ID: 999325661

View in Genome Browser
Species Human (GRCh38)
Location 5:150641809-150641831
Sequence CTAGGCAGCTGGGTTTTCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 358}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999325654_999325661 13 Left 999325654 5:150641773-150641795 CCTGAAAGGAAGAAGTGGAAGAA 0: 1
1: 0
2: 6
3: 67
4: 642
Right 999325661 5:150641809-150641831 CTAGGCAGCTGGGTTTTCAGGGG 0: 1
1: 0
2: 3
3: 17
4: 358

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999325661 Original CRISPR CTAGGCAGCTGGGTTTTCAG GGG Intronic
900829724 1:4957144-4957166 TTATGCAGCAGGGTTTGCAGGGG + Intergenic
901112067 1:6805629-6805651 CTGAGCAGCTGGGACTTCAGGGG + Intronic
901259640 1:7862036-7862058 CTAAGTAGCTGGGATTACAGGGG + Intergenic
901384981 1:8902140-8902162 CTAAGTAGCTGGGATTACAGGGG + Intergenic
901594416 1:10373358-10373380 CTGGGTAGCTGGGATTACAGGGG + Intronic
902331312 1:15732376-15732398 CCAGGCAGCAGGGTATGCAGGGG - Exonic
902449075 1:16485219-16485241 ATGGGCAGCTGGGATTCCAGAGG + Intergenic
903980760 1:27186349-27186371 CTAAGTAGCTGGGGTTACAGGGG + Intergenic
904507359 1:30969069-30969091 CGAGGCAGGTGGATTATCAGAGG + Intronic
907067592 1:51501280-51501302 CTGGGTAGCTGGGATTACAGGGG - Intronic
907092942 1:51746088-51746110 CTAAGTAGCTGGGATTACAGAGG + Intronic
908282485 1:62555483-62555505 CTAAACAGCTGGGATTACAGGGG + Intronic
909078656 1:71083035-71083057 CATGTCAGCTGGGTTTTCAAAGG + Intergenic
911069632 1:93822463-93822485 CAAAGCAGCTGGGATTACAGGGG + Intronic
911366665 1:96946924-96946946 CCAAGCAGCTGGGATTACAGGGG + Intergenic
912752688 1:112298778-112298800 CTAGGCTGCTGGCTTCTCAAGGG - Intergenic
912803467 1:112736771-112736793 CTGGGTAGCTGGGATTACAGGGG + Intergenic
915937073 1:160095863-160095885 CCAGGCAGCTGGGGCTTCTGGGG + Intronic
915946111 1:160152906-160152928 CCAAGCAGCTGGGATTACAGGGG - Intronic
916259764 1:162829734-162829756 CTGGGTAGCTGGGATTACAGGGG + Intronic
916443415 1:164849469-164849491 CCAGGAAGCTGTGTTTCCAGAGG - Exonic
917757572 1:178118036-178118058 CTAAGTAGCTGGGATTACAGAGG - Intronic
919228524 1:194740699-194740721 AAAGGCAGCTGTCTTTTCAGAGG - Intergenic
920029588 1:203028486-203028508 CTGGGGAGCTGGGTGTTAAGGGG + Intronic
920579097 1:207088158-207088180 AAAGGCAAGTGGGTTTTCAGGGG + Intronic
920648922 1:207822522-207822544 CTAGGGAGATGGGTATGCAGAGG - Intergenic
922185421 1:223270146-223270168 CTTGGCAGCTGGGGATGCAGGGG + Intronic
922360755 1:224819328-224819350 TTAGGCATTTGGGTTTTGAGAGG - Intergenic
922912603 1:229230250-229230272 CTGGGCAGTTGGGTTTTCGCTGG - Intergenic
924438561 1:244067604-244067626 CAGGGCAGCGGGGTTTTCAAAGG - Intergenic
1063388424 10:5632036-5632058 CTAGGCAGCTGCGTTCCCAGAGG + Intergenic
1063938129 10:11100076-11100098 CTGGGCAACTGGAATTTCAGAGG - Intronic
1064211922 10:13366914-13366936 CCAAGCAGCTGGGATTACAGGGG + Intergenic
1064271184 10:13867991-13868013 CTAGGTAGCTGGGATTACAGGGG - Intronic
1064543744 10:16430996-16431018 CCAGGTAGCTGGGATTACAGGGG + Intergenic
1066153794 10:32653183-32653205 TTAGGCAGCTGGTGTTTAAGGGG + Intronic
1066185670 10:33007864-33007886 CTAAGCAGCTGGGATTACAGGGG - Intergenic
1066555637 10:36609651-36609673 CTAGGCAGCAGAGGTTGCAGTGG + Intergenic
1066701215 10:38130584-38130606 CCAGGTAGCTGGGATTACAGGGG + Intergenic
1066974194 10:42349814-42349836 CAAGGCTGCTGGGTATGCAGTGG - Intergenic
1067513061 10:46911451-46911473 CGAGGCTGCTGGGGTTGCAGCGG + Intronic
1067649192 10:48140391-48140413 CGAGGCTGCTGGGGTTGCAGCGG - Intergenic
1067665664 10:48275799-48275821 CTTAGCAGCTGGGTTTACAAAGG - Intergenic
1069001781 10:63274933-63274955 CTAAGTAGCTGGGATTCCAGGGG - Intronic
1070288249 10:75099121-75099143 CTGCGGAGCTGGATTTTCAGCGG + Intronic
1070989872 10:80722093-80722115 CTCTGCAGCTGGGGTTTCAAGGG - Intergenic
1073283224 10:102369938-102369960 CTTGGCCTCTTGGTTTTCAGTGG - Exonic
1073615267 10:104988496-104988518 CAAGGCAGTTGTGTTTTAAGGGG + Intronic
1074164050 10:110859291-110859313 CAGGGCAGCTGGATGTTCAGGGG - Intergenic
1076142872 10:128093525-128093547 CTGAGTAGCTGGGATTTCAGGGG + Intergenic
1077457370 11:2689026-2689048 CTGGGCTGCAGGGTTTTGAGGGG + Intronic
1079046623 11:17110076-17110098 CTAAGCAGCTGGGATTACAGGGG + Intronic
1079099928 11:17534746-17534768 CTAAGTAGCTGGGATTACAGGGG - Intronic
1079210307 11:18455327-18455349 CCAGGTAGCTGGGATTACAGGGG + Intergenic
1079375856 11:19891251-19891273 CTAGTCAGCTGAGGTTCCAGTGG + Intronic
1079719742 11:23794693-23794715 ATATGCAGCTGAGTTTTTAGGGG + Intergenic
1081112285 11:39150802-39150824 TTTGGCAGCAGAGTTTTCAGTGG + Intergenic
1081961354 11:47139933-47139955 CAATGCAGCTTTGTTTTCAGTGG - Intronic
1083026762 11:59557778-59557800 CTAAGTAGCTGGGATTACAGGGG - Intergenic
1083449937 11:62736728-62736750 CTAAGTAGCTGGGATTACAGGGG - Intronic
1083578291 11:63808538-63808560 CAAGGTAGCTGGGATTACAGGGG + Intergenic
1083704635 11:64505574-64505596 CAAGGCAGCTGGGCTCTCTGAGG + Intergenic
1084097484 11:66921210-66921232 GCAAGCAGCTGGGTTTTTAGCGG - Intronic
1085034535 11:73292113-73292135 TGAGGCAGCTGGGTCCTCAGGGG + Intronic
1085119564 11:73958475-73958497 CTAGACTGTTGGGTTTTCTGAGG + Intronic
1085120237 11:73962939-73962961 TTAGGAAGCTGGGGTTTCAGAGG - Intronic
1085784191 11:79437340-79437362 CTCTGCAGTTGGGCTTTCAGCGG - Intronic
1085814567 11:79723698-79723720 GTTGGCAGCAGGCTTTTCAGTGG + Intergenic
1085838180 11:79978789-79978811 ATAGTCAGCTGGGGTTACAGAGG - Intergenic
1087109335 11:94446279-94446301 CCAGGTAGCTGGGATTACAGGGG - Intronic
1087635799 11:100699646-100699668 CCAAGCAGCTGGGATTACAGAGG + Intronic
1087640611 11:100751062-100751084 CTAAGTAGCTGGGATTACAGGGG + Intronic
1088146742 11:106689867-106689889 CTAAGTAGCTGGGATTACAGGGG - Intronic
1088878696 11:113957121-113957143 CTGAGGAGCTGGGTGTTCAGGGG + Intergenic
1088982868 11:114879399-114879421 CTAGTCATGTGGTTTTTCAGTGG - Intergenic
1089792231 11:120953487-120953509 CAAGGCAGCTGTGTTTTCAGAGG - Intronic
1091919512 12:4293061-4293083 GCAGGCAGATGGGTTTCCAGTGG + Intronic
1092546945 12:9460527-9460549 CCAAGCGGCTGGGTTTTCATTGG + Intergenic
1093538385 12:20249688-20249710 CTTGGCAGCAGACTTTTCAGTGG + Intergenic
1094162968 12:27411251-27411273 CCAGGCAGCTGGGACTACAGGGG + Intronic
1094505994 12:31061545-31061567 CCAAGCTGCTGGGTTTTCACTGG - Intergenic
1096531623 12:52246233-52246255 CTATGCAGCTGGGCCTTCATGGG + Intronic
1096635230 12:52953966-52953988 CTGAGTAGCTGGGATTTCAGGGG + Intergenic
1096692350 12:53328852-53328874 GTGGGCAGCTGGGGGTTCAGTGG + Exonic
1097169707 12:57105810-57105832 AGAGGCAGCTGGGTTTCCACAGG - Intronic
1099564693 12:84228730-84228752 CCTGGCAGCAGGCTTTTCAGTGG - Intergenic
1101824153 12:108207715-108207737 CTAGGCAGCTGATTTTAAAGGGG - Intronic
1102372173 12:112391037-112391059 CTAAGCAGCTGGGATTACAGGGG - Intergenic
1103144263 12:118580808-118580830 CTAAGTAGCTGGGATTACAGGGG - Intergenic
1103710670 12:122910210-122910232 GCAGGCAGATGGGTTTTCAATGG + Intergenic
1104671203 12:130681818-130681840 CCAAGCAGCTGGGATTACAGGGG + Intronic
1104953476 12:132452913-132452935 CAAGGCAGCTGGGACTTGAGGGG - Intergenic
1105229810 13:18481595-18481617 CAAGGCTGCTGGGTATGCAGTGG - Intergenic
1105599509 13:21873957-21873979 CTTATCAGCTGAGTTTTCAGAGG - Intergenic
1106894217 13:34280542-34280564 TTAGGCAGCTGGGGTCCCAGAGG + Intergenic
1107062528 13:36175039-36175061 CCAGGAAGCTGTGATTTCAGGGG - Intronic
1107403868 13:40095231-40095253 CAAGGCAGCTGGGTTACCTGAGG - Intergenic
1109285217 13:60400609-60400631 CCAGGTAGCTGGGATTACAGGGG - Intronic
1109596021 13:64554691-64554713 CCAAGTAGCTGGGATTTCAGGGG + Intergenic
1110338094 13:74355728-74355750 CTAGGAAAATGGCTTTTCAGAGG - Intergenic
1110927189 13:81168441-81168463 CTAAGTAGCTGGGATTACAGGGG + Intergenic
1112495404 13:99900050-99900072 CTAAGTAGCTGGGATTACAGGGG + Intergenic
1112944451 13:104910165-104910187 TTAGGCAGCAGGCTTTTCAATGG - Intergenic
1114014058 14:18408432-18408454 CAAGGCTGCTGGGTATGCAGTGG - Intergenic
1115596978 14:34918871-34918893 CCAGGTAGCTGGGATTACAGGGG + Intergenic
1117770361 14:59128073-59128095 ATAGGCTGCTGGGGTTTCTGTGG - Intergenic
1117913199 14:60653459-60653481 CGGGGCGGCAGGGTTTTCAGCGG - Intronic
1118194541 14:63612499-63612521 CTAAGTAGCTGGGATTACAGGGG + Intronic
1119510281 14:75205943-75205965 CCAAGCAGCTGGGATTACAGGGG - Intergenic
1119784599 14:77302991-77303013 CTGGGGTGCTTGGTTTTCAGGGG - Intronic
1121348073 14:93150747-93150769 GTTGGCAGCCAGGTTTTCAGTGG + Intergenic
1123052461 14:105552220-105552242 CTGAGCAGCTGGGATTACAGGGG + Intergenic
1124362627 15:29049235-29049257 CTGGGCATCAGGGTTTTCAATGG + Intronic
1124393155 15:29278076-29278098 CTGGGGAGCTGGGTTTACACAGG + Intronic
1125140404 15:36399555-36399577 CCAGGAAGCTGTGTTTCCAGAGG - Intergenic
1125665474 15:41426965-41426987 CCAAGCAGCTGGGATTACAGGGG + Intronic
1126840881 15:52716379-52716401 CTGAGCAGCTGGGATTACAGGGG + Intergenic
1127411057 15:58707256-58707278 CTGAGCAGCTGGGATTACAGGGG - Intronic
1128163102 15:65437515-65437537 CTAGGCAGCTGGTTTGGCTGCGG + Intergenic
1128586156 15:68852257-68852279 CTAGACAGCTAGGATTTAAGGGG + Intronic
1128809171 15:70557569-70557591 CTATCCAGCTGGGTTCTCTGGGG + Intergenic
1128953363 15:71911525-71911547 CTAGGCAGCTGAGTATGGAGAGG + Intronic
1129262895 15:74378738-74378760 CTAAGTAGCTGGGATTACAGGGG + Intergenic
1131160665 15:90102642-90102664 CTGCGGAGCTGGGCTTTCAGCGG - Intergenic
1131297639 15:91165209-91165231 CCAGGTAGCTGGGATTACAGGGG - Intronic
1131525637 15:93150406-93150428 CTAAGCAGCTGGTATTACAGGGG - Intergenic
1132757944 16:1495033-1495055 TTGAGAAGCTGGGTTTTCAGAGG + Intronic
1133576536 16:7096804-7096826 CTACGTAGCTGGGATTACAGGGG - Intronic
1133605597 16:7384778-7384800 CTCAGCCGCTGGGTATTCAGTGG + Intronic
1133750704 16:8723105-8723127 CTGAGCAGCTGGGATTACAGGGG - Intronic
1134103808 16:11471115-11471137 CGATCCAGCTGGGATTTCAGAGG + Intronic
1134573149 16:15309086-15309108 CTAAGTAGCTGGGATTACAGGGG + Intergenic
1134729234 16:16446872-16446894 CTAAGTAGCTGGGATTACAGGGG - Intergenic
1134880584 16:17742323-17742345 GCAGGCAGCTGGGGTCTCAGTGG - Intergenic
1134938201 16:18264992-18265014 CTAAGTAGCTGGGATTACAGGGG + Intergenic
1135159540 16:20081409-20081431 ATGGGTAGATGGGTTTTCAGTGG + Intergenic
1135615339 16:23906864-23906886 CTAGGCAGCAAGGATTTTAGGGG + Intronic
1136354153 16:29732882-29732904 CTGAGTAGCTGGGTTTACAGGGG + Intergenic
1136785636 16:32932466-32932488 TTAGGCAGCTGGGAGTTGAGAGG + Intergenic
1138353022 16:56356540-56356562 GCAGGCAGCAGGGTTTGCAGTGG - Intronic
1140515441 16:75537924-75537946 CCAGGTAGATGAGTTTTCAGTGG - Exonic
1140698590 16:77560051-77560073 CTAAGTAGCTGGGATTACAGGGG + Intergenic
1140744066 16:77965577-77965599 CTTGGCAGCTGGATTTTCCAGGG - Intronic
1142541194 17:660739-660761 CTAGGGACCTGGATTTTCTGTGG - Intronic
1142546481 17:707392-707414 CTGAGCAGCTGGGATTACAGGGG - Intronic
1142736249 17:1901793-1901815 CCGGGCAGCTGGGATTACAGGGG - Intergenic
1142906833 17:3049171-3049193 CTGGGGATCTGGGTTTTCTGGGG + Intergenic
1143343683 17:6233864-6233886 CTAGGTAGCTTGGCTTCCAGGGG + Intergenic
1144756627 17:17683445-17683467 CCACACAGCTGGGTTTTCAGAGG + Intronic
1145253094 17:21307167-21307189 ATAATCAGCTGGGTTTTCTGGGG + Intronic
1145265997 17:21379810-21379832 AGAGGCAGGTGGGTTTTCTGAGG + Intronic
1146007481 17:29169757-29169779 CTAGTCAGTTGGGTTCTCTGTGG - Intronic
1146388556 17:32399922-32399944 CAAGGCAGGTGGGTCTTCTGAGG + Intergenic
1147553233 17:41460050-41460072 CTGGGCAGCCTGGTATTCAGTGG - Exonic
1147906226 17:43824898-43824920 CCAAGCAGCTGGGATTACAGGGG + Intronic
1148051134 17:44770397-44770419 CCAGGCAGCTGGGATTTTCGGGG - Intronic
1149231104 17:54535753-54535775 CAAGGCTGCTGGATTTTAAGAGG - Intergenic
1149904800 17:60515809-60515831 TTATGAAGCTGTGTTTTCAGTGG + Intronic
1149907451 17:60539098-60539120 CCAAGCAGCTGGGATTACAGGGG - Intergenic
1150341790 17:64374361-64374383 CTGGGTAGCTGGGATTACAGGGG - Intronic
1150930745 17:69581913-69581935 CTAGGCAGCTGTTCTTTCAAAGG + Intergenic
1151042074 17:70874170-70874192 CCAAGCAGCTGGGATTACAGAGG - Intergenic
1151820684 17:76495139-76495161 CCCGGCAGCCGGGTTTTCACGGG + Intronic
1151964677 17:77425243-77425265 CTGTGCAGCTGGGTTTTCCTGGG - Intronic
1152057522 17:78041742-78041764 CTTCGCTGCTTGGTTTTCAGGGG - Intronic
1153040520 18:809423-809445 CCAGGTAGCTGGGATTACAGGGG + Intronic
1153765719 18:8372971-8372993 CTGTGCAGCTGGGAATTCAGGGG - Intronic
1154500430 18:14993434-14993456 CCAAGCAGCTGGGATTACAGGGG + Intergenic
1154503621 18:15010190-15010212 CCAAGCAGCTGGGATTACAGGGG + Intergenic
1154523592 18:15258245-15258267 CAAGGCTGCTGGGTATGCAGTGG + Intergenic
1155311143 18:24525059-24525081 CTGGGTAGCTGGGATTACAGGGG + Intergenic
1157132987 18:45025126-45025148 GAAGGCAGCTGGGGTTTCAAGGG + Intronic
1158286767 18:55892713-55892735 CTAGGCTGCTGGGGGGTCAGGGG + Intergenic
1158653444 18:59307875-59307897 CTGGGTAGCTGGGATTACAGGGG + Intronic
1160096123 18:75875342-75875364 CTGAGCAGCTGGGATTACAGGGG - Intergenic
1160524295 18:79526013-79526035 CTAGGCTGCTGGTTGCTCAGCGG - Intronic
1160537098 18:79600522-79600544 CTAGGAAGCTGAGTGTTCAAAGG + Intergenic
1161338541 19:3728112-3728134 CCAGGTAGCTGGGATTACAGGGG - Intronic
1161642266 19:5431775-5431797 CCAAGCAGCTGGGATTACAGGGG + Intergenic
1163100383 19:15092297-15092319 CAGGGAAGCTGGGTTTGCAGGGG + Intergenic
1163247812 19:16108148-16108170 CTAAGTAGCTGGGATTACAGGGG - Intergenic
1164215077 19:23137796-23137818 CAAGGCTGCTGGGTCTTCACTGG + Intronic
1164653608 19:29903598-29903620 CTAAGTAGCTGGGATTACAGGGG + Intergenic
1164865681 19:31602499-31602521 CTGGGTAGCTGGGATTACAGGGG - Intergenic
1165587142 19:36928038-36928060 CCAAGCAGCTGGGATTACAGGGG + Intronic
1166223697 19:41381989-41382011 CTAAGTAGCTGGGATTACAGGGG + Intronic
1166291656 19:41867432-41867454 CCAGGTAGCTGGGGTTACAGCGG + Intronic
1167704291 19:51069633-51069655 GTAGGCAGCTGGATGTTAAGTGG - Intergenic
926108347 2:10166420-10166442 CAGGGCAGCTTGGTGTTCAGGGG - Intronic
927718006 2:25364848-25364870 CCAGGCAGCTGGGTGGGCAGCGG + Intergenic
928194407 2:29204713-29204735 CTGAGTAGCTGGGTTTACAGGGG + Intronic
928260624 2:29763579-29763601 AGAGGCAGCTGGGTCTCCAGTGG - Intronic
931470282 2:62532413-62532435 TTAGGAAGCTTGGTTTTAAGAGG - Intergenic
932038962 2:68278009-68278031 CTAGGAAGCTGGGACTACAGGGG + Intergenic
932486294 2:72086179-72086201 GGAGGCAGCTGGTATTTCAGGGG - Intergenic
932519793 2:72398569-72398591 CTAAGTAGCTGGGATTACAGGGG - Intronic
933339311 2:81002424-81002446 CCTGGCAGCAGAGTTTTCAGTGG - Intergenic
935144313 2:100384461-100384483 CTTAGCACCTGGGTTCTCAGTGG + Intergenic
938499630 2:131823781-131823803 CCAAGCAGCTGGGATTACAGGGG + Intergenic
938502794 2:131840325-131840347 CCAAGCAGCTGGGATTACAGGGG + Intergenic
938522902 2:132091123-132091145 CAAGGCTGCTGGGTATGCAGTGG + Intergenic
938703938 2:133903522-133903544 CTAGCCAGCTGGAACTTCAGGGG - Intergenic
938713923 2:134001405-134001427 CTAGACAGTCGGGTTTTAAGGGG - Intergenic
940805251 2:158180062-158180084 GTAGGCACCTGGGTTCTCAGGGG + Intronic
943933767 2:193887625-193887647 AGAGGCAGCAGAGTTTTCAGTGG + Intergenic
944633772 2:201654644-201654666 GTAGGCAGCTGGCTTTTAAAAGG - Intronic
945988692 2:216374982-216375004 CTAGGCAGGTGGATTGCCAGAGG + Intergenic
946541895 2:220693944-220693966 CATGGCAGCTGGGTGTTAAGAGG - Intergenic
947820036 2:233063133-233063155 CAGGGCAGCCGGGTTTTCTGCGG + Intronic
1169076047 20:2760311-2760333 CTGGGCAGCTGAGTCCTCAGTGG - Intergenic
1169930938 20:10832418-10832440 CCAGGGAGCTGGGTGTTGAGGGG - Intergenic
1170940246 20:20842793-20842815 CTCAGCAGCTGGGTTTGAAGGGG - Intergenic
1171090084 20:22276815-22276837 CTAGGCAGGGTGGTTTGCAGTGG - Intergenic
1172520324 20:35561768-35561790 CTGGGGACCCGGGTTTTCAGAGG + Intergenic
1172558209 20:35861885-35861907 CTAGGCACATAGGTTTTCACTGG - Intronic
1172900340 20:38330102-38330124 CCAGGTAGCTGGGATTACAGGGG - Intronic
1173125353 20:40331620-40331642 CTATGCTGCTGGGTTCCCAGGGG - Intergenic
1173191762 20:40882307-40882329 TGAGGCAGCTGAGTTTTCTGGGG + Intergenic
1174724681 20:52849106-52849128 CCAAGTAGCTGGGATTTCAGGGG - Intergenic
1174969781 20:55261968-55261990 GTAGGCATCTGTGTTTTCTGGGG + Intergenic
1175792510 20:61749933-61749955 CTGAGCAGCTGGGATTACAGGGG - Intronic
1176773801 21:13109954-13109976 CAAGGCTGCTGGGTATGCAGTGG - Intergenic
1177412981 21:20754985-20755007 CATGGCAGCTGGGTTTTACGAGG - Intergenic
1179189709 21:39113422-39113444 ATATGCAGCTGTGTTCTCAGAGG - Intergenic
1180438557 22:15339238-15339260 CAAGGCTGCTGGGTATGCAGTGG - Intergenic
1180521410 22:16209666-16209688 CAAGGCTGCTGGGTATGCAGTGG - Intergenic
1181042551 22:20199077-20199099 CAAGGAAGCTGGGTTTTTACAGG - Intergenic
1181300070 22:21873563-21873585 CTAAGTAGCTGGGATTACAGGGG - Intergenic
1182069444 22:27453263-27453285 CCAGGCTACTGGGTTTTAAGTGG - Intergenic
1182482886 22:30621116-30621138 CTGAGCAGCTGGGATTACAGGGG + Intronic
1183168567 22:36166644-36166666 CCAGGCAGAAGGGTTTTGAGAGG + Intergenic
1184279374 22:43428304-43428326 CGAGGCAGCTGGGGTTTGGGTGG + Intronic
1184803985 22:46780559-46780581 CAAGGCCGCTGGGTTTTGACAGG - Intronic
949812295 3:8018893-8018915 CTTGACACCTGGATTTTCAGAGG - Intergenic
952137509 3:30439844-30439866 CCAAGTAGCTGGGATTTCAGGGG - Intergenic
954214141 3:49115159-49115181 CCAGCCAGCTGGGTGTGCAGTGG - Intronic
954605240 3:51904417-51904439 CTGTCCAGCTGGGTCTTCAGAGG - Intergenic
954912063 3:54119152-54119174 CCAGGTAGCTGGGATTACAGGGG - Intergenic
954968321 3:54630228-54630250 CTAGAGACCTGGGTTCTCAGTGG - Intronic
955486986 3:59445093-59445115 CTGGGCATCTGTGTTTTCACTGG + Intergenic
957184623 3:76925721-76925743 CTAGGTGGCTTGGTTTTCTGGGG - Intronic
959428966 3:106228367-106228389 CCAGGCAGCTGGGATTTTGGGGG - Intergenic
959601902 3:108196437-108196459 AAAGGCAGATGGGTTTGCAGTGG + Intronic
960124433 3:113983051-113983073 CTAGGCAACAGGGCTTTCAGTGG - Intronic
960784813 3:121361138-121361160 CTGGGCAGCAGACTTTTCAGTGG - Intronic
961042245 3:123685773-123685795 CTAGGGTGCTGGGTTTTCACTGG + Intronic
961152169 3:124648156-124648178 ATAGGTAGCTAGGTCTTCAGAGG + Intronic
962229647 3:133651310-133651332 CCAAGCAGCTGGGATTACAGGGG + Intronic
962976830 3:140452954-140452976 CTAGGCACCAGGCTTTCCAGAGG + Intronic
964211088 3:154228919-154228941 CTTAGCAGCTGGGCTTCCAGTGG + Intronic
964810285 3:160655779-160655801 TTTGGCAGCAGAGTTTTCAGTGG + Intergenic
965586761 3:170325793-170325815 CTGAGCAGCTGGGATTACAGGGG + Intergenic
966289970 3:178343826-178343848 CAATGCAGCTGGGTTGGCAGGGG - Intergenic
967749470 3:193097373-193097395 CTTGACAACAGGGTTTTCAGAGG + Intergenic
968017479 3:195351241-195351263 CCAAGCAGCTGGGATTACAGGGG + Intronic
968162377 3:196437426-196437448 CTAGGTAGCTGGGATTACAGGGG - Intergenic
968435448 4:585038-585060 CTAAGTAGCTGGGATTACAGGGG - Intergenic
968552456 4:1230542-1230564 CTGGGCAGCTGGATGTGCAGGGG + Intronic
969287889 4:6218084-6218106 CAAGGAAGCTGGGATTTGAGAGG - Intergenic
969302478 4:6305191-6305213 CTAGGGAGCTGGGCTTCCAGAGG - Intergenic
970210974 4:13709692-13709714 CCAGGTAGCTGGGATTACAGGGG + Intergenic
970834098 4:20379910-20379932 CGAGGCAGCTGGAATTTGAGGGG + Intronic
972556829 4:40189761-40189783 CTAAGTAGCTGGGATTACAGGGG - Intergenic
972604178 4:40599130-40599152 CTATGTAGCTGGGATTACAGGGG - Intronic
973968908 4:56191335-56191357 CTATGCAGCTGGTTTTGAAGAGG - Intronic
975772184 4:77738034-77738056 CTTGGAAGGAGGGTTTTCAGAGG - Intronic
976737241 4:88323075-88323097 CTAAGTAGCTGGGATTACAGGGG + Intergenic
977299986 4:95256584-95256606 ATAGACAGTTGAGTTTTCAGAGG - Intronic
977304700 4:95308625-95308647 CCAAGCAGCTGGGATTACAGGGG - Intronic
977724528 4:100280008-100280030 ATGGACAGCTGGGTTTTGAGAGG + Intergenic
978468670 4:109037447-109037469 CTAGTCAGGAGGGTTTTGAGAGG - Intronic
979644413 4:123051789-123051811 CTTGGCAGCAGAATTTTCAGTGG - Intronic
982355724 4:154465541-154465563 CCAGGTAGCTGGGATTACAGGGG - Intronic
983378916 4:166966995-166967017 CTAGGGAGCTGTGAATTCAGGGG - Intronic
984808712 4:183775150-183775172 CCAAGCAGCTGGGATTACAGGGG + Intergenic
984818813 4:183862079-183862101 CTAGGGAGCTTAGGTTTCAGAGG + Intronic
985653243 5:1116760-1116782 CTGGGCAGCTTGGACTTCAGAGG - Intergenic
988450037 5:31332674-31332696 CTGAGCAGTTGGGTTTTCTGGGG - Intergenic
989107388 5:37876432-37876454 GTAAGCAGCTGTGTTTTAAGGGG + Intergenic
989946044 5:50230805-50230827 TTAGGCTGCTTGGTTTTCAGGGG - Intergenic
990405559 5:55486785-55486807 CTAAGTAGCTGGGATTACAGGGG - Intronic
990813888 5:59760920-59760942 ATAAACAGCTGGGTTTTTAGAGG + Intronic
990932946 5:61113880-61113902 CTTGGCAGCAGACTTTTCAGTGG - Intronic
990992569 5:61700103-61700125 CCAGGCAGGTGAGTTTCCAGGGG + Intronic
991364755 5:65856720-65856742 CCAAGCAGCTGGGATTACAGGGG + Intronic
992296641 5:75333410-75333432 CTGGGTAGCTGGGATTACAGGGG - Intergenic
992463329 5:76983375-76983397 CCAGGTAGCTGGGATTACAGGGG + Intergenic
997499860 5:134364930-134364952 CTAAGTAGCTGGGATTACAGGGG + Intronic
997877828 5:137565135-137565157 CAAGGCAGGTGGGTTATCTGAGG - Intronic
998034310 5:138901281-138901303 CCAAGCAGCTGGGATTACAGGGG + Intronic
998922365 5:147083747-147083769 CCAGGCATTTGTGTTTTCAGCGG - Intronic
999191656 5:149752402-149752424 CCAGGCAGCTGGGTCTTCCTGGG - Intronic
999201070 5:149816762-149816784 CTAGGCAGCTGGGGCCTCCGAGG - Intronic
999325661 5:150641809-150641831 CTAGGCAGCTGGGTTTTCAGGGG + Intronic
999365380 5:151020485-151020507 CTAGGCGGCTGGGATTTCAGGGG - Intronic
999763982 5:154724345-154724367 CTAGACTGCTGACTTTTCAGTGG + Intronic
1000043103 5:157499741-157499763 CTAGAGAGCTGGGGTTCCAGGGG - Intronic
1003495055 6:6656483-6656505 CCAGGAAGCAGGGTTGTCAGGGG + Intergenic
1003674547 6:8191172-8191194 CGAGGCAGGTGGGTTATCGGAGG - Intergenic
1003913649 6:10765583-10765605 CTGAGCAGCTGGGATTACAGGGG + Intronic
1004610096 6:17231823-17231845 CTAAGTAGCTGGGATTACAGGGG - Intergenic
1005152670 6:22771012-22771034 ATAGGCAGCTTGAATTTCAGAGG - Intergenic
1006398872 6:33804243-33804265 AGAGGCAGCTGAGTTTTCAGTGG - Intergenic
1007064190 6:38972853-38972875 CTATACAACTGGGGTTTCAGAGG - Intronic
1008851456 6:56027360-56027382 CTAAGTACCTAGGTTTTCAGTGG - Intergenic
1010404925 6:75493897-75493919 CTAAGCAGCTGGGTTATCAGTGG + Intergenic
1012891147 6:104898984-104899006 CTAAGTAGCTGGGATTACAGGGG + Intergenic
1014097920 6:117480782-117480804 TGAGGCAGGTGGGCTTTCAGGGG - Intronic
1014542229 6:122691033-122691055 TCTGGCAGCAGGGTTTTCAGTGG - Intronic
1014579846 6:123123580-123123602 CATGGCAGCTGGGTTCTGAGAGG - Intergenic
1014865062 6:126519599-126519621 CTTGGCAGCAGACTTTTCAGTGG - Intergenic
1015805404 6:137103188-137103210 CTTGGTGGCTGGGTTCTCAGGGG - Intergenic
1015993525 6:138974043-138974065 CTAGGGCACTGGGTTTGCAGAGG - Intronic
1018666711 6:166145325-166145347 ATACTCAGCTGCGTTTTCAGAGG + Intergenic
1019194262 6:170272114-170272136 AGAGGCAGCTGGGTTTCCTGTGG + Intergenic
1021263910 7:18495551-18495573 CTGGACAGCTGGGTTTGCTGGGG + Intronic
1022827417 7:34029851-34029873 GTAGCCAGCTATGTTTTCAGAGG + Intronic
1023377888 7:39577018-39577040 CTAAGTAGCTGGGATTACAGGGG + Intronic
1023647310 7:42331158-42331180 CTAGACTGCTGGTTTTCCAGTGG - Intergenic
1023818395 7:43966963-43966985 CCAAGTAGCTGGGATTTCAGGGG + Intergenic
1024267659 7:47619167-47619189 ATAGGCAGCTGGACTTCCAGAGG + Intergenic
1024707782 7:51979806-51979828 CCAAGCAGCTGGGATTACAGGGG - Intergenic
1025028219 7:55535402-55535424 TGAGGCAGCAGGGTTTCCAGGGG - Intronic
1026468035 7:70671268-70671290 CTCCCCAGCTGGGTATTCAGTGG + Intronic
1027775093 7:82455058-82455080 CTAGTCATCTGTGTTTTCACAGG - Intergenic
1028601336 7:92603798-92603820 CCAAGTAGCTGGGATTTCAGGGG - Intergenic
1029409755 7:100401277-100401299 CTTGGCAGCCAGCTTTTCAGAGG - Exonic
1029743023 7:102501795-102501817 CCAAGTAGCTGGGATTTCAGGGG + Intronic
1029761013 7:102600956-102600978 CCAAGTAGCTGGGATTTCAGGGG + Intronic
1031826986 7:126577609-126577631 TGAGGCAGCTGAGTTTTCTGTGG - Intronic
1032078498 7:128847278-128847300 CCGGGCAGCTGGGTCTGCAGAGG - Intronic
1032331867 7:130987846-130987868 CTGAGCAGCTGGGATTACAGAGG - Intergenic
1033599337 7:142877453-142877475 CTAGGCCCCTGGCATTTCAGGGG + Intronic
1036407130 8:8465050-8465072 CTAAGTAGCTGGGATTACAGGGG + Intergenic
1037882017 8:22578231-22578253 CCAGGCTGCTGTGTTTTCAGGGG - Intergenic
1042652068 8:71053894-71053916 CTTGGCAGCTGGGTTTCAAGAGG - Intergenic
1042691287 8:71502180-71502202 CTAGTCAAATGGGATTTCAGAGG - Intronic
1043873463 8:85460976-85460998 CTAAGCAGCTGGGACTACAGGGG + Intergenic
1044978717 8:97693457-97693479 CTAAGTAGCTGGGATTACAGGGG + Intronic
1047111951 8:121800486-121800508 CTAGGGTGGTGGGCTTTCAGGGG - Intergenic
1048420072 8:134269486-134269508 CCAGGGAGCTGGGTTGTAAGTGG + Intergenic
1049216537 8:141410875-141410897 CAAGGCAGGTGGGTTCTCTGGGG - Intronic
1052431769 9:28375809-28375831 CTAGAGATCTTGGTTTTCAGAGG + Intronic
1052803733 9:32993842-32993864 CTGAGCAGCTGGGATTACAGGGG + Intronic
1052984729 9:34478468-34478490 CTAGGCAGCTGAGTTGTGACTGG + Intronic
1053388489 9:37715399-37715421 AAAGGCAGCAGGGTTTACAGAGG - Intronic
1053602328 9:39623618-39623640 ACTGGCAGTTGGGTTTTCAGGGG - Intergenic
1053859981 9:42377344-42377366 ACTGGCAGTTGGGTTTTCAGGGG - Intergenic
1054251207 9:62718817-62718839 ACTGGCAGTTGGGTTTTCAGGGG + Intergenic
1054565318 9:66753330-66753352 ACTGGCAGTTGGGTTTTCAGGGG + Intergenic
1054786377 9:69214209-69214231 CTAAGTAGCTGGGATTACAGGGG + Intronic
1055039992 9:71859347-71859369 CCAAGCAGCTGGGATTACAGAGG + Intergenic
1055045068 9:71915304-71915326 CCAAGTAGCTGGGATTTCAGGGG + Intronic
1055302707 9:74898939-74898961 CCAGGTAGCTGGGATTACAGGGG + Intergenic
1056596614 9:88012998-88013020 CCATGGAGCTGGGTTTGCAGGGG - Intergenic
1056863573 9:90209785-90209807 CTGAGCAGCTGGGATTACAGGGG + Intergenic
1057209263 9:93190845-93190867 CTAGGCGGCTGCTTTTCCAGAGG + Intronic
1060082628 9:120665329-120665351 CTAAGTAGCTGGGATTACAGGGG + Intronic
1060387476 9:123245292-123245314 CTAAGCATCTGGATTTTTAGAGG - Intronic
1061294160 9:129667833-129667855 CCAGGCAGCTGGGTGTGCAGTGG + Intronic
1061894296 9:133639081-133639103 CTAGGCTGCAGGGTTTAAAGTGG + Intronic
1061979878 9:134096009-134096031 ACAGGCAGCTGGGATTACAGGGG - Intergenic
1186081030 X:5932046-5932068 CAACGCAGCTGAGTTTTCCGTGG - Intronic
1187134152 X:16530399-16530421 CTAGGCAGCACTGATTTCAGGGG - Intergenic
1187221344 X:17329100-17329122 CTAGGGAGCTGGACTTTGAGTGG - Intergenic
1189484451 X:41418795-41418817 CTAAGCTGCTGGGATTACAGGGG + Intergenic
1189656193 X:43247324-43247346 CTAGGTGGCTGGGTTTTCCCAGG - Intergenic
1191194816 X:57709229-57709251 TTAGGCTGCTTGGTTGTCAGGGG - Intergenic
1191897468 X:66008262-66008284 CTAGGCAGCAGGGTTTGAGGGGG + Intergenic
1192001955 X:67160746-67160768 CTTGGCAGCAGACTTTTCAGTGG + Intergenic
1192247971 X:69388925-69388947 CTGTGCAGCAGGGTTCTCAGTGG - Intergenic
1194039655 X:88924311-88924333 CCAAGCAGCTGGGATTACAGGGG - Intergenic
1194972574 X:100360188-100360210 AGAGGCAACTGGGTTTTTAGTGG - Intronic
1197154280 X:123253163-123253185 TTGGGTAACTGGGTTTTCAGGGG + Intronic
1197216259 X:123869396-123869418 CTAAGTAGCTGGGATTGCAGAGG - Intronic
1197470173 X:126857416-126857438 CTTGGCAGCAGACTTTTCAGTGG + Intergenic
1199063327 X:143385729-143385751 CTGAGTAGCTGGGATTTCAGGGG - Intergenic
1200159381 X:153997805-153997827 CCAGACAGCTGGGATTACAGGGG - Intergenic
1201579172 Y:15493179-15493201 CCAAGCAGCTGGGATTACAGGGG + Intergenic