ID: 999326571

View in Genome Browser
Species Human (GRCh38)
Location 5:150647963-150647985
Sequence CTTTCAGATCCTTCTCCGTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999326571_999326573 -9 Left 999326571 5:150647963-150647985 CCTCACGGAGAAGGATCTGAAAG 0: 1
1: 0
2: 1
3: 12
4: 160
Right 999326573 5:150647977-150647999 ATCTGAAAGAAGCCAAGGCGCGG 0: 1
1: 0
2: 1
3: 22
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999326571 Original CRISPR CTTTCAGATCCTTCTCCGTG AGG (reversed) Exonic
901598199 1:10401496-10401518 GTTACAAATCCTTCTCCCTGTGG - Intronic
905348001 1:37324558-37324580 CTGTCAAATCCTTCTGCATGTGG + Intergenic
907280743 1:53345674-53345696 ATTCCAGATCCTTCTCTGTTTGG + Intergenic
910519749 1:88106280-88106302 CTTTCTGATCCTTGTCAGTCTGG + Intergenic
913708091 1:121448499-121448521 ATTTTAGATCCTTATCTGTGTGG - Intergenic
914846939 1:151288650-151288672 TTTTCAGACCCATCTCCGGGAGG + Exonic
914859447 1:151374050-151374072 CCTTCAGGGCCTTCCCCGTGGGG - Intergenic
915442217 1:155952221-155952243 CTTTCAGACCCTCCACTGTGGGG + Exonic
922033154 1:221824036-221824058 CTCTCAAATCCTTTTCAGTGAGG - Intergenic
1067548521 10:47215278-47215300 CTTTAAGATCCTTTTGTGTGTGG + Intergenic
1068212449 10:53938142-53938164 CTTTTATATGCTTCTCTGTGGGG + Intronic
1071233822 10:83621132-83621154 CATTCAAATCATTCTCCGTATGG - Intergenic
1071603423 10:86969966-86969988 CTCTGAGCTCCTTCTCTGTGGGG - Intronic
1072710234 10:97711749-97711771 CATTCAGAGCCTTCTCCAAGTGG + Intergenic
1072914959 10:99532182-99532204 CTTTCACATACTGCTCTGTGCGG + Intergenic
1074085136 10:110204091-110204113 CTCACAGCTCCTTCTCCTTGGGG - Intergenic
1077252322 11:1566141-1566163 CCCTCAGACCCTTCTCTGTGGGG - Intronic
1079095326 11:17506239-17506261 CTTTCAGACCCTTCTCTCAGTGG + Intronic
1079151942 11:17907760-17907782 CTCTGAGATCCTTCTCCTTTTGG - Intronic
1082677993 11:56132716-56132738 CTTTCACATCCTTGTTCCTGAGG + Intergenic
1082704733 11:56479532-56479554 CTTTCACATCCTTGTTCCTGAGG + Intergenic
1082753729 11:57051018-57051040 CTTTCAGCTCCATCTCCTTTAGG - Intergenic
1083669812 11:64293294-64293316 CTTTCAGATCAGTATCCCTGAGG + Intronic
1085831391 11:79905034-79905056 CTTACAAAACCTTCTCCTTGTGG + Intergenic
1086323341 11:85672660-85672682 GTTTCAGTTCCTCCTCCATGTGG + Intronic
1088896304 11:114081184-114081206 GTTTCAGATCTTTGTCTGTGAGG + Intronic
1091260423 11:134229752-134229774 CTTTCAGGTCATTTTCTGTGAGG + Intronic
1091960948 12:4693730-4693752 CATTCAGGTCCTTATCAGTGAGG - Exonic
1092595346 12:9998022-9998044 CTTTAAGACCCTCCTCAGTGTGG - Intronic
1092731465 12:11538892-11538914 CTTTCATATCCTCCTTGGTGTGG - Intergenic
1094500847 12:31019752-31019774 CTTTCATATCCTCCTTGGTGTGG + Intergenic
1096370334 12:51064027-51064049 CATTCAGATCCTTCTCCTTTGGG + Exonic
1096910676 12:54980731-54980753 CTTACAGATACTTCACCATGGGG + Intronic
1100914177 12:99399475-99399497 CTTTAAGATTCTTGTCAGTGTGG - Intronic
1107539818 13:41378063-41378085 CTTTCAGATGCTTCTCCTTTGGG - Intergenic
1108392262 13:49957904-49957926 CTATCAGATCCATCCACGTGAGG - Intergenic
1113225643 13:108156746-108156768 CTTTCATATCACTCTCAGTGGGG - Intergenic
1114702718 14:24695181-24695203 CTTTCAAGTCCTTCACAGTGTGG - Intergenic
1114786262 14:25603420-25603442 CTCTCAAATCCATCTCCTTGAGG + Intergenic
1116601419 14:46929480-46929502 CTTTCATAACCTTCACCTTGAGG - Intronic
1117987581 14:61403344-61403366 GTGTCAGTTCCTTCTCCCTGTGG - Intronic
1121584639 14:95054825-95054847 GTTTCTCATCCTTCTCCCTGAGG - Intergenic
1122367138 14:101200897-101200919 CTGCCAGATCCTTGTCCGTTTGG + Intergenic
1122997969 14:105275901-105275923 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122997980 14:105275954-105275976 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122997993 14:105276007-105276029 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998004 14:105276060-105276082 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998079 14:105276378-105276400 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998144 14:105276643-105276665 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998167 14:105276749-105276771 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998218 14:105276961-105276983 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998271 14:105277173-105277195 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998284 14:105277226-105277248 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998309 14:105277332-105277354 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998334 14:105277438-105277460 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998347 14:105277491-105277513 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998358 14:105277544-105277566 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1123114657 14:105889283-105889305 CTTTCAGTGCCTTCTGCCTGTGG + Intergenic
1123116818 14:105898684-105898706 CTTTCAGTGCCTTCTGCCTGTGG + Intergenic
1123118873 14:105907958-105907980 CTTTCAGTGCCTTCTGCCTGTGG + Intergenic
1123121102 14:105917553-105917575 CTTTCAGTGCCTTCTGCCTGTGG + Intergenic
1127174274 15:56337280-56337302 TATTCAGATCCTTATCCTTGAGG + Intronic
1127319728 15:57831314-57831336 CTTCCAGCTCCTTCTCTGAGGGG - Intergenic
1134015420 16:10884799-10884821 CTTCCTGCTCCTTCTCTGTGTGG + Intronic
1138175923 16:54898147-54898169 CTTTCACATCCTCCTCTTTGAGG - Intergenic
1140224896 16:73069115-73069137 CTTTCAGCAACCTCTCCGTGTGG - Intergenic
1142548012 17:718996-719018 CTTCCAGATCCTTCACCGTCCGG - Intronic
1145680526 17:26585332-26585354 TTCTCAGAACCTTCTTCGTGAGG + Intergenic
1145681779 17:26603241-26603263 TTCTCAGAACCTTCTTCGTGAGG + Intergenic
1145681944 17:26605621-26605643 TTCTCAGAACCTTCTTCGTGAGG + Intergenic
1145682448 17:26612769-26612791 TTCTCAGAACCTTCTTCGTGAGG + Intergenic
1145682613 17:26615149-26615171 TTCTCAGAACCTTCTTCGTGAGG + Intergenic
1145682816 17:26618154-26618176 TTCTCAGAACCTTCTTCGTGAGG + Intergenic
1145683157 17:26622914-26622936 TTCTCAGAACCTTCTTCGTGAGG + Intergenic
1146969658 17:37062423-37062445 CTTTCGGAGCCTTCACCCTGGGG + Intergenic
1149430794 17:56594388-56594410 CGTTCAGATCCTTTTCCTTGGGG - Exonic
1149531689 17:57400742-57400764 CCTGCAGGTCCTTCTCCTTGGGG - Intronic
1150221217 17:63496918-63496940 CATGCAGCTCGTTCTCCGTGCGG - Exonic
1157801855 18:50627307-50627329 CTTTCAGAACCTTCCCCCTGAGG - Intronic
1157838910 18:50936097-50936119 CTTTCATATTCTTCTCTTTGTGG - Intronic
1158419030 18:57276294-57276316 CTCATAGATCCTTCTCCTTGGGG - Intergenic
1160199513 18:76784490-76784512 CTTTCATATCCTTCCCCTTGTGG + Intergenic
1164809184 19:31142646-31142668 CTTTCAGATCCTTCCCCGACTGG - Intergenic
1165081078 19:33306324-33306346 CTTTAAGGTCCTTCTTCCTGAGG + Intergenic
1166186334 19:41141549-41141571 CTTGCTGTTCCTTCTCCCTGAGG - Intergenic
1167300707 19:48675897-48675919 AGCTCAGCTCCTTCTCCGTGGGG + Intergenic
1167538649 19:50071591-50071613 CTTCCAGAACCTTCTCCCAGTGG - Intergenic
926765340 2:16318834-16318856 CTTTCAGCACATTCTCTGTGAGG + Intergenic
928696096 2:33851693-33851715 CGTGCAGGTCCTTCTCCCTGGGG - Intergenic
929070778 2:38028804-38028826 TTTTTATATCCTTCTCCTTGGGG + Intronic
931074828 2:58698966-58698988 CTTTCAGTTCCTTCCCCATATGG + Intergenic
939012492 2:136862947-136862969 GTTTCAGATCCTTTACCATGGGG + Intronic
940469428 2:154076321-154076343 ATTTCTGATCCTTCTCCATATGG - Intronic
942299269 2:174546739-174546761 CTTTCTGATCCCTGCCCGTGTGG - Intergenic
943643943 2:190387903-190387925 CTTTCAAATCCTTTTTTGTGGGG - Intergenic
946609973 2:221447574-221447596 CCTACAGATGTTTCTCCGTGGGG + Intronic
948524259 2:238560510-238560532 CTTACAGCTCCTTCCTCGTGCGG + Intergenic
1169533212 20:6507451-6507473 CTTTATGATCCTTCTCTTTGGGG + Intergenic
1172357849 20:34292241-34292263 CTTCCAGATCCTGCTGCTTGAGG + Intronic
1173958822 20:47055623-47055645 CTTTCAGATCCTTACCCCTCAGG + Intronic
1174063698 20:47849857-47849879 CCTGCAGATCCTTCTACATGGGG - Intergenic
1174865181 20:54128812-54128834 CTTGCAATTCCTTCTCTGTGGGG - Intergenic
1175146030 20:56897036-56897058 CTTCCAGGTTCTTATCCGTGGGG + Intergenic
1179106459 21:38404824-38404846 CTTTCAGATCCTTGTTTGTTTGG + Intronic
1179721687 21:43319939-43319961 CTTTCAGTGTCTTCTCAGTGTGG + Intergenic
1182576025 22:31273486-31273508 CTTTGGGATCGTTCTCTGTGAGG + Exonic
1183988484 22:41582686-41582708 CTTTCACATCCTTTTCCCAGTGG - Intronic
1184119562 22:42441165-42441187 CTTCCAGACCCTTCTCCGTGGGG + Intergenic
1185218529 22:49617159-49617181 CTGTCTGCTCCTTCTCCGTGGGG - Intronic
950574769 3:13825664-13825686 CTGTCAGATCCTTCAGGGTGTGG + Intronic
950885021 3:16355589-16355611 CTTTCAAATCCATCACCTTGTGG + Intronic
950885704 3:16361002-16361024 CTTTTATATCCTTTTCTGTGAGG + Intronic
952794041 3:37223290-37223312 CATTCAGATTCTTCTCCTTGAGG + Intergenic
952828483 3:37543803-37543825 CCCTCAGATGCTTCTCAGTGGGG + Intronic
953023312 3:39129811-39129833 CCTCCAGATCCCTCTCCATGAGG - Intronic
955101720 3:55856298-55856320 CTTTCAAACCCTTCTCTGGGTGG - Intronic
955656262 3:61248063-61248085 CTTTGAGATCATTCTCCAAGGGG - Intronic
956717700 3:72092799-72092821 CTTTCAGTTCCTCCTCCTCGTGG - Intergenic
964467501 3:157012400-157012422 TTATCAGATTCTTCTCCTTGGGG + Intronic
967575494 3:191085897-191085919 CTCTCAGATCCTTCTCCCAGAGG - Intergenic
967576133 3:191096050-191096072 CCTTCAGATTCTTATCCCTGTGG - Intergenic
968919699 4:3516124-3516146 CCTCCAGCTCCTTGTCCGTGAGG + Exonic
969125681 4:4946108-4946130 CTTTTGGATCCTCCTCCCTGAGG - Intergenic
969881564 4:10178461-10178483 CTTTCAAATCCTCCTCATTGAGG - Intergenic
971346703 4:25818189-25818211 CTTTCAGCTCCTTCTCCCAGGGG + Exonic
972844734 4:42974141-42974163 CTCTCAAATCCATCTCCTTGAGG + Intronic
973003789 4:44985523-44985545 CCTTCAAATCCATCTCCCTGAGG - Intergenic
974944220 4:68506516-68506538 CTTTCAGATCCTAATCATTGGGG + Intergenic
974954768 4:68623827-68623849 CTTTCAGATCCTAATCATTGGGG + Intronic
976493809 4:85702981-85703003 CTTTCACATGCTTCTCGGTGGGG - Intronic
982557872 4:156891535-156891557 CATTCAAATCCTTTTCAGTGAGG + Intronic
984598032 4:181693750-181693772 CTTTCAAGTCCTTCTGCCTGAGG - Intergenic
985344982 4:188994638-188994660 GTTTCAAATCCATCTCCCTGAGG - Intergenic
985680220 5:1252223-1252245 CTTCCAGTTCCTTCTGCCTGAGG + Intergenic
986810872 5:11358346-11358368 CTTTCAGATGCTTACCTGTGTGG - Intronic
986992597 5:13571450-13571472 ATTTCAGAGCCTTCACTGTGTGG + Intergenic
990119457 5:52431980-52432002 CCTTCAAATCCATCTCCCTGAGG - Intergenic
992695242 5:79279549-79279571 CTTTGAGAACCTTATGCGTGGGG + Intronic
993771421 5:91932572-91932594 CATTCAGACACTTCTCCATGTGG + Intergenic
996848311 5:127925405-127925427 CTTTCAATTCCTCCTCCTTGTGG - Intergenic
999326571 5:150647963-150647985 CTTTCAGATCCTTCTCCGTGAGG - Exonic
1001261385 5:170232862-170232884 CATCCAGAACCTTCTCCGTAGGG + Exonic
1002552145 5:180002511-180002533 GTGTCAGCTCCTTCTCTGTGGGG + Intronic
1003497259 6:6675090-6675112 TTTTCAAAGACTTCTCCGTGAGG + Intergenic
1005329381 6:24734300-24734322 CTTCCAGATCTTTTTCCATGTGG - Intergenic
1007513245 6:42390949-42390971 CTTTCAGTTCCTTTTCCCAGTGG - Intronic
1013596362 6:111664284-111664306 CTGACAGATCCTTCTGGGTGCGG + Intronic
1019453672 7:1113488-1113510 CTTACAGAATCTTCTCAGTGTGG - Intronic
1025764244 7:64427946-64427968 CTTTAAGGTCCTTCTGCCTGTGG - Intergenic
1027296997 7:76786009-76786031 ATTTCAGAGCCTTCACTGTGTGG + Intergenic
1031311485 7:120203792-120203814 CTTTCAGATACTTAGCAGTGGGG - Intergenic
1031602457 7:123727249-123727271 CTTTCAGATAGTTCTCCAAGTGG - Intronic
1032006993 7:128310587-128310609 CTTTCAGATATTTCTCTTTGTGG + Exonic
1032119529 7:129145742-129145764 CTTTCAGAATCTTCTGCTTGGGG + Intronic
1033462660 7:141561791-141561813 GTTCCAGATCCTTCTGCTTGTGG - Intronic
1034085444 7:148318073-148318095 CATTCAGACCCTTCTCCTTTTGG + Intronic
1034875761 7:154723648-154723670 CTTTCAGATCCATCCCTCTGTGG + Intronic
1036999853 8:13705277-13705299 CTTTCAGCTCCAGCTCTGTGGGG - Intergenic
1039749434 8:40463577-40463599 ATTTCAGTGCCTTCTCCATGAGG + Intergenic
1040945430 8:52880321-52880343 CCTTCAAATCCATCTCCCTGAGG + Intergenic
1043858254 8:85286382-85286404 CTTTCAGTACCTTCTGAGTGGGG + Intergenic
1043964064 8:86451792-86451814 TTTTCAGATCCATCTCCTTTTGG + Intronic
1049267319 8:141675394-141675416 TTTCCAGATCCTTCTCCAGGAGG - Intergenic
1049450959 8:142661264-142661286 CTTTCAGCCCCTTCTACGTTGGG - Intronic
1051117055 9:13707832-13707854 CTTTCAGTTCCCTTTCCATGTGG - Intergenic
1051880540 9:21835325-21835347 CTTTAAGTTCTTTCTTCGTGAGG - Intronic
1056512176 9:87316551-87316573 CTTCCAGAGGCTTCTCCCTGAGG - Intergenic
1058094354 9:100842743-100842765 CTGTCAGATTCTTCTAAGTGTGG - Intergenic
1059257786 9:112946365-112946387 CTCTCAGCTCCTTCTCAGTTTGG - Intergenic
1061935095 9:133853136-133853158 GGTTCAAAGCCTTCTCCGTGGGG + Intronic
1186661809 X:11675443-11675465 GTTTCAAATCCATCTCCCTGAGG - Intergenic
1188805735 X:34587169-34587191 GTTTCGGATTCTTCTCAGTGAGG - Intergenic
1195866761 X:109440628-109440650 CTTTCTGTTCCTTCTAAGTGAGG - Intronic
1196981333 X:121216976-121216998 CTTTCAGTTGCTTCTTAGTGGGG + Intergenic