ID: 999322042

View in Genome Browser
Species Human (GRCh38)
Location 5:150621496-150621518
Sequence CTGGAGATCAGGAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999322033_999322042 15 Left 999322033 5:150621458-150621480 CCTTGGGAAAGGGAGTGGCTAGA 0: 1
1: 0
2: 1
3: 22
4: 226
Right 999322042 5:150621496-150621518 CTGGAGATCAGGAGGGAAGAAGG No data
999322032_999322042 16 Left 999322032 5:150621457-150621479 CCCTTGGGAAAGGGAGTGGCTAG 0: 1
1: 0
2: 0
3: 22
4: 169
Right 999322042 5:150621496-150621518 CTGGAGATCAGGAGGGAAGAAGG No data
999322028_999322042 26 Left 999322028 5:150621447-150621469 CCTTTCTGCTCCCTTGGGAAAGG 0: 1
1: 0
2: 0
3: 25
4: 254
Right 999322042 5:150621496-150621518 CTGGAGATCAGGAGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999322042 Original CRISPR CTGGAGATCAGGAGGGAAGA AGG Intronic
No off target data available for this crispr