ID: 999325002

View in Genome Browser
Species Human (GRCh38)
Location 5:150638464-150638486
Sequence ATGGTGAAGCAAAATGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 349}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999325002 Original CRISPR ATGGTGAAGCAAAATGTGAA GGG Intronic
900722229 1:4184557-4184579 ATGGTGGTGCAAAATATGAAAGG + Intergenic
902560920 1:17277012-17277034 CTGGTGAAGCAAGGTGTGCAGGG - Intronic
905718999 1:40179748-40179770 AAGGTGAAGAAAAAAGGGAATGG - Intronic
907645137 1:56234893-56234915 ATGGTGAAGTAAAAAGAGCACGG - Intergenic
907808301 1:57843190-57843212 TTGGTGAAATAAGATGTGAATGG - Intronic
908230060 1:62095657-62095679 ACTGGGAAGCACAATGTGAAAGG - Intronic
908438036 1:64126126-64126148 CAGGTGAAGAAAAATGAGAATGG + Intronic
909154670 1:72058146-72058168 ATGGTGAAGTTTCATGTGAAGGG - Intronic
909432732 1:75608307-75608329 ATGGATAAACAAAATGTGAGGGG + Intronic
909856770 1:80544198-80544220 ATGGAAAAGCAAAATTTAAATGG + Intergenic
910283980 1:85532666-85532688 ATGGTGGAGCAGCATATGAAGGG + Intronic
913310148 1:117481926-117481948 TTGGTGAGGCAAAATGGAAAGGG - Intronic
914206038 1:145530319-145530341 ATGGTGGAGCAGCATATGAAGGG - Intergenic
915735404 1:158081433-158081455 AAGGTGAAGCCAACTGTAAATGG - Intronic
916611547 1:166396725-166396747 ATGGTGAAGCAGGATGGGAGGGG + Intergenic
917287275 1:173434447-173434469 TTGGTGATGAAAAAGGTGAAAGG - Intergenic
920432152 1:205925736-205925758 ATGGTTAAGTAAATTGTCAAAGG - Intronic
920905405 1:210160375-210160397 TTAGTGAAGCTAAATGGGAATGG + Intronic
920906545 1:210175063-210175085 ATGGTGAAGCCACAGATGAAAGG + Intergenic
921977885 1:221222221-221222243 GTGGGGAAGCAGAATGTGTAGGG + Intergenic
922935102 1:229416554-229416576 ATGGTGGTGCAGAATATGAAAGG - Intergenic
922975391 1:229779624-229779646 ATGGTGGAGCCAAAGGTGGAAGG - Intergenic
923894606 1:238255464-238255486 ATGGTGAAATAAAATGTGACAGG - Intergenic
924825962 1:247539193-247539215 AAGGTGTAGGAAAATGTGATTGG + Intronic
924895897 1:248337765-248337787 ATGGTGGTGCAGAATATGAAAGG + Intergenic
1065180789 10:23122729-23122751 ATAGTAAAACAAAATGTGAGAGG - Intergenic
1066365394 10:34771216-34771238 ATGGTGATGCTAAATGTGCTGGG + Intronic
1066498268 10:35963933-35963955 ATTGTGAAGCAAAATCTTATAGG + Intergenic
1067853719 10:49772204-49772226 AAGGCAAATCAAAATGTGAAAGG + Intergenic
1068466985 10:57406730-57406752 ATTGTGAAAAACAATGTGAATGG + Intergenic
1069291968 10:66790945-66790967 ATGGTAAAGGTAAAAGTGAATGG - Intronic
1069413266 10:68174478-68174500 CTGGGGATGGAAAATGTGAATGG - Exonic
1070707509 10:78651327-78651349 ATGGTGAAGAAAGAGGTAAAGGG + Intergenic
1071542242 10:86496560-86496582 ATGGATAAACAAAATGTGGAAGG + Intronic
1073672475 10:105607599-105607621 AAGGTAAAGGAAAAAGTGAAAGG + Intergenic
1073839981 10:107487209-107487231 TTGGTGAAACAAAATAAGAAAGG + Intergenic
1074347042 10:112696979-112697001 ATCTTGAAGCAAAAGGTGATTGG + Intronic
1074749538 10:116571154-116571176 ATGCTGAGGCAAAATGTCAGAGG - Intergenic
1075137640 10:119799766-119799788 ATTATGAACCTAAATGTGAAAGG + Intronic
1076278657 10:129226255-129226277 ATTGTGAAGCAAAATGTGTTAGG + Intergenic
1077968178 11:7158384-7158406 ATGGTGAGACAAAATTTAAAGGG - Intergenic
1078150712 11:8757441-8757463 CTGGAGAAGCTAACTGTGAAGGG + Intronic
1078193848 11:9118000-9118022 ATCATGGATCAAAATGTGAAGGG + Intronic
1078489031 11:11752278-11752300 AGGGTGGAGCAGAATTTGAAGGG - Intergenic
1080239309 11:30108330-30108352 ATGGTTAAGTAGATTGTGAAAGG - Intergenic
1083973520 11:66098627-66098649 TTGGGGCAGCAAACTGTGAATGG - Intronic
1084278505 11:68069937-68069959 ATTGAGAAGGAAAATGTCAAAGG - Intronic
1084354535 11:68628696-68628718 ATGGTGGTGCAGAATATGAAAGG - Intergenic
1085844829 11:80053068-80053090 AAGGGGAAGCAAAATCAGAATGG + Intergenic
1087197200 11:95313691-95313713 ATGGTGGTGCAGAATATGAAAGG - Intergenic
1087922383 11:103881303-103881325 ATGGTAGAGGAAAATGTGGAAGG - Intergenic
1088970998 11:114774710-114774732 ATGGGGAAGGAAAAAGGGAAAGG - Intergenic
1090672938 11:128962756-128962778 AAGGGGAACCAAAGTGTGAATGG + Intergenic
1090898250 11:131000215-131000237 ATGGTTAAGTTAAAAGTGAAAGG - Intergenic
1093095870 12:14971740-14971762 ATAGTAAAGGAAGATGTGAATGG + Intergenic
1093173496 12:15884841-15884863 AGGATGAAGCAAACTGTAAAGGG - Intronic
1093358775 12:18199504-18199526 ATGGTGGTGCAGAATATGAAAGG - Intronic
1093403037 12:18769830-18769852 ATGGATAAGTAAAATGTGACAGG + Intergenic
1093868349 12:24256203-24256225 GTGCAGAAGGAAAATGTGAACGG + Intergenic
1093985460 12:25526833-25526855 ATTCTCCAGCAAAATGTGAATGG - Exonic
1094400992 12:30060368-30060390 ATGGTGGTGCAGAATATGAAAGG - Intergenic
1094826071 12:34270114-34270136 ATGGTGGTGCAGAATATGAAAGG - Intergenic
1096883788 12:54696673-54696695 ATGGTGAAGCAGAAAGAGAGTGG + Intergenic
1097541875 12:60953303-60953325 ATGGTGGTGCAGAATATGAAAGG + Intergenic
1097800572 12:63909411-63909433 CTGTTGAAGCACAAAGTGAAAGG - Intronic
1098189417 12:67932158-67932180 ATGGTTAAGCATCATATGAAAGG - Intergenic
1098330970 12:69353121-69353143 AAGATGAAGCAAATGGTGAAAGG - Intronic
1099578151 12:84406024-84406046 ATGGTGAAGAGATATGTGGATGG + Intergenic
1100395533 12:94183368-94183390 ATGGTGAAGCAAATTGGCATAGG - Intronic
1101236692 12:102796890-102796912 ATGCTTCAGCAAAATGGGAAAGG - Intergenic
1101324847 12:103706516-103706538 AGGATGAAGAAAAATGAGAAAGG - Intronic
1101677603 12:106932686-106932708 ATGATGAAGCATAATGAGAAAGG + Intergenic
1102479649 12:113212879-113212901 AGAGTGAAGCAAATTGTTAATGG + Intronic
1102711498 12:114931974-114931996 ACGGTGAATCAGAATGTGACAGG + Intergenic
1104268304 12:127259052-127259074 ATTGTGAAGCAAAAGGAGAAAGG + Intergenic
1105531975 13:21228799-21228821 CTGGTGGTGCAAAATGGGAAAGG + Intergenic
1106775881 13:33009122-33009144 AAGGTTAAGGAAAATGAGAATGG - Intergenic
1106827178 13:33536178-33536200 ATGGTGAAGCAAAACAGAAATGG + Intergenic
1107850210 13:44563634-44563656 AGGGTGAAGGAAAATGTGTCAGG - Intronic
1108132009 13:47311346-47311368 AAGGTGATACAAAATATGAAGGG + Intergenic
1108544626 13:51480377-51480399 ATTGTGAAGAAAAGTGGGAAAGG - Intergenic
1108571284 13:51754232-51754254 ACAGAGAAGTAAAATGTGAATGG - Intronic
1109154892 13:58896767-58896789 ATGTTGATTCAAAATGTTAATGG + Intergenic
1109881694 13:68486825-68486847 ATGGTGAAGGAAAATGGTGAAGG - Intergenic
1110355735 13:74564842-74564864 AAAGTGAAGCAAAATGTGTGTGG - Intergenic
1110845631 13:80187860-80187882 ATGGTGGTGCAGAATATGAAAGG - Intergenic
1110978763 13:81870360-81870382 ATGGTGGTGCAGAATATGAAAGG - Intergenic
1111242685 13:85496408-85496430 ATGGTGAAGCAATAAGTCCATGG - Intergenic
1111556307 13:89885194-89885216 ATGTTGAAATAAAATATGAATGG - Intergenic
1111711746 13:91824464-91824486 ATGGCAAAGTGAAATGTGAAAGG + Intronic
1112064192 13:95774221-95774243 AAAGTAAAACAAAATGTGAAAGG - Intronic
1112889052 13:104209636-104209658 ATGGTGGTGCAAAATATGAAAGG + Intergenic
1114167895 14:20240471-20240493 ATGTAAAAGAAAAATGTGAAAGG - Intergenic
1114848598 14:26354866-26354888 GTGGTGAAGAAAAATGTAAAAGG - Intergenic
1114998624 14:28392622-28392644 AAAGTGAAGCAATATTTGAAAGG - Intergenic
1116864712 14:50022304-50022326 ATGGTGAAAGAACATGAGAAGGG - Intergenic
1117091879 14:52259398-52259420 ATGATGAAGAAATATATGAAAGG - Intergenic
1118070266 14:62238963-62238985 ATGGTTTAGAAAAATGTGTATGG + Intergenic
1119986858 14:79148085-79148107 ATGGTGAAAAAAAATATGCAGGG + Intronic
1120081637 14:80224192-80224214 AGGGTGAAGCAAATTGCCAAAGG + Intronic
1120273093 14:82339216-82339238 ATGGTTCAGGAATATGTGAAGGG + Intergenic
1120539281 14:85734502-85734524 ATGGTGGTGCAGAATATGAAAGG + Intergenic
1202834082 14_GL000009v2_random:65077-65099 ATGTTAATGCAAAATGTTAAAGG + Intergenic
1124602017 15:31141154-31141176 ATGGTGAAGCTAAATATGTTTGG + Intronic
1125247505 15:37658256-37658278 ATGGATAAAGAAAATGTGAAGGG + Intergenic
1126771794 15:52064303-52064325 AAGGCAAATCAAAATGTGAAAGG + Exonic
1126844086 15:52743133-52743155 ATGGTGGTGCAGAATATGAAAGG - Intergenic
1127084480 15:55412125-55412147 ATGGTGAATCACTATATGAATGG - Intronic
1127692263 15:61408943-61408965 ATCTTGAAGCAAAACATGAATGG + Intergenic
1128422282 15:67504801-67504823 AAAGTGAAACAAAATGTTAATGG - Intergenic
1128933044 15:71722700-71722722 ATGGTAAAACAAATTGTAAAGGG + Intronic
1129484854 15:75860863-75860885 ATAGTCAGGCAAAATGAGAAAGG - Intronic
1129536375 15:76316466-76316488 ATGGTGAAGAAAAATCTCCATGG - Intergenic
1130789906 15:87143118-87143140 ATGATGAATAAAAATGTTAAGGG - Intergenic
1130976174 15:88776974-88776996 ATGGTGAAAAAAAATGGGATGGG - Intergenic
1131768218 15:95704022-95704044 ATGCTGAAGGATAATTTGAAAGG + Intergenic
1132758958 16:1499754-1499776 AGGGTGAAGCAAGATGTGGCCGG - Intronic
1133869262 16:9672619-9672641 ATGGTGGTGCAGAATATGAAAGG + Intronic
1133919102 16:10136117-10136139 ATGGTGGAGCAGAGTGTAAAAGG - Intronic
1135857735 16:26027523-26027545 TTGGAGAAGCAAAATGAGATAGG - Intronic
1137535734 16:49323661-49323683 ATGTTGAAGGAAAATTAGAAGGG - Intergenic
1138000647 16:53275599-53275621 ATGGAGAAGAAAACTGGGAAAGG - Intronic
1138716251 16:59026343-59026365 ATGGGTAAACAAAATGTGATAGG + Intergenic
1142925099 17:3228774-3228796 ATGGTAAATCTAAATGTGAGTGG + Intergenic
1143891335 17:10104780-10104802 GTGGAGAAGGAAAATGTGGATGG - Intronic
1145706824 17:26878744-26878766 ATGGTGAAATGAAATGTGAGCGG + Intergenic
1146933602 17:36795649-36795671 ATGGATAAGCAAAATGTGGTAGG - Intergenic
1149900579 17:60473788-60473810 ATGATGAAGCTAAATGTTTAAGG - Intronic
1151411840 17:73935796-73935818 ATCATGAAGAAAAATGTGGAAGG - Intergenic
1151563746 17:74885445-74885467 ATTCTGAAGCCAGATGTGAAGGG + Intronic
1153508198 18:5824928-5824950 ATGGTGAAAGGAAAGGTGAATGG - Intergenic
1153901150 18:9617816-9617838 ATTCTGAAGAAAAAAGTGAATGG - Intergenic
1155941833 18:31807981-31808003 ATGGTGGTGCAGAATATGAAAGG - Intergenic
1156107431 18:33681835-33681857 ATGATGAGTCAAAATGTGATAGG - Intronic
1156119570 18:33825686-33825708 AGGGTGAGGCAATATATGAATGG + Intergenic
1157314614 18:46577219-46577241 ATGCTTAAGCAAAAAGAGAAAGG + Intronic
1157537794 18:48473161-48473183 ATTGCTAAGCAAAATGTTAAAGG + Intergenic
1157770317 18:50339911-50339933 ATTGTGCAGCAAAAGCTGAAAGG - Intergenic
1158001434 18:52623749-52623771 AAGGTGAGGCAAAAGTTGAAAGG - Intronic
1158496709 18:57961612-57961634 GTGGTGAAGTCAACTGTGAAAGG + Intergenic
1160312632 18:77810200-77810222 TTTTTGAACCAAAATGTGAAGGG - Intergenic
1162182052 19:8876616-8876638 ATGGTGAAGTTCAGTGTGAATGG + Exonic
1162184757 19:8896048-8896070 ATGGTGAAGTTGAGTGTGAATGG + Exonic
1163899869 19:20091774-20091796 ATGGTGCTGCAGAATATGAAAGG + Intronic
1164153262 19:22572420-22572442 ATGGTGCTGCAGAATATGAAAGG - Intergenic
1164597941 19:29542368-29542390 AGGGTGAATCAATGTGTGAATGG + Intronic
1165483673 19:36082248-36082270 ACTGTGAAGGAAAATGTGCAGGG + Intronic
1165913541 19:39244331-39244353 ATGGAGAAGGAGAAGGTGAAGGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166129153 19:40735557-40735579 CTGAGGAAGCAAAATTTGAAAGG - Intronic
1166249187 19:41554878-41554900 ATGTTTAAGCAAGTTGTGAAAGG - Intronic
1168211841 19:54896425-54896447 ATGGTGGGGCAGAATATGAAAGG + Intergenic
1168248540 19:55127199-55127221 ATGGTGGGGCAGAATATGAAAGG - Intergenic
1202638599 1_KI270706v1_random:62615-62637 ATGTTAATGCAAAATGTTAAAGG - Intergenic
927273380 2:21238736-21238758 AAAGTGAAGCAAAAAGTGAGGGG - Intergenic
928183805 2:29091285-29091307 ATTGCGAAGAGAAATGTGAATGG - Intergenic
928311352 2:30213219-30213241 AGGGGGAAGCAAATAGTGAAGGG - Intergenic
929440226 2:41960152-41960174 ATGGTTAAGTATAATGTGCAAGG + Intergenic
929840605 2:45458534-45458556 ATTTTGAAGCCAAGTGTGAAAGG - Intronic
929875140 2:45790674-45790696 AAGGAGAAGAAAAACGTGAAGGG - Intronic
929913774 2:46116445-46116467 ATGATTAAGAAAAATGTGAAAGG + Intronic
929960638 2:46493755-46493777 AAGGTGAGGCAATTTGTGAAGGG - Intronic
930086273 2:47499547-47499569 ATGGTGTAGTGAAATGAGAAAGG + Intronic
931023672 2:58082175-58082197 ATGTTCATTCAAAATGTGAAAGG + Intronic
932121597 2:69105665-69105687 GTGGGGAAGGAAAATGGGAAAGG - Intronic
933171671 2:79132312-79132334 GAGGGGAAGCAAAATGGGAAGGG - Intergenic
934616763 2:95776165-95776187 ATGGAGAGACAAAATGGGAATGG - Intergenic
934644127 2:96048395-96048417 ATGGAGAGACAAAATGGGAATGG + Intergenic
936794011 2:116185793-116185815 ATGGTGGTGCAGAATATGAAAGG + Intergenic
936854456 2:116939725-116939747 CTGGTGAAAGAAAATGGGAAGGG - Intergenic
937607131 2:123814590-123814612 ATGCTGCAGAAAAATGTCAATGG + Intergenic
939029358 2:137052691-137052713 ATATTGAAGTAAAATGTGACTGG - Intronic
939155178 2:138516590-138516612 ATAGTGAAGAAAACTGTGGAGGG + Intronic
939488636 2:142849629-142849651 ATAGTGAAGCAAACCCTGAAGGG - Intergenic
941013753 2:160331295-160331317 CTGGTGAAGGAAAATCTTAAAGG - Intronic
941880675 2:170477108-170477130 ATGGTGGGGAAAAATGAGAATGG - Intronic
942658990 2:178244230-178244252 ACAGTGAAGCAAAGTCTGAAGGG - Intronic
942920430 2:181366517-181366539 GTGGTGAAGCAAAAAAGGAATGG + Intergenic
943412645 2:187562015-187562037 ATGGTGGTGCAGAATATGAAAGG + Intronic
943504882 2:188742361-188742383 ATTGTGAAGAAAAATGTTATTGG - Intronic
944354699 2:198773354-198773376 ATGGTCAATCTCAATGTGAAGGG + Intergenic
944387734 2:199183553-199183575 ATGGTGGTGCAGAATATGAAAGG - Intergenic
944472535 2:200069833-200069855 ATGTTGAAGAGAAATGAGAATGG - Intergenic
944961642 2:204881628-204881650 ATGCTGAAGCCAACTGAGAAAGG + Intronic
945030968 2:205663386-205663408 ATGGTGAGGCAGACAGTGAAGGG - Intergenic
945361920 2:208903409-208903431 ATGGTGGTGCAGAATATGAAAGG - Intergenic
945376390 2:209082252-209082274 ATGGTGGTGCAGAATATGAAAGG - Intergenic
1168792422 20:588521-588543 AAGTTGAAGGAAAATGGGAAAGG - Intergenic
1169888017 20:10423045-10423067 ATGGAGAAGTAAATGGTGAATGG - Intronic
1170032884 20:11960659-11960681 ATGGCTAAGCAAAAAGTGAGGGG + Intergenic
1175018747 20:55821763-55821785 ATGATGAACCAAAAAGTCAAGGG - Intergenic
1175065915 20:56288504-56288526 ATGAGGAAGGAAAAAGTGAAAGG + Intergenic
1175620123 20:60436746-60436768 AAGGAGAAACAAAATCTGAATGG - Intergenic
1175836293 20:61997423-61997445 AAGGTGAGACAAAATGTAAATGG + Intronic
1178711359 21:34919830-34919852 AATGTGAATCAAATTGTGAAAGG + Intronic
1180363367 22:11919273-11919295 ATGTTAATGCAAAATGTTAAAGG + Intergenic
1182388413 22:29967964-29967986 ATGGACAAACAAAATGTGAATGG - Intronic
1183914749 22:41108583-41108605 ATGGTGAAGTAAAACGGGACAGG - Intronic
949197586 3:1331445-1331467 AAGGTGAAAGAAAAGGTGAAAGG + Intronic
949437664 3:4046939-4046961 TTGGTGAGGCAAAATGTGTAGGG - Intronic
950815910 3:15702054-15702076 ATTGTTTAGCAAAATCTGAAAGG - Intronic
950971408 3:17192218-17192240 ATAGAGAAGAAAAAAGTGAAAGG + Intronic
952259161 3:31722940-31722962 ATGATCAAGAAAAATGTGAATGG + Intronic
952747602 3:36795677-36795699 AAGCTGAAGCAATATCTGAAGGG - Intergenic
952894879 3:38071819-38071841 ATGGTGGTGCAGAATATGAAAGG + Intronic
953660807 3:44890307-44890329 GTGGTGAAGCAAGTGGTGAAGGG + Intronic
954063276 3:48087095-48087117 ATTTTGAAGCTAAATTTGAAAGG + Intronic
954325044 3:49858971-49858993 ATGGTGAGGCAAGAAGGGAAGGG + Exonic
955024833 3:55157336-55157358 ATGGGGAACCCAACTGTGAACGG - Intergenic
957542891 3:81598371-81598393 ATTGTGAGGAAAAATGAGAAAGG + Intronic
958676512 3:97274507-97274529 ATGGTGGTGCAGAATATGAAAGG + Intronic
959796651 3:110438915-110438937 AAGGTTAAGCAAAATGTAATAGG - Intergenic
959869552 3:111310819-111310841 ATGCTCAAGCAATATGGGAAAGG + Intronic
960061546 3:113328035-113328057 ATGGTGAAGAAATAGGTGGAAGG - Intronic
960603286 3:119479262-119479284 ATGGATGAGCAAAATGAGAAGGG - Intronic
962430674 3:135316380-135316402 ATGGTGAAGAGAAAAATGAAGGG + Intergenic
963233586 3:142934212-142934234 ATAGTGAATGAATATGTGAAAGG - Intergenic
963685912 3:148433857-148433879 CTGGTGAAGCTAACTGTGGAAGG + Intergenic
964125172 3:153228212-153228234 ATGGTGGTGCAGAATATGAAAGG + Intergenic
964646502 3:158963697-158963719 AAGGAGAAGCAAAATTTGATGGG + Intronic
964656037 3:159066994-159067016 ATGCTGAAGCAAAGGATGAAGGG + Intronic
965794196 3:172421741-172421763 ATTTTGAAGGAAAATGTGAAAGG - Intergenic
967005035 3:185375865-185375887 ATGGTGGTGCAGGATGTGAAAGG + Intronic
967154255 3:186677993-186678015 AAGATGCAGCAAAATGTGAATGG + Exonic
967155975 3:186692620-186692642 AGGATGAAGCAAAATATGGATGG + Intergenic
968842513 4:3017979-3018001 AAGGTAAAGGAAAAAGTGAAAGG + Intronic
969973239 4:11070124-11070146 ATAGTGAAGCAGACAGTGAATGG - Intergenic
970256134 4:14172053-14172075 ATGGTGGTGCAGAATATGAAAGG + Intergenic
970533014 4:17001846-17001868 ATGGTGGTGCAGAATATGAAAGG - Intergenic
970853771 4:20631826-20631848 ATGGTGGTGCAGAATATGAAAGG + Intergenic
970916184 4:21338002-21338024 ATGGTGGAGCAGAAAGTGGAAGG - Intronic
971108803 4:23559007-23559029 ATGCTGATGCAAAATGTGTAAGG + Intergenic
971148320 4:24003917-24003939 ATGGTAAGGCAAAATCTAAATGG + Intergenic
971164214 4:24165938-24165960 ATGATGAAGCTTAATGAGAAAGG + Intergenic
971420827 4:26472574-26472596 ATGGTGAAGGAAAAGGAAAATGG + Intergenic
971542844 4:27842825-27842847 ATGGAGAAACATAATGTGGAGGG + Intergenic
971795833 4:31227106-31227128 ATGCTTTAGCAAAATGTAAATGG - Intergenic
971870977 4:32238093-32238115 ATGCTGAAGGAAAATTGGAATGG + Intergenic
973235989 4:47905669-47905691 AAGGAAAAGCAAAGTGTGAAAGG + Intronic
973270528 4:48257936-48257958 ATGCTGAAGCAACATGAAAATGG + Intronic
973936483 4:55851742-55851764 ATGGTGAGGGAAAATTAGAATGG + Intergenic
974059548 4:57018886-57018908 ATGGTGAAGAGAAATCTGAAGGG + Intronic
974748454 4:66105665-66105687 ATGCTGATGCAAAATGAGAAGGG + Intergenic
974976604 4:68901534-68901556 ATGGCCATGCAAAAAGTGAATGG - Intergenic
975696711 4:77021234-77021256 GTGGAGACGCAAAATGTGAAGGG + Intronic
977011046 4:91633735-91633757 ATGTCGAAGTAAAATGAGAAGGG - Intergenic
977187528 4:93958714-93958736 ATAATGAATCAAAATGAGAAAGG - Intergenic
978194063 4:105950162-105950184 ATTGTAAAGGAAAATCTGAAAGG - Intronic
979527766 4:121735547-121735569 TTGCTGATGCAGAATGTGAAAGG - Intergenic
979861955 4:125705647-125705669 ATTATGAAGCAGAATGTGATGGG + Intergenic
980029564 4:127811550-127811572 ATTGAGAAGCAAAATTTGGAAGG + Exonic
980407548 4:132373227-132373249 ATGGTAGAGCAAAAGGTGGAAGG - Intergenic
981006185 4:139878087-139878109 ATAGCGAGGCAAAATTTGAATGG - Intronic
982250384 4:153400207-153400229 ATGGTGATGAAAAATGATAAAGG - Intronic
982396446 4:154920384-154920406 ATGGTGGTGCAGAATATGAAAGG + Intergenic
982513955 4:156320251-156320273 ATGAGGAAGCAAATTGTCAAGGG - Intergenic
983810443 4:172054014-172054036 ATAGTTAAGCAAAATGTTATTGG + Intronic
1202765938 4_GL000008v2_random:148474-148496 ATGTTAATGCAAAATGTTAAAGG - Intergenic
986828012 5:11542511-11542533 ATGGTAAAGCAGTATGTAAATGG - Intronic
987768799 5:22272551-22272573 ATGGTTAAGCTTAATGAGAAAGG - Intronic
988584093 5:32493888-32493910 ATAGTGAAGCAAAACTTGGAAGG + Intergenic
991181879 5:63761474-63761496 ATGTTCAAGCTTAATGTGAAGGG - Intergenic
993292084 5:86086647-86086669 ATGCTCTAGCAAAATGAGAAAGG - Intergenic
995978530 5:118073051-118073073 ATGGTGGAGCAATGTGAGAAAGG + Intergenic
996491544 5:124104008-124104030 ATGTTTCAGGAAAATGTGAATGG - Intergenic
996523061 5:124448700-124448722 ATGATGAAGCAAGATCTGTAAGG + Intergenic
996994473 5:129678188-129678210 ATGCTGAAGCAGATTATGAAGGG - Intronic
999320981 5:150614923-150614945 ATGGCAAAGCAGGATGTGAATGG - Intronic
999325002 5:150638464-150638486 ATGGTGAAGCAAAATGTGAAGGG + Intronic
1002851244 6:998276-998298 ATGATGCAGCCAAATATGAAAGG - Intergenic
1002915571 6:1525502-1525524 ATGCTGGAGCAGAATGGGAAGGG - Intergenic
1003199517 6:3946255-3946277 ATGGTGAAATAAATTGTGATAGG - Intergenic
1004409314 6:15366015-15366037 GTGATGAAGGAAAATGAGAAAGG - Intronic
1004489183 6:16097998-16098020 ATGGTGGACCAGAATGTGCAAGG - Intergenic
1004826925 6:19432794-19432816 AGGCAGAAGCAAAAGGTGAAGGG + Intergenic
1005190113 6:23211545-23211567 AAGGTTAAGTAAAATGTGATGGG - Intergenic
1006701061 6:35973715-35973737 GTGGTGAAGCATAAGGTAAAAGG - Intronic
1008028570 6:46667049-46667071 ATAGTGGGGCAAAATGGGAATGG - Intronic
1008515323 6:52313626-52313648 ATGGTATAGCAATATGTTAAAGG - Intergenic
1012574939 6:100783198-100783220 ATGGTGTAGAATAATTTGAAGGG - Intronic
1012675376 6:102106129-102106151 ATGGTGGTGCAGAATATGAAAGG - Intergenic
1012693548 6:102348861-102348883 AAGAGGAAGCAAAAAGTGAAAGG + Intergenic
1012708863 6:102571732-102571754 AATGTGAAACAAAATGTTAAAGG + Intergenic
1013579342 6:111517629-111517651 AATGTGTAGCTAAATGTGAATGG - Intergenic
1013645513 6:112135502-112135524 AAGTTGAACCAAAATGCGAAGGG - Intronic
1013869749 6:114742738-114742760 AGGCTGGAGCAAAATGTAAATGG + Intergenic
1014006015 6:116419005-116419027 ATTGTGAAGCAAAATGCACAGGG - Intronic
1015260244 6:131228820-131228842 ATGGTGAATAAAACTGTGTATGG + Intronic
1016169081 6:140986523-140986545 AAGGTGATGGAAAAGGTGAAGGG - Intergenic
1016289214 6:142509600-142509622 ATGGTGAAGTAAAAAGGGAGAGG - Intergenic
1017579063 6:155840735-155840757 ATGGGCAAGCAAAAAGTAAAAGG + Intergenic
1018118409 6:160611431-160611453 ATGGTGTAGCAAAATGTCTCAGG - Intronic
1018398655 6:163401195-163401217 ATGGGGATGCTAATTGTGAAAGG - Intergenic
1018606631 6:165604347-165604369 GTGGGGTATCAAAATGTGAATGG - Intronic
1018831984 6:167450248-167450270 ATGGGTAAGCAGAATGTTAATGG - Intergenic
1020617767 7:10480824-10480846 ATGGTGATGCAAAAGTTGACAGG + Intergenic
1021430131 7:20549619-20549641 ATGGTGGTGCAGAATATGAAAGG - Intergenic
1022846743 7:34217474-34217496 ATTATGAAGAAAAATGTGAAAGG + Intergenic
1023602634 7:41895120-41895142 ATGGTATAGCAAAATTTGAAAGG - Intergenic
1024451188 7:49545248-49545270 ATGGTAAATGAAAATGTGAAAGG + Intergenic
1024788308 7:52933763-52933785 ATGGTGAAGTGGGATGTGAATGG + Intergenic
1026078891 7:67199575-67199597 ATGCTGAAGGCAAATGTGGAAGG - Intronic
1026697929 7:72612368-72612390 ATGCTGAAGGCAAATGTGGAAGG + Intronic
1027371721 7:77513081-77513103 ATGGTGAGGCCAATTGGGAAGGG - Intergenic
1028273368 7:88820602-88820624 ATGGTGAAGGGAAAAGTGAGTGG + Intronic
1028372082 7:90103783-90103805 ATGGTGGAGTAAAAAGTGTAAGG - Intergenic
1028490468 7:91405830-91405852 ATGGTATAGATAAATGTGAAGGG - Intergenic
1029882007 7:103823827-103823849 ATGTTAAAGCAAAATTTTAAAGG - Intronic
1030213596 7:107020776-107020798 ATGGGGAAGCGAAATGAAAAAGG + Intergenic
1031354915 7:120778671-120778693 ATGGTGGTGCAGAATATGAAAGG + Intergenic
1032945911 7:136852072-136852094 ATAGTAAACAAAAATGTGAAAGG + Intergenic
1036223456 8:6939758-6939780 ATGTAGAGGCAAAATGAGAAGGG + Intergenic
1036236327 8:7042501-7042523 ATGTAGAGGCAAAATGAGAAGGG + Intergenic
1036472053 8:9060971-9060993 ATGGTGGTGCAGAATATGAAAGG + Intronic
1036481954 8:9147933-9147955 ATGGTGACACACAAAGTGAAGGG - Intronic
1037276209 8:17182625-17182647 AGGGAAAAGCAAACTGTGAATGG + Intronic
1038351380 8:26779319-26779341 ATGGAGAAGGAAAATTTGGAAGG - Intronic
1039170283 8:34737672-34737694 ATGGGTAAGCAAAATTTTAATGG - Intergenic
1040393606 8:46973143-46973165 AAGGCAAATCAAAATGTGAAAGG - Intergenic
1040784839 8:51153765-51153787 ATGGCCAAGGAAAATGTGCAAGG + Intergenic
1040868554 8:52076413-52076435 TTGGTGAAACAAAAAGTGAGTGG + Intergenic
1041487483 8:58394963-58394985 ATGGAGAAGCAAAAAGTCAGAGG + Intergenic
1042201995 8:66287943-66287965 ATGCTAAGTCAAAATGTGAAGGG + Intergenic
1043140765 8:76587094-76587116 GTGGAGAAGAAACATGTGAAAGG + Intergenic
1043717633 8:83506749-83506771 ATGGTGGTGCAGAATATGAAAGG + Intergenic
1043946459 8:86259507-86259529 AAGGTTAAGCAAAGTGCGAAAGG - Intronic
1045078347 8:98595721-98595743 ATGGTGGAGCAAAAAGTCAAAGG + Intronic
1045265454 8:100614941-100614963 CTGGGGAAGCAAAGTGAGAATGG + Intronic
1046088638 8:109470426-109470448 AAGGCAAATCAAAATGTGAAAGG + Intronic
1046376785 8:113393604-113393626 CTGGAGAAGGAAAATGAGAAAGG + Intronic
1048079187 8:131106447-131106469 ATGGAGAAGCAATAAGAGAAGGG - Intergenic
1048085112 8:131169011-131169033 ATGTAGAAACAAAATTTGAAGGG - Intergenic
1049264256 8:141658874-141658896 ATCGTGCAGCCAAATGTGGATGG + Intergenic
1052049226 9:23825989-23826011 ATGGCGAAAAAAAATATGAAAGG + Exonic
1052216813 9:25976050-25976072 AAGGGGAAGCAGAAGGTGAAGGG - Intergenic
1052252880 9:26420687-26420709 ATGCTTAAGCTAAATCTGAAAGG + Intergenic
1052325253 9:27210776-27210798 ATGACGAAGCAAAATTTTAAGGG - Intronic
1052460659 9:28758531-28758553 ACTGTGAAGCAATATGGGAATGG - Intergenic
1053050844 9:34959045-34959067 ATGGAGAAGAAAAATCCGAATGG - Intronic
1055983819 9:82035299-82035321 ATGGGAAAGCCAAATGTGATTGG + Intergenic
1056324172 9:85462827-85462849 ATGGTGGTGCAGAATATGAAAGG - Intergenic
1056372081 9:85966490-85966512 ATAGTGAAGCTAAATTTTAAAGG - Intronic
1058946982 9:109866512-109866534 ATAGAGAAGAAAAATATGAAGGG + Intronic
1059084606 9:111286625-111286647 AAGGTTAAGTAAAATGTGTAAGG + Intergenic
1060161996 9:121372354-121372376 ATGGTGAAGGAAGCTGTGAAAGG + Intergenic
1060342071 9:122786482-122786504 ATGGTGAAGCAGCATGAGAGAGG + Intergenic
1060705204 9:125792371-125792393 GAGGTGAAGGAAAATGAGAATGG + Intronic
1061590654 9:131595500-131595522 ATGGTGAAGTAAATTGTGGAGGG - Intronic
1062182282 9:135196821-135196843 ATGGGAAAGAAAAATGGGAAGGG - Intergenic
1203546690 Un_KI270743v1:133363-133385 ATGTTAATGCAAAATGTTAAAGG - Intergenic
1185884706 X:3772103-3772125 ATGGTGAAGCAAAGTGTTAATGG + Intergenic
1186644394 X:11490940-11490962 ATTGTAATGCCAAATGTGAATGG + Intronic
1187668614 X:21645139-21645161 ATAGTGGAGCAGAATATGAAAGG + Intronic
1187772650 X:22717924-22717946 TTATTGAAGCAAAATGTTAAGGG - Intergenic
1187808194 X:23144441-23144463 ATGGTTTAGGAAAATGTGTATGG + Intergenic
1188169507 X:26906331-26906353 AAGATGGAGCAAAATTTGAAAGG + Intergenic
1189514597 X:41700375-41700397 ATGCTGCAGCAACATGTTAATGG + Intronic
1189752234 X:44234072-44234094 CTGGTGAGGGAAAATGTGGAAGG - Intronic
1191104663 X:56765049-56765071 ATGAAGAAGAAAAAAGTGAAGGG - Intergenic
1191761625 X:64653456-64653478 ATGGTGGTGCAGAATATGAAAGG - Intergenic
1194386991 X:93267677-93267699 ATAATGAAGCAAAATTTCAAGGG + Intergenic
1194661001 X:96628421-96628443 ATGGTGGTGCAGAATATGAAAGG - Intergenic
1194695224 X:97039759-97039781 ATGGTAAAGCAATACGTGGAAGG + Intronic
1194873480 X:99160774-99160796 ATGGTGGTGCAGAATATGAAAGG + Intergenic
1195150227 X:102060337-102060359 AATGGGAAGCAAAGTGTGAAAGG + Intergenic
1196335846 X:114532918-114532940 ATGGAGAATCAAAATGTGTCAGG + Intergenic
1196603731 X:117631462-117631484 ATGGTGAAGCCCAAGGTAAATGG - Intergenic
1196885340 X:120239420-120239442 ATGGTGCAACAAAAAGTGACAGG + Intergenic
1196936741 X:120737813-120737835 AAAGAGAAGCAAAAGGTGAAGGG + Intergenic
1197127750 X:122967792-122967814 ATGGTGAAGGAAAATAGGCATGG + Intergenic
1197585773 X:128346199-128346221 AAGCTGAAGCATAAGGTGAAAGG + Intergenic
1197667312 X:129237895-129237917 ATGGTCAAGCACAAAGTTAATGG + Intergenic
1197964685 X:132046655-132046677 ATGGTGAAGCATAAAGTCAAAGG - Intergenic
1199572701 X:149283699-149283721 AAGTTGAACCAAAAGGTGAATGG - Intergenic
1201108873 Y:10784181-10784203 ATGATGAAATAAAATGTGAACGG - Intergenic
1201109452 Y:10788588-10788610 ATGGTGAAGTCAAATTTGAACGG - Intergenic
1201131182 Y:10953132-10953154 ATGGTGAAAAGAAATGTGAGCGG - Intergenic
1201914655 Y:19169287-19169309 ATGGTGAGGCAAAATGTTGATGG - Intergenic
1201937451 Y:19423524-19423546 ATGGTGGTGCAAAATATGAAAGG - Intergenic