ID: 999324132

View in Genome Browser
Species Human (GRCh38)
Location 5:150632623-150632645
Sequence CCTGGAGGGCAGAGCCGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 212}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999324132_999324143 17 Left 999324132 5:150632623-150632645 CCCTTTCGGCTCTGCCCTCCAGG 0: 1
1: 0
2: 0
3: 14
4: 212
Right 999324143 5:150632663-150632685 TTTGGAGAAGGAGTGCTTGATGG 0: 1
1: 0
2: 2
3: 31
4: 243
999324132_999324137 -7 Left 999324132 5:150632623-150632645 CCCTTTCGGCTCTGCCCTCCAGG 0: 1
1: 0
2: 0
3: 14
4: 212
Right 999324137 5:150632639-150632661 CTCCAGGCTCCTCTGCTTTATGG 0: 1
1: 0
2: 1
3: 30
4: 275
999324132_999324138 -6 Left 999324132 5:150632623-150632645 CCCTTTCGGCTCTGCCCTCCAGG 0: 1
1: 0
2: 0
3: 14
4: 212
Right 999324138 5:150632640-150632662 TCCAGGCTCCTCTGCTTTATGGG 0: 1
1: 0
2: 0
3: 16
4: 181
999324132_999324140 -1 Left 999324132 5:150632623-150632645 CCCTTTCGGCTCTGCCCTCCAGG 0: 1
1: 0
2: 0
3: 14
4: 212
Right 999324140 5:150632645-150632667 GCTCCTCTGCTTTATGGGTTTGG 0: 1
1: 0
2: 1
3: 10
4: 125
999324132_999324142 5 Left 999324132 5:150632623-150632645 CCCTTTCGGCTCTGCCCTCCAGG 0: 1
1: 0
2: 0
3: 14
4: 212
Right 999324142 5:150632651-150632673 CTGCTTTATGGGTTTGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999324132 Original CRISPR CCTGGAGGGCAGAGCCGAAA GGG (reversed) Intronic
900073515 1:792913-792935 AGTGGAGGGCAGAGGAGAAAAGG - Intergenic
900616591 1:3568310-3568332 CCTGGAGGCCAGAGCCCTCAGGG - Intronic
901399266 1:9004879-9004901 CCTGGAGGGCAGAGCAGGATGGG + Exonic
902400963 1:16156415-16156437 CCTGAAGGTCTGAGCTGAAATGG + Intergenic
902935666 1:19762888-19762910 TCTGGAGGGCAGCCCCCAAAGGG - Intronic
905019114 1:34796223-34796245 CCTGGTGGGCAGACTAGAAAGGG - Intronic
905908514 1:41637688-41637710 CCTGGAGGGCACTGCAGAATGGG + Intronic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
907089088 1:51707791-51707813 CTTAGAGGGGAGAGCCAAAAGGG - Intronic
907859271 1:58335586-58335608 CCTGGAGGCCAGGGTGGAAACGG + Intronic
913083573 1:115413028-115413050 CCAGGAGAGCAGAGCCCAAATGG + Intergenic
914428582 1:147600115-147600137 CCGGGAGGGGGGAGCCGGAAAGG + Intronic
915319029 1:155046056-155046078 CCAGGAAGGCAGAGAGGAAAGGG + Intronic
915669076 1:157472314-157472336 CCTGGAGGGCGGAGCAAAAAGGG - Intergenic
919438732 1:197599219-197599241 CCAGGAAGGCAGAGCATAAAAGG + Intronic
920060908 1:203226305-203226327 CCTGGAGGGGAGACCCTAACTGG - Intronic
920187208 1:204167183-204167205 CCTGGGGGTCAGAGGCAAAATGG - Intergenic
920187747 1:204172073-204172095 CCTGGGGGTCAGAGGCAAAATGG - Intergenic
920704536 1:208242050-208242072 CCTGGAGGTCAGAGGGGAGAGGG + Intronic
920916642 1:210262923-210262945 CCGGGAGGGCAGAGCAGAGAGGG - Intergenic
922886556 1:229025044-229025066 CCTGGAGAGCTGAGCCTGAAGGG - Intergenic
923299942 1:232630943-232630965 CCTGGAGGGCAGGGAGGAAGGGG - Intergenic
1062910165 10:1206941-1206963 GCAGGAGGGCAGAGCCGCGAAGG + Intronic
1064128463 10:12685901-12685923 CTTGAAGGGCAGAGCAGAAAAGG - Intronic
1064429206 10:15256867-15256889 CCTGGAGGGCAGCGTGGAAAGGG - Intronic
1067390341 10:45857591-45857613 CCTGGTGCGCAGAGCCCAAGTGG - Intergenic
1067414333 10:46092147-46092169 CATGGAGAGCAGAGCTGACATGG + Intergenic
1067872935 10:49978476-49978498 CCTGGTGTGCAGAGCCCAAGTGG + Intergenic
1069532927 10:69232266-69232288 CCTGGAGGGGAGAGGAGACAGGG - Intronic
1069616795 10:69811405-69811427 CCTGTAGGGCAGGTCAGAAAGGG + Intronic
1070137516 10:73707777-73707799 CCTGGTGTGCAGAGCCCAAGTGG - Intergenic
1070515104 10:77197713-77197735 CCTGGAGGCGACAACCGAAAGGG + Intronic
1073516051 10:104076534-104076556 TCGGGAGGGCACAGCTGAAAGGG + Intronic
1073766587 10:106689325-106689347 ACTGGAGGGCAGTGAGGAAAAGG + Intronic
1075377946 10:121994622-121994644 GGTGGAGGGCAGTGCTGAAAAGG + Intronic
1075401275 10:122163295-122163317 CCTGGAGGGATGAGCCAACAGGG + Intronic
1076521009 10:131081331-131081353 CCTGGTGGGCAGAGGAGATAGGG + Intergenic
1077430089 11:2512022-2512044 CCTGGAGGGCAGAGACATCAGGG + Intronic
1078326794 11:10387770-10387792 CATGGATTGCAGAGCCGGAAGGG + Intronic
1080212923 11:29807974-29807996 ACTGGAGAGCAGAACAGAAATGG - Intergenic
1084653489 11:70502286-70502308 GCTGGAGGGCAGAGGAGAGATGG + Exonic
1085784436 11:79438328-79438350 GCTGGAGGGAAGCGGCGAAACGG + Intronic
1089091892 11:115885279-115885301 CCTGGTGGGCAGTGCCTACAGGG - Intergenic
1089145978 11:116329972-116329994 CCAGAAGGGCAGAGAGGAAATGG - Intergenic
1089196001 11:116694423-116694445 CCAAGAGGGCAGAGCCAAGAGGG + Intergenic
1090296630 11:125593514-125593536 CATTGAGGGCAGGGCCGTAAGGG - Intronic
1090409028 11:126495082-126495104 CCTGGAGGTCAGGGCCTAAGAGG - Intronic
1091381738 12:66576-66598 CCTGCAGGGCAGAGAGGAGAGGG - Intergenic
1092729070 12:11511329-11511351 CCTGGACCTCAGAGCCTAAAAGG - Intergenic
1094110661 12:26858811-26858833 CCTGGAGGTCAGAGGCTAAATGG - Intergenic
1096789408 12:54035613-54035635 CCTGGAGTGCAGAGGCGTGAAGG - Intronic
1100772215 12:97935970-97935992 CCTGGAGGGAAGAGAAGTAAGGG + Intergenic
1104143088 12:126006964-126006986 CCTGGGTGACAGAGCTGAAAGGG - Intergenic
1104165952 12:126230013-126230035 CCTGAAGAGCAGAGCCCCAAAGG + Intergenic
1104843619 12:131835973-131835995 CCTGGAGGTCAGGGCGGAAGTGG + Intronic
1106404316 13:29460546-29460568 CATGGATGGCACAGCAGAAATGG - Intronic
1106548702 13:30752742-30752764 CCTGGAGGGCACAGGCAGAAAGG + Intronic
1107402975 13:40087163-40087185 CCAGGAGGGCAGAGACCAACAGG - Intergenic
1108140511 13:47416108-47416130 CCTGGAGGACAGAGCCAGGAGGG + Intergenic
1108526038 13:51286834-51286856 CCTGGAAGCCAGAGCGAAAAGGG + Intergenic
1108635990 13:52334505-52334527 ACTGGAAGCCAGAGCCTAAATGG - Intergenic
1108651820 13:52488743-52488765 ACTGGAAGCCAGAGCCTAAATGG + Intergenic
1108817349 13:54307992-54308014 CTTGGAGGGAAGAGCGGAACAGG + Intergenic
1113774255 13:112933800-112933822 GCTGCAGGGCAGAGCCGTCAGGG - Intronic
1117060839 14:51961490-51961512 CGTGGAGCCCAGAGCCTAAAGGG + Intronic
1117339290 14:54780097-54780119 CCTGGAGGGCCTAACAGAAAAGG + Intronic
1118319097 14:64742925-64742947 GCGGGAGGGCAGAGCTGCAAGGG - Intronic
1120514232 14:85451607-85451629 CCTGGAGTTCAGGGCCAAAATGG - Intergenic
1121708448 14:96018864-96018886 CCTGGAGGGTGGAGCAGCAAAGG - Intergenic
1121790855 14:96698688-96698710 CTTTTAGTGCAGAGCCGAAAAGG + Intergenic
1122108436 14:99479185-99479207 CTTGGAGGGCAGACAGGAAAGGG + Intronic
1122849937 14:104522677-104522699 CCTGGAGGCCACAGGGGAAAAGG - Intronic
1124008033 15:25810295-25810317 CCGAGAGGGCAGAGCCCACAGGG + Intronic
1124217189 15:27817071-27817093 CCAGGAGCGCAGAGCCTAGAGGG - Intronic
1124783865 15:32660713-32660735 ACTGCAGGGCAGACCCCAAAAGG + Intronic
1125776911 15:42224166-42224188 TCTGGAGGTCAGAGCTGATATGG - Intronic
1127961575 15:63894527-63894549 TCTGGAGACCAGAGCAGAAAGGG - Intergenic
1128760913 15:70215445-70215467 GCTGGAGGCCAGAGCCAGAAGGG - Intergenic
1131688109 15:94793204-94793226 CCTGGAGAGCAGAGGCAAGAGGG - Intergenic
1132994341 16:2815246-2815268 CCTGGAGGGCAGGGAGGACAGGG - Intergenic
1132996686 16:2827181-2827203 CCTGGAGGGCAGGGAGGACAGGG + Intergenic
1134451181 16:14364746-14364768 CCTGCAGGGCAGGGCGGAAAGGG + Intergenic
1136711201 16:32238640-32238662 CCTGGATGGCAGTGCTGAGAAGG - Intergenic
1136756706 16:32690767-32690789 CCTGGATGGCAGTGCTGAGAAGG + Intergenic
1136811404 16:33179608-33179630 CCTGGATGGCAGTGCTGAGAAGG - Intergenic
1136817880 16:33289688-33289710 CCTGGATGGCAGTGCTGAGAAGG - Intronic
1136824444 16:33346217-33346239 CCTGGATGGCAGTGCTGAGAAGG - Intergenic
1136829510 16:33444988-33445010 CCTGGATGGCAGTGCTGAGAAGG - Intergenic
1141909277 16:87047515-87047537 CCTGGACAGGAGAGCTGAAAAGG + Intergenic
1202989982 16_KI270728v1_random:2577-2599 CCTGGATGGCAGTGCTGAGAAGG - Intergenic
1203058855 16_KI270728v1_random:951119-951141 CCTGGATGGCAGTGCTGAGAAGG + Intergenic
1142557503 17:789905-789927 CCTGGAGGGGAGAAGGGAAAGGG - Intronic
1143732385 17:8888439-8888461 CCTGGAGGGCAGCTCGGACACGG - Exonic
1144535195 17:16081939-16081961 CCTGGCGTGCAGAGCCTTAAGGG - Intronic
1144829524 17:18123454-18123476 GCCGGAGGCCAGGGCCGAAAGGG + Intronic
1144848989 17:18234572-18234594 AGTGGAGGGCAGAGCAGGAATGG + Intronic
1148204056 17:45768533-45768555 GCTGGAGGGCAGAGCATCAAGGG + Intergenic
1148206360 17:45782821-45782843 CCTGGAGGGCTGGGCCCTAAAGG - Intergenic
1149903310 17:60501926-60501948 CCTGGAGGGGAGAGGGGACAGGG + Intronic
1150603914 17:66675290-66675312 CCAGGAGGGCAGAGCCTCCATGG - Intronic
1150720131 17:67607363-67607385 CCTGGATGGGAGAGCCCAAGGGG - Intronic
1152346487 17:79755546-79755568 CCCGGAGGGCAGAGCCATTACGG + Intergenic
1152390682 17:80002033-80002055 CCTGGAGGGTTGGGCAGAAAAGG + Intronic
1152422620 17:80202259-80202281 CATGGAGGGCAGGGCCAAAGGGG + Exonic
1152826517 17:82469303-82469325 TCTGAAGAGCAGAGCAGAAAGGG + Intronic
1152992627 18:377123-377145 CCTGGAGGGCAGAGCTTCAGTGG + Intronic
1158208306 18:55019262-55019284 TCTGGTGGGCAGAGCAGAACAGG + Intergenic
1159208404 18:65283547-65283569 CCTGAAGGTTAGAGCCGATAGGG - Intergenic
1159421672 18:68228764-68228786 CATGGAGGGAAAAGCTGAAAAGG + Intergenic
1161516789 19:4700884-4700906 CCTGGAGGCCAGAGCCACGAGGG - Intronic
1162323671 19:9985934-9985956 CCTGGAGGTCAGAGGCGGAAAGG + Intronic
1165376064 19:35443024-35443046 CTTGGAGGGCTGAGGCGGAAAGG + Intergenic
1167166474 19:47802980-47803002 CCTGGGGGGCAGAGGGGACAGGG + Exonic
1167175369 19:47860780-47860802 CCTGGGGGGCAGAGGGGACAGGG - Intergenic
1167368848 19:49068858-49068880 CATGGAGGTCAGAGCCACAAGGG - Exonic
1168145616 19:54418866-54418888 AATGGAGGGCAGAGCAGAATTGG + Intronic
1168703973 19:58457663-58457685 CCTGCATGGCAGAGACAAAAGGG + Exonic
925057564 2:866885-866907 CCTAGAGAGCAGAGAGGAAAGGG - Intergenic
925149084 2:1602263-1602285 CCTGGAGGCCCGAAGCGAAAGGG - Intergenic
925712965 2:6759352-6759374 AGTGGAGGGCAGAGCCTGAATGG - Intergenic
926167613 2:10531248-10531270 CCTGGAGTGCAGAGCCACCATGG + Intergenic
926632235 2:15147123-15147145 CCTAGAGGGCAGACCTGAGACGG + Intergenic
927394869 2:22638197-22638219 CCTGGAGACCAGAGGCCAAAGGG - Intergenic
927698617 2:25253282-25253304 CCTCGAGGGCAGAGCCAACAGGG - Intronic
927893076 2:26764491-26764513 CCAGGAGGGCAGGGCCAAGAAGG - Intronic
936399117 2:112152452-112152474 CCTGGGGTGCAGAGCCCCAAAGG + Intronic
942351910 2:175061514-175061536 CCTGGGGGTCAGATCCAAAATGG - Intergenic
944018575 2:195073525-195073547 CCTGGAGGGAGGAGCCAAGATGG - Intergenic
946359281 2:219209395-219209417 CCTGGAGGGCAGAGACAAGCGGG + Exonic
948052396 2:234988513-234988535 CCAGGGGAGCAGAGCCCAAAGGG + Intronic
948612914 2:239180972-239180994 CCTGGATGGCAGAGCCCCACAGG + Intronic
948655870 2:239476407-239476429 CCTGGAGGGCTGAGGTGAAGAGG + Intergenic
1171962470 20:31504649-31504671 CCTGGCTGGCAGGGCTGAAATGG - Intergenic
1172126107 20:32626245-32626267 CCAGGAGACCAGAGCCAAAAGGG + Intergenic
1172878449 20:38180922-38180944 CCTGCAGGGCAGGTCCGAAGGGG - Intergenic
1173477615 20:43372873-43372895 CCTGGAGCGAAGAGCTGAAGAGG + Intergenic
1173615870 20:44402676-44402698 CCTGGAGGGAAGAGCCCCATCGG + Intronic
1175683045 20:61005413-61005435 CCTGGAGGGCAGCTCAGAAAAGG - Intergenic
1176035764 20:63035721-63035743 CCTGGAGGGCAGGGCAGAGCGGG + Intergenic
1176283468 20:64328257-64328279 CCTGCAGGGCAGAGAGGAGAGGG + Intergenic
1179243585 21:39611868-39611890 CATGGAGTCCAGAGCCTAAAAGG - Intronic
1182833197 22:33320427-33320449 CTTGGAGCGCAGAGAAGAAACGG - Intronic
1183086120 22:35488344-35488366 CCTTGAGGACAGAGCAGTAATGG - Intergenic
1183828685 22:40406760-40406782 GCTGGGGGGCAGAGCAGGAAGGG - Intronic
1184992877 22:48182503-48182525 CCAGGTGGGCAGTGCAGAAAGGG - Intergenic
1185214377 22:49590046-49590068 GCCGGAGGGCAGAGCCCACAGGG - Intronic
949414523 3:3800325-3800347 GCTGGAGAGCAGCGCGGAAAGGG + Intronic
950106685 3:10393084-10393106 CCTGGAGGGCAGGGACCACAGGG - Intronic
950250289 3:11459582-11459604 CCTGGAAGCCAGAGCCAACAGGG + Intronic
951900744 3:27655382-27655404 CCTGGAAGGCAGAGCTGCAGAGG - Intergenic
955376255 3:58399781-58399803 CCTGGAGGGCAGACCCTTCAAGG - Intronic
956332806 3:68130131-68130153 CCTGGAATGAAGAGCCCAAAGGG + Intronic
962865576 3:139445730-139445752 CCCGCAGTGCAGAGCAGAAAGGG - Intergenic
965734932 3:171810121-171810143 CCTGGAGCGCAGAGCCGCGCAGG - Intronic
965741434 3:171879130-171879152 CCTGGCAGGCAAAGCAGAAAGGG - Intronic
966500427 3:180633636-180633658 CCTGGAGGACAGACCTAAAAGGG + Intronic
966918892 3:184599719-184599741 CCTGGAGGGCCCAGCTGATATGG - Intronic
967467653 3:189826005-189826027 CATGGAGGACAGGGCAGAAAAGG + Intronic
967978113 3:195046636-195046658 TCAGGAGGCCAGAGCCAAAATGG + Intergenic
969271470 4:6106104-6106126 CCTGCAGGGCACTGCCGAAGGGG - Intronic
971473254 4:27049704-27049726 CCTGGAGGGCTGTGCTGAGAAGG - Intergenic
971486694 4:27167979-27168001 CCTGGAGGGCTGAGCTCCAAGGG + Intergenic
972779810 4:42277220-42277242 ACTGGAGGGCAGAGATGACAAGG + Intergenic
973681708 4:53327324-53327346 CCAGGGTGGCAGAGCCAAAATGG + Intronic
975639474 4:76484928-76484950 TTTGGTGGGCAGAGCAGAAAGGG - Intronic
977780095 4:100970782-100970804 CCTGGAAGGAATAGCAGAAATGG + Intergenic
978255593 4:106689236-106689258 CTTGGAGGGCAGAGATGACATGG - Intergenic
981006905 4:139884501-139884523 CCTGTGGGGAAGAGCAGAAAGGG - Intronic
984902747 4:184599664-184599686 CCTGGAGGTCAGAGGCAAGATGG - Intergenic
988037882 5:25851562-25851584 CGTGGATGGCAAAGCTGAAAGGG - Intergenic
991200703 5:63988186-63988208 TCTGAGGGGCAGAGCCCAAAAGG - Intergenic
999324132 5:150632623-150632645 CCTGGAGGGCAGAGCCGAAAGGG - Intronic
999404648 5:151296268-151296290 CCTGGAGGGGAGAGGAGAAAGGG + Exonic
1001434168 5:171686461-171686483 CCTGGAGGGCAAAAGCGAAAAGG - Intergenic
1002906390 6:1452582-1452604 CTTGGAGGTCAGAAGCGAAATGG + Intergenic
1003253755 6:4456669-4456691 CCTTGAGGGCAGAGCCTTCATGG + Intergenic
1003396704 6:5759601-5759623 ACTGGTGGTCAGAGTCGAAAGGG - Intronic
1003574358 6:7278893-7278915 CCTGGAGGGCAGCACAGGAAGGG + Intronic
1003642208 6:7885439-7885461 CTTGGAGACCAGAGCAGAAATGG - Intronic
1004327902 6:14693647-14693669 CCTGGAGGGGAGAGAGGGAAAGG + Intergenic
1004517800 6:16335413-16335435 CCAGGGGTGCAGAGCCGAGAAGG - Intronic
1004523358 6:16382880-16382902 CCTGGATGGCAGAGGTGAATGGG + Intronic
1005583080 6:27251543-27251565 CCTGCAGGGAAGACCCGAGAAGG + Intronic
1006368277 6:33628739-33628761 GCAGGTGGGCAGAGCCGGAAGGG + Intronic
1007431849 6:41781061-41781083 CCTGAAGGGCAGAGCCCGAGAGG - Intronic
1008914475 6:56772404-56772426 ACTGCATGGCAGAGCAGAAACGG + Intronic
1011071733 6:83392748-83392770 CTTGGAGGGAGGAGCCAAAACGG + Intronic
1011971930 6:93236247-93236269 CTTGGAGGGCAGAAGCCAAATGG - Intergenic
1013633518 6:112007824-112007846 CCTGGAGGTCAGAGCAGAGGTGG - Intergenic
1014809636 6:125870890-125870912 CCTGGAGGTAAGAGCTGGAATGG - Intronic
1017718469 6:157228536-157228558 CCTGCAAGGCAGAGCCCAAGGGG - Intergenic
1019834843 7:3372547-3372569 TCAGGAGGGCAGAGCGGAAGAGG + Intronic
1020551707 7:9615311-9615333 CCTGCAGGAGAGAGCCAAAAGGG + Intergenic
1022104402 7:27188072-27188094 CCTCGAGGGCCGAACCGAGAGGG + Intergenic
1022523124 7:31020516-31020538 CCTGGGGGTCAGAGATGAAAAGG - Intergenic
1024107871 7:46110839-46110861 CATGGAGGGAAAAGCAGAAAAGG + Intergenic
1025161454 7:56664838-56664860 CCAGGAGGGCAGAGCCCAGCAGG - Intergenic
1028222031 7:88208975-88208997 TCTATAGGGCAGAGCTGAAATGG - Intronic
1030185799 7:106760475-106760497 CATGGAGAGCAGGCCCGAAAAGG - Intergenic
1031063379 7:117076780-117076802 CGTGGATGGCAGAGCTAAAAGGG - Intronic
1031984596 7:128155325-128155347 CCTGGAAGGCAGAGAGGAGAGGG + Intergenic
1032462451 7:132122222-132122244 CCTGGAGGGCACAGACAGAAGGG - Intergenic
1032847995 7:135768294-135768316 CATGGAAGGCAGAGCTTAAAGGG + Intergenic
1034524057 7:151644074-151644096 CTTGGAGGGAAGAGCGGAAGCGG + Intronic
1035542141 8:448673-448695 AGTGGAGGGCAGAGGAGAAAAGG + Intronic
1035602316 8:903927-903949 CCTGGAGGGCGGAGCTGCACGGG + Intergenic
1037584109 8:20264757-20264779 CCCTGAGGCCAGAGCGGAAAAGG + Intronic
1039591844 8:38756606-38756628 CCTGGTTGTCAGAGCCTAAAGGG + Intronic
1040834046 8:51712958-51712980 TCTGGAAGGCTGAGCTGAAAGGG + Intronic
1040835951 8:51731630-51731652 GCTGCAGGGCAGAGCCCTAATGG - Intronic
1044596025 8:93959419-93959441 CCAGGATGGCAGAACAGAAAAGG - Intergenic
1046191064 8:110794292-110794314 CCTGGAGGGTAGAGCCCCTAGGG + Intergenic
1048385996 8:133913110-133913132 CCTGGAGGGCAGAGGCCAGGTGG - Intergenic
1048892270 8:138958736-138958758 CATGGAGGGCAGAGGAGAATGGG + Intergenic
1051876739 9:21802086-21802108 CCTGGAGGACAGAGCTGGGATGG - Intergenic
1056237408 9:84608591-84608613 CCTTGAGTGCTGAGCTGAAAAGG + Intergenic
1057163382 9:92907233-92907255 CCTGGAAGGCAAAGACCAAAAGG + Intergenic
1057191870 9:93092882-93092904 CTTGGAAGGCAGAGCCCACAGGG + Intergenic
1059331956 9:113541328-113541350 CCTGCTGGAGAGAGCCGAAAGGG - Intronic
1061061112 9:128250878-128250900 CCTGAGGGGGAGGGCCGAAAGGG - Exonic
1061723079 9:132565725-132565747 CCAGGAAGGCAGAGCCCACATGG - Intronic
1187158601 X:16744172-16744194 ACTGGAGGGCAGAGCCTGAATGG - Intronic
1189157471 X:38773235-38773257 CATGGAGGGCAGAGATGGAAGGG + Intergenic
1189310511 X:40014451-40014473 CCGGGAGGGCAGTTGCGAAACGG + Intergenic
1190026962 X:46933271-46933293 AATGGAGAGCAGAGCCCAAACGG + Intronic
1198518410 X:137429629-137429651 CCTGGAGGACAGAGCGTGAAAGG + Intergenic
1200162096 X:154014907-154014929 CTGAGAGGGCAGAGCCGAGAAGG + Intronic