAGGAGG + Intergenic
988805357 5:34734957-34734979 GACTTCAAGGATAAATGAGATGG - Intronic
988884852 5:35545583-35545605 GAAATCAGCAAAATATGAGATGG - Intergenic
988913501 5:35869722-35869744 GAGAGCAGGAACAAGAGAGAGGG + Intronic
989016164 5:36937263-36937285 AAGGCAAGGAATAAATGAGAAGG - Intronic
989687434 5:44106961-44106983 GAGATGAGGAAAAAATGTTAAGG - Intergenic
991486199 5:67139807-67139829 GAGATAAGGAAGAAAAGAAAGGG - Intronic
991646480 5:68805590-68805612 GAGATATGGATAAAATGAGAAGG + Intergenic
991928902 5:71732426-71732448 GAGATTTTAAATAAATGAGATGG + Intergenic
992195386 5:74334198-74334220 CAGAACAGGAAGAAATGATAAGG + Intergenic
993674134 5:90796688-90796710 GAGATAAGGAAAAAATGTTAAGG + Intronic
994600466 5:101896311-101896333 GAAATGAGGAATAAATGCCAAGG - Intergenic
995352507 5:111196282-111196304 GTGATGAGAATTAAATGAGATGG + Intergenic
995630220 5:114124741-114124763 AAGACCAGAAAGAAATGAGAAGG - Intergenic
995694302 5:114862858-114862880 CAGAGCAGAAATAAATGAAATGG - Intergenic
995906803 5:117134440-117134462 GAGAACAGGAATATATGATATGG + Intergenic
996788224 5:127264262-127264284 GTTATGAGGATTAAATGAGATGG - Intergenic
997728313 5:136141560-136141582 GGGTGAAGGAATAAATGAGAAGG - Intronic
997770509 5:136549095-136549117 GTGATTAGGTATTAATGAGATGG + Intergenic
998481270 5:142465155-142465177 GAGAATAGAAAGAAATGAGAAGG + Intergenic
999021686 5:148173055-148173077 GAAATAAGGAATAAAGGAAATGG + Intronic
999321285 5:150616677-150616699 GAGATCAGGAATAAATGAGAAGG - Intronic
1000707280 5:164527219-164527241 CAGGTGAGGAATATATGAGAGGG - Intergenic
1001548918 5:172587864-172587886 GAGCTCTGGAATAGATGGGAAGG + Intergenic
1001759222 5:174193804-174193826 GACGTGAGGATTAAATGAGATGG - Intronic
1003026109 6:2557172-2557194 GAGATCATTAATAGAGGAGAGGG - Intergenic
1004708048 6:18142767-18142789 ATGGTCAAGAATAAATGAGAAGG - Intronic
1005210933 6:23461695-23461717 CATATTAGGAATGAATGAGAGGG + Intergenic
1006019708 6:31110946-31110968 GACAGCAGGACTAATTGAGATGG - Intergenic
1008689028 6:53957046-53957068 GATATGAGGAAAAAGTGAGAAGG - Intronic
1008783329 6:55135094-55135116 AAGATGAGGAATTAATGAAATGG + Intronic
1011448443 6:87467941-87467963 GAGATAAAGGATAACTGAGAAGG + Intronic
1011523351 6:88235839-88235861 GAGATCATGAAGAAATGGTAAGG - Intergenic
1011816900 6:91202191-91202213 CTGATGAGGATTAAATGAGATGG + Intergenic
1011818136 6:91216866-91216888 AATATCAGGAATAAATGAGAGGG + Intergenic
1011987440 6:93466486-93466508 GAGATCTGCCATAAGTGAGATGG + Intergenic
1012121799 6:95378029-95378051 GAGAACAGAAAAAAATGATAAGG - Intergenic
1012224864 6:96692690-96692712 CAGAGCAGAAATAAATGAAATGG + Intergenic
1013800219 6:113933008-113933030 GTGATCAGCAAGAAAAGAGATGG + Exonic
1014157611 6:118129387-118129409 GAGATAAGTAAAAAATGAGGAGG + Intronic
1014438254 6:121444501-121444523 GAGAACAAGAAAAAATGAAATGG - Intronic
1015806586 6:137116007-137116029 GAAATCATGAATATATGAAAAGG - Intergenic
1016474138 6:144407958-144407980 GAGGTCATAAATAAATGAGCAGG - Intronic
1016612270 6:146004098-146004120 GAGAGCAGAAATAAATGAATTGG + Intergenic
1016715415 6:147222299-147222321 GATATCAGGAAAAAATTAAAAGG - Intronic
1016892203 6:149017652-149017674 GATACCTGGAAAAAATGAGAAGG - Intronic
1017220584 6:151961446-151961468 GAGTTCATGAAAAAATGGGAGGG + Intronic
1017564842 6:155672388-155672410 AACATCATGAAGAAATGAGAGGG + Intergenic
1017693824 6:156994403-156994425 GAGATCCGGAAACAATCAGAGGG - Intronic
1017869237 6:158472330-158472352 GAGCTCAGGAATAAGAGAAAAGG + Intronic
1017979157 6:159383873-159383895 GAGTTCAGGAGAAAATGAAAAGG + Intergenic
1020196771 7:6046132-6046154 CAGGTCAGGAATAAATTAGATGG - Exonic
1020450573 7:8316393-8316415 GTGATGGGGAATATATGAGAAGG - Intergenic
1021159270 7:17251565-17251587 GAGAAAAAGAATAAAAGAGAGGG - Intergenic
1022919501 7:34998315-34998337 GAGATCAGGAACAGATCAGAGGG + Intronic
1022977269 7:35570272-35570294 GCCATCAGGACTGAATGAGAAGG + Intergenic
1023255698 7:38310428-38310450 AAGAACTGGAATAAATGACAAGG - Intergenic
1026624397 7:71979533-71979555 GAGCTCAGGCAGGAATGAGAGGG + Intronic
1027952510 7:84835743-84835765 GAAATCAGCAACAAAAGAGAAGG + Intergenic
1028019209 7:85749784-85749806 GAGTTCAGGCAGAAGTGAGATGG - Intergenic
1028032737 7:85936922-85936944 GAAATCAAGAATAAGTTAGAAGG - Intergenic
1030087202 7:105826730-105826752 CAGACCAGGTCTAAATGAGAAGG + Intronic
1030737434 7:113066475-113066497 GAAATCAGTGATGAATGAGATGG + Intergenic
1031077050 7:117223017-117223039 GAGGTCAGGAATACAGGAGGAGG - Exonic
1031257054 7:119466549-119466571 GAGATTAGAAATATATGAAATGG - Intergenic
1031523405 7:122794299-122794321 GAGTACAGAAAAAAATGAGAAGG - Intronic
1032501493 7:132403534-132403556 GCGATCAGTAAGAAGTGAGAGGG - Intronic
1032610440 7:133407120-133407142 GTGATCAGGTATAAAGGGGAGGG - Intronic
1032663349 7:134010440-134010462 GAAAACAAGAAAAAATGAGAGGG - Intronic
1034112090 7:148547092-148547114 GAGTTTAGGAAGAAATGAAAAGG - Intergenic
1034311277 7:150091007-150091029 GATAGCAGGAATTAATGAGCTGG + Intergenic
1034597112 7:152207919-152207941 GAGATTAGGAATGATTGAGGTGG - Intronic
1035488017 7:159244247-159244269 GAGAGCAGTAATCAATGAAAAGG + Intergenic
1035642713 8:1196113-1196135 TGGATCAGGAAAAAATGTGACGG - Intergenic
1035825035 8:2635595-2635617 GAGAACAGGAAAGACTGAGAGGG - Intergenic
1037975222 8:23205072-23205094 TAGAGCAGAAATTAATGAGACGG + Intronic
1038084709 8:24182577-24182599 CAGAGCAGAAATAAATGAAATGG + Intergenic
1038923476 8:32111968-32111990 GAAATCATGAAGAAATGAAAGGG + Intronic
1041283248 8:56232848-56232870 GTCATGAAGAATAAATGAGAAGG - Intergenic
1041620418 8:59961091-59961113 TAGATGAGGAATAAATGGAAGGG - Intergenic
1042254777 8:66791544-66791566 GGCATCAGGAATAAAGGAGAAGG - Intronic
1043046783 8:75335012-75335034 GAGAACATGAATAAGTGAGAGGG - Intergenic
1043717336 8:83504283-83504305 CAGAGCAGAAATAAATGAAATGG - Intergenic
1044264430 8:90165691-90165713 GACATGAGGAATAGATGATAAGG - Intergenic
1046323345 8:112607033-112607055 CAGAGCAGAAATAAATGAAATGG + Intronic
1046626582 8:116582781-116582803 GAGATCAGGAATAGGAAAGAAGG + Intergenic
1046652223 8:116848982-116849004 AAGATCAGGAAGAAAGAAGATGG - Exonic
1046746667 8:117883193-117883215 GACATCACCAATAAATAAGAGGG + Intronic
1047654581 8:126963162-126963184 GAGATCAGGCCAAAGTGAGATGG - Intergenic
1048260759 8:132943301-132943323 GAGATCAGGAGTTAGAGAGAGGG - Intronic
1049078046 8:140416057-140416079 TAGAGCAGAAATAAATGAAAGGG + Intronic
1049119744 8:140724632-140724654 GAGAACAGCAATAAATTTGAAGG + Intronic
1049148867 8:141021526-141021548 GCGATCTGGACCAAATGAGAAGG - Intergenic
1050197214 9:3098757-3098779 CACATCAGGAGTATATGAGAGGG + Intergenic
1051343590 9:16132759-16132781 GATGTAAGGATTAAATGAGATGG + Intergenic
1051426491 9:16937044-16937066 CAGAGCAGAAATAAATGAAATGG + Intergenic
1051767229 9:20538484-20538506 AATATCAGGAATACCTGAGAAGG + Intronic
1052839254 9:33277480-33277502 GATAGCATGAAAAAATGAGAAGG + Intronic
1054703241 9:68435153-68435175 GAGATAAAGAATAAAAGGGAGGG - Intronic
1054718735 9:68582769-68582791 GAGGTCAAGAATAGTTGAGAGGG + Intergenic
1055473546 9:76638596-76638618 GACATCACAAAAAAATGAGAGGG + Intronic
1055562225 9:77532390-77532412 GAGATCTGCTATAAATAAGATGG + Intronic
1055677237 9:78676512-78676534 GAGTTCAGGAAGAAAAGACAAGG - Intergenic
1056013978 9:82362614-82362636 GAAATCAGGAACAAATCAAAAGG + Intergenic
1056088791 9:83184366-83184388 GAAAGCAGGGGTAAATGAGATGG + Intergenic
1056235923 9:84594332-84594354 ATGATCAGGAATAAGTGTGATGG + Intergenic
1056322046 9:85444445-85444467 GAAATCAGGAATAAATCACACGG - Intergenic
1056657817 9:88523427-88523449 GAGATCAGGAAAAAATGGGGAGG + Intergenic
1057762479 9:97888024-97888046 GAGAAAAGGAATTAATAAGAGGG + Intergenic
1057962702 9:99471770-99471792 GTTATGAGGAATAAATGAAATGG - Intergenic
1058950501 9:109899214-109899236 GAGATTAAGAATCAATGAAAAGG - Intronic
1059091356 9:111362021-111362043 AAAATCTGGAATAAATTAGAAGG - Exonic
1059301375 9:113316299-113316321 TACATCAGAAATAATTGAGATGG - Exonic
1059679326 9:116571048-116571070 CAGGTCAGGATTAAATGAGATGG + Intronic
1059770806 9:117423101-117423123 GAGAGGATGAAAAAATGAGAGGG - Intergenic
1060000223 9:119952027-119952049 ATGAAAAGGAATAAATGAGATGG - Intergenic
1060168646 9:121442214-121442236 GAGATCAGGGATTGCTGAGAAGG + Intergenic
1060428622 9:123527537-123527559 GAGATGAAGAATAAATGAGTGGG - Intronic
1060856466 9:126917633-126917655 GTTATGAAGAATAAATGAGACGG + Intronic
1060857838 9:126929198-126929220 GAGATTAGCAACATATGAGAGGG + Intronic
1186344125 X:8673849-8673871 GAGAACAGGAACAACAGAGAAGG + Intronic
1186663435 X:11693523-11693545 GACAGCAGGAATAAAGAAGAGGG - Intergenic
1187029170 X:15467911-15467933 CAGATCAGGAATAAATGTTTTGG + Intronic
1187262691 X:17702001-17702023 AAAACCAGAAATAAATGAGATGG + Intronic
1187618385 X:21023290-21023312 CAGAGCAGAAATAAATGAAATGG + Intergenic
1187640211 X:21279484-21279506 AAGTTCAGGAATACATGTGAAGG + Intergenic
1188122839 X:26331333-26331355 GAAATCAGCAATATTTGAGATGG + Intergenic
1188397469 X:29702867-29702889 GAGCACATGAATAAATGGGAAGG + Intronic
1188542910 X:31269673-31269695 GAGATAAAGAAGAAATGAAATGG + Intronic
1188696436 X:33197579-33197601 GAGGTCAGGAATAAGGCAGAGGG - Intronic
1189842729 X:45098506-45098528 GAGATAAAGAAGAAATGAGTTGG + Intronic
1192365349 X:70467952-70467974 GTGATCCGGAATAGGTGAGAAGG + Intronic
1193342423 X:80365248-80365270 GAGATCAGGAAAAAATTGTAAGG + Intronic
1194157614 X:90412172-90412194 TAGAGCAGAAATAAATGAAAAGG - Intergenic
1195018625 X:100802812-100802834 AAGATCAGGAAGAAAGAAGATGG + Intergenic
1195019240 X:100809867-100809889 AAGCTCAGTAAGAAATGAGACGG - Intergenic
1197163501 X:123350030-123350052 GAGAGCAGGAAAAAATGAAGGGG + Intronic
1198878906 X:141257518-141257540 GAGATCAAGAAGAAATGGAAGGG + Intergenic
1198927766 X:141818260-141818282 GAGATGAACATTAAATGAGATGG + Intergenic
1199353770 X:146836158-146836180 CTTATGAGGAATAAATGAGAAGG - Intergenic
1199462078 X:148095985-148096007 GAGCTCACAAATAAATGCGATGG + Intergenic
1199910515 X:152281928-152281950 AAGTGCAAGAATAAATGAGAAGG - Intronic
1200010935 X:153120231-153120253 GAGGTCAGGAATGAATGAATGGG + Intergenic
1200028664 X:153279691-153279713 GAGGTCAGGAATGAATGAATGGG - Intergenic
1200503944 Y:3989145-3989167 TAGAGCAGAAATAAATGAAAAGG - Intergenic
1200542044 Y:4469808-4469830 GATATGAGGATTAAAGGAGAGGG - Intergenic
1200906989 Y:8493914-8493936 TAGACCAGGAACAAATGTGATGG + Intergenic
1201168647 Y:11235347-11235369 GAGATCAGGATTAAATGAAAAGG - Intergenic