ID: 999327095

View in Genome Browser
Species Human (GRCh38)
Location 5:150650212-150650234
Sequence CGCCCTGGAGGGAGACACGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 196}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999327095_999327106 7 Left 999327095 5:150650212-150650234 CCCCCGTGTCTCCCTCCAGGGCG 0: 1
1: 0
2: 2
3: 19
4: 196
Right 999327106 5:150650242-150650264 CCCGAGCCAAGCAGGCCCCCAGG 0: 1
1: 0
2: 1
3: 18
4: 221
999327095_999327113 25 Left 999327095 5:150650212-150650234 CCCCCGTGTCTCCCTCCAGGGCG 0: 1
1: 0
2: 2
3: 19
4: 196
Right 999327113 5:150650260-150650282 CCAGGCCCTCCTTCTCTACCCGG 0: 1
1: 1
2: 4
3: 60
4: 348
999327095_999327103 -1 Left 999327095 5:150650212-150650234 CCCCCGTGTCTCCCTCCAGGGCG 0: 1
1: 0
2: 2
3: 19
4: 196
Right 999327103 5:150650234-150650256 GTGGTCTCCCCGAGCCAAGCAGG 0: 1
1: 0
2: 0
3: 8
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999327095 Original CRISPR CGCCCTGGAGGGAGACACGG GGG (reversed) Exonic
900185019 1:1328870-1328892 CTCCCAGGAGGGAGACGCTGGGG + Exonic
900215679 1:1480331-1480353 CGCCCGGGTGGGAGACAAGGAGG - Intronic
900372282 1:2337332-2337354 AGGCGTGGAGGGAGACACCGAGG + Intronic
901679731 1:10906129-10906151 CTCCCTCGAGGGACACACTGTGG + Intergenic
903537151 1:24074506-24074528 AGCCCTGGAGGAAGTCAGGGTGG - Intronic
903773497 1:25778662-25778684 AGCCCCGGAGGCAGAAACGGCGG + Intronic
904858790 1:33519750-33519772 GGCCCTGGAGGGAGAGAGGGAGG + Intronic
905106084 1:35564414-35564436 AGCCAAAGAGGGAGACACGGAGG - Intronic
905345483 1:37308397-37308419 CGCTCAGGAGGGAGTGACGGAGG + Intergenic
906511063 1:46410703-46410725 GGCCCTGGGGGGAGGCATGGAGG + Intronic
906691165 1:47793522-47793544 CGCCCTGGAGGGCGGCATGAGGG + Intronic
908841272 1:68282364-68282386 CACCATGGCGGAAGACACGGAGG + Intergenic
910515359 1:88054305-88054327 TGCCCTGAAGGGAGATACGCAGG - Intergenic
915005392 1:152630406-152630428 TGCCCTGGAGGGAGAGACCCAGG + Intergenic
915539687 1:156558187-156558209 CGTCCGGGAGGGAGGCGCGGGGG + Intronic
917848310 1:179040542-179040564 CGTCCTGGAGGGAGGTAGGGGGG - Intronic
920216339 1:204363607-204363629 CGCGGAGGAGGGAGACAAGGGGG + Intronic
920695033 1:208175410-208175432 AGCCCTGGAGGGATACAGTGGGG - Intronic
921302031 1:213760423-213760445 AGCCCTGGAGAGAGAAACTGGGG + Intergenic
921414167 1:214869589-214869611 CGTCCTGGAGGGAGATGGGGGGG - Intergenic
922902540 1:229147955-229147977 CGCCCTGGGGGAAGAAACAGCGG - Intergenic
923053257 1:230403720-230403742 TGCCCTGGTGGGAGAGAAGGCGG - Intronic
1069739223 10:70676959-70676981 CCTCCTGGAGCGAGACACAGAGG + Intronic
1070716288 10:78724458-78724480 TTCCCTGGAGGGATCCACGGTGG - Intergenic
1071420529 10:85492729-85492751 AGCCCTGGAGGGAGGTACGTGGG + Intergenic
1072550774 10:96475677-96475699 GTCCCTGGAGGGAGACATGGGGG - Intronic
1072609327 10:97006167-97006189 AGCACTGGAGGCAGACACTGAGG + Intronic
1074145802 10:110716246-110716268 TGCCCTGGAGGGAGACATCTGGG - Intronic
1075743865 10:124712881-124712903 CTCCCTGGGTGCAGACACGGTGG + Intronic
1076622721 10:131802743-131802765 AGCCCTGGAGGCAGACACTTGGG + Intergenic
1076635561 10:131880112-131880134 AGCCCTGGAGGCAGGCAGGGTGG + Intergenic
1076680100 10:132167396-132167418 GGCCCTGGGGGCAGACACGGTGG + Intronic
1077093175 11:788655-788677 GGGCCTGGAGGGAGACACAAGGG + Exonic
1077362366 11:2146337-2146359 CGCCCTGCAGGGGGTGACGGAGG - Intronic
1078377492 11:10808354-10808376 CGCCGTGGCGGGAGGCACGCGGG - Intronic
1079096993 11:17517415-17517437 TGACCTGGATGGAGGCACGGAGG - Intronic
1081701722 11:45156760-45156782 CGCCCTGGAGGTGGAGAGGGAGG + Intronic
1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG + Exonic
1083638893 11:64134907-64134929 GACCCTGGAGGGAGACTCTGAGG - Intronic
1083768631 11:64854276-64854298 CGGCCGGGAGGCAGAGACGGGGG - Exonic
1084398538 11:68930549-68930571 CGTCCTGGTGGGAGACACATGGG + Intronic
1084785300 11:71438522-71438544 CCCCCTGTAGGGAGAGAGGGTGG - Intronic
1089129909 11:116203370-116203392 AGCCCTGGAGGGAGATCCAGGGG - Intergenic
1089343973 11:117778325-117778347 GACCCTGGAGGGAGGCAAGGTGG + Intronic
1090606087 11:128424387-128424409 AGGCCTGGAGGCAGACAGGGAGG - Intergenic
1091916691 12:4275131-4275153 AGCCCTGGAAAGAGGCACGGGGG - Intronic
1091985949 12:4910371-4910393 TGCCCTGGCGGGAGCCGCGGCGG - Exonic
1096195498 12:49646758-49646780 GGCCCAGGAGAGAGACACAGTGG + Intronic
1096535315 12:52268410-52268432 GGCCCTGAAGGGAGACTCTGAGG + Intronic
1097358562 12:58631328-58631350 TGCCCTGGGGGGATACAAGGGGG - Intronic
1099978053 12:89566935-89566957 TGCCCAGGAGGGAGAGAAGGAGG + Intergenic
1102680747 12:114688696-114688718 TGCCCTGGAGGGAGGAAAGGTGG - Intergenic
1102875241 12:116444033-116444055 CGCACTGGCGGGAGACATGGGGG - Intergenic
1103209320 12:119154907-119154929 GGACCTAGAGGGAGCCACGGTGG + Intronic
1104417031 12:128604039-128604061 CACCAGGGAGAGAGACACGGAGG - Intronic
1104598171 12:130133973-130133995 CACACAGGAGGGCGACACGGAGG + Intergenic
1104747784 12:131220997-131221019 CACCCTGGAGGGAGGGAGGGAGG - Intergenic
1106188130 13:27426399-27426421 CGTCCAGGAGGGAGGCACCGAGG - Intronic
1107727958 13:43318962-43318984 CAACCTGGAGGGAGAGAGGGAGG + Intronic
1112691754 13:101904200-101904222 AGCCCTGGAGGTAGACACACTGG - Intronic
1112768780 13:102773714-102773736 CTCCCTGAAGGGAGTGACGGCGG - Exonic
1113917414 13:113882865-113882887 CGCCCTTGCAGGAGAGACGGGGG - Intergenic
1117089051 14:52231394-52231416 TTCCCTGGAGGGTGACATGGGGG + Intergenic
1118321805 14:64757766-64757788 CTCCCTGGAGGGGGACAAGGAGG + Intronic
1121001284 14:90453742-90453764 CGCAGTGGAGGGAGGCCCGGGGG - Intergenic
1122789881 14:104179655-104179677 GGCCCTGGAGCGAGCCACGGCGG + Exonic
1122938092 14:104969135-104969157 AGCCTTGGAGGCAGACACAGAGG - Intronic
1123069078 14:105632353-105632375 GCCCCAGGAGGGAGACACAGAGG - Intergenic
1123147063 14:106142225-106142247 CTCCCTGCAGGGAGACAGGAGGG - Intergenic
1123218211 14:106831670-106831692 CTCCCTGCAGGGAGACAGGAGGG - Intergenic
1123917688 15:25048963-25048985 AGACATGGAGGGAGACAGGGAGG - Intergenic
1126295692 15:47133270-47133292 CGTCCGGGAGGGAGGCGCGGGGG + Intergenic
1126599844 15:50417682-50417704 CGCCTGGAAGGGAGAAACGGAGG + Intergenic
1128385568 15:67145829-67145851 CGCCTTGCAGGGAGACACGGTGG - Intronic
1132603100 16:782612-782634 GGCCCAGGAGGGAGACAGGGAGG + Intronic
1133201740 16:4207899-4207921 CGCGCTGGCGGCAGACGCGGGGG + Intronic
1134862585 16:17573940-17573962 CCTCCTGGAGGGAGACACAGTGG + Intergenic
1136075402 16:27813766-27813788 CTCCCTGGCAGGAAACACGGAGG + Intronic
1140051395 16:71484479-71484501 CTCAGTGGAGGGAGACAGGGCGG - Intronic
1140730526 16:77852064-77852086 GGCCCTGGAGGAAGAGACTGTGG - Intronic
1142030754 16:87837277-87837299 AGCCCTGGAGGAAGCCACTGTGG + Intronic
1145230623 17:21171031-21171053 AGCCCTGGAGGTGGACTCGGGGG + Intronic
1145896206 17:28459125-28459147 CGTCCGGGAGGGAGACGGGGGGG + Intronic
1147598408 17:41731556-41731578 AGGCCTGGAGGGAGACAAAGAGG + Exonic
1148022439 17:44562343-44562365 CACCCTGGAGGAAGACTCAGAGG + Intergenic
1149909003 17:60551682-60551704 CGTCCTGGAGGGAGATGGGGGGG + Intergenic
1152196983 17:78924148-78924170 CGCCATGGAGGGAGGCAGGAGGG - Intronic
1152904133 17:82961169-82961191 CGCCCTGCAGGGCGTCCCGGAGG - Exonic
1152914631 17:83027130-83027152 CACCCTGGACAGACACACGGAGG + Intronic
1153690942 18:7592890-7592912 CGGGCTGAAGGGAGACTCGGAGG + Intronic
1156469268 18:37367314-37367336 CAGACTGGAGGCAGACACGGGGG + Intronic
1157598114 18:48876091-48876113 AGCCCTGGACCGAGACACCGTGG - Intergenic
1157977492 18:52342366-52342388 GGCCCGGGAGGGACAGACGGAGG - Intronic
1160524259 18:79525811-79525833 TGCCCAGGAGGAAGACACGGTGG - Intronic
1163493418 19:17630659-17630681 TGCCCTGGAGCGAGACAAGAAGG - Exonic
1164388059 19:27793841-27793863 ATCCCTGGAGGGAGACAGCGCGG + Intergenic
1165313515 19:35041752-35041774 CGGCCTGGAGGCAGAGGCGGTGG - Exonic
1165327674 19:35123722-35123744 TGCCCTGGAGGCTGACACAGAGG + Intronic
1166276721 19:41758922-41758944 AGCCCTGGATGGGGACACAGTGG - Intronic
1167002824 19:46756026-46756048 CGCCCTGGACGGAGATGCTGTGG + Exonic
1168421671 19:56208114-56208136 GGACCTGGAGGAAGACAGGGAGG + Exonic
925554978 2:5120980-5121002 CTCCCTGGAGGGAGAGAGGATGG - Intergenic
925588576 2:5487570-5487592 TGCCCTGGAGGGAGAGACTTGGG + Intergenic
926097845 2:10094021-10094043 GTCCCTGGAGGGAGACCCCGAGG - Intergenic
928330823 2:30356659-30356681 GTCCCTGGAGGGTGACACGCTGG - Intergenic
932654806 2:73601306-73601328 GACCCTGGAGGGAGCCACTGCGG + Exonic
932662959 2:73672920-73672942 AGCCGTGGAGGGAGCCACTGTGG + Intergenic
932793171 2:74673438-74673460 CCCCCTGCAGGGCGACAGGGAGG - Exonic
934513172 2:94964478-94964500 CTCCCTGCAGGGAGACAGGAGGG - Intergenic
934778511 2:96954124-96954146 GGCCCTGGAGGGAGAGACAGAGG + Intronic
935459026 2:103306832-103306854 GGACCTGGAGCCAGACACGGTGG - Intergenic
936982036 2:118273736-118273758 CGCCCTGGACGTAGGCACTGAGG - Intergenic
939917095 2:148059996-148060018 CTCACTGGAGGCAGGCACGGTGG + Intronic
941666305 2:168247115-168247137 CGCCCTGGAGGCAGAGAGGCCGG - Intronic
946312805 2:218892360-218892382 CGGCCTGGAGCGAGATACAGCGG + Intronic
948896776 2:240931314-240931336 TGCCCAGGAGGCAGACACTGGGG + Intronic
1169293025 20:4368892-4368914 CGCCCTTGAGGGAGAGAGGAAGG - Intergenic
1169414713 20:5405970-5405992 CATCCTGCAGGGAGACACTGAGG + Intergenic
1170598361 20:17822367-17822389 CCCCCTGAAAGGAGACAAGGAGG + Intergenic
1170677608 20:18497015-18497037 CAGCCTGGAGGGAGGGACGGCGG - Intronic
1171726827 20:28631002-28631024 CACCCTGGAAGGTGACAAGGAGG + Intergenic
1171774017 20:29349248-29349270 TGCTGTGGAGGGAGACACCGGGG - Intergenic
1171816024 20:29786802-29786824 TGCTGTGGAGGGAGACACCGGGG - Intergenic
1175646391 20:60676549-60676571 CGCCTTCGAGGAAGACAGGGAGG + Intergenic
1175776148 20:61654897-61654919 CGCTCTGGACAGGGACACGGGGG + Intronic
1175776158 20:61654933-61654955 CGCTCTGGACAGGGACACGGGGG + Intronic
1176023325 20:62973531-62973553 AGCCCTGGAGGGACATGCGGGGG - Intergenic
1176197292 20:63843420-63843442 CGGACTGGTGGGAGAGACGGAGG - Intergenic
1176265789 20:64208680-64208702 CGATCTGGAGCGAGACACAGCGG + Intronic
1178531100 21:33376947-33376969 GGCGCTGGAGGAAGACAAGGTGG - Intergenic
1178770895 21:35503012-35503034 GGATTTGGAGGGAGACACGGAGG - Intronic
1179808336 21:43854269-43854291 AGCCCTGTGGGGATACACGGAGG + Intergenic
1180187182 21:46145687-46145709 CGCCCTGGGTGGAGACGTGGGGG - Intronic
1180997607 22:19973228-19973250 CTGCCTGGAGGAAGACACCGTGG - Exonic
1181766065 22:25092913-25092935 TGCACTGGAGGGAGTCAGGGTGG + Intronic
1183316509 22:37139923-37139945 CACCCTGTAGGGGGACACAGAGG - Intronic
1184103863 22:42355982-42356004 CACCCAGGAGGGAGAGAAGGGGG + Intergenic
1184391701 22:44206887-44206909 TGCCCTGGAGGGTGACTCTGGGG - Exonic
1184631422 22:45783566-45783588 AGCACTGGAGGGAAACACGAAGG - Intronic
1184914869 22:47562549-47562571 CACCCTGGAGGGTGTCAGGGAGG + Intergenic
951170244 3:19533513-19533535 CTCCCTGGAGGGACACACAGAGG - Exonic
953254464 3:41276316-41276338 TGCCCTGGAGGGAGACTCGAAGG - Intronic
954743958 3:52776239-52776261 GGCCAGGGAGGCAGACACGGTGG - Intergenic
960312617 3:116134825-116134847 CCTCCTAGAGGGAGACACTGGGG - Intronic
961340374 3:126213282-126213304 CGGCCTGGAGGGAGACCCGGCGG + Intergenic
961486523 3:127221213-127221235 GGCCCTGCAGGGTGACAGGGAGG + Intergenic
962613790 3:137104083-137104105 CACCCAGGAGAGAGACAAGGTGG + Intergenic
964893197 3:161561253-161561275 CTCCCTACAGGGAGAGACGGAGG + Intergenic
968041388 3:195592094-195592116 GCCCCTGGAGGGAGACACCCAGG + Intergenic
968081269 3:195848196-195848218 CGCCCAGGATGGGGACACTGGGG - Intergenic
968453687 4:686846-686868 CGCCCTCGGGGGAGGCAGGGTGG - Intronic
968573765 4:1355541-1355563 CTCCCTAGAAGGAGTCACGGGGG - Intronic
968652483 4:1765774-1765796 CGCCCTGGAGGGATACTCAGAGG + Intergenic
969520531 4:7675480-7675502 CGACCTGCAGGGAGGCACCGTGG - Intronic
969641858 4:8403517-8403539 CACCCTGCAGAGAGACACGGTGG + Intronic
971340601 4:25765325-25765347 CGCCCTGGATGGAGACTCCCAGG - Exonic
972321714 4:37977890-37977912 CACCCGCGAGGGAGACACGCGGG - Intronic
973281401 4:48363801-48363823 CGTCCGGGAGGGAGATGCGGGGG - Intronic
985493602 5:192895-192917 CTCCCTCGAGGGAGACTGGGAGG - Intronic
985995855 5:3596447-3596469 CGCCCGGGAGGGAGAGACTACGG + Intronic
990389803 5:55307499-55307521 GGCTCTGGAAGCAGACACGGCGG + Exonic
992397639 5:76382321-76382343 GGCCCTGGAGAGACACAAGGGGG - Intergenic
997892337 5:137687231-137687253 CGTCCGGGAGGGAGGCGCGGGGG + Intronic
998143369 5:139711960-139711982 AGCGCTGGCGGGAGACAAGGAGG - Intergenic
999327095 5:150650212-150650234 CGCCCTGGAGGGAGACACGGGGG - Exonic
999523466 5:152376997-152377019 GGCTCTAGAGGGAGGCACGGGGG + Intergenic
1000384977 5:160666748-160666770 CTCCCTGGAGGGAGACATCTTGG - Intronic
1001237898 5:170045410-170045432 GGCCCTGGAGACACACACGGGGG + Intronic
1002636027 5:180609233-180609255 TGCCACGGAGGGAGACACTGAGG + Intronic
1006410761 6:33872058-33872080 AGCCCTGGAGGGAGGCGAGGGGG - Intergenic
1006443859 6:34068142-34068164 CGTGCTGGAGGGAGACGGGGGGG + Intronic
1007696464 6:43737072-43737094 GGCCTTGTAGGGTGACACGGTGG + Intergenic
1011112448 6:83853548-83853570 GGCGCAGGAGGGAGAGACGGGGG - Intronic
1012887284 6:104859952-104859974 CGCCCTGGGCGGAGTCACGTTGG + Intergenic
1016317845 6:142809429-142809451 TGCTCTGAAGAGAGACACGGGGG - Intronic
1016573411 6:145540082-145540104 CAGGCTGGAGGCAGACACGGCGG - Intronic
1019605857 7:1909888-1909910 CGCCCTGGAATTACACACGGAGG + Intronic
1019738470 7:2661649-2661671 TGTACTGGAGGGAGACAAGGGGG - Exonic
1019779221 7:2929804-2929826 CACTCTGGAGGGAGAGAGGGTGG + Intronic
1020118126 7:5487728-5487750 CGCCCTGGAGGGGCACACACGGG + Intronic
1020213510 7:6172008-6172030 CGCCCAGGAGTGAGCCCCGGAGG + Intronic
1022355429 7:29610109-29610131 CTCCCTGGAGTGAGGCACCGAGG + Intergenic
1023262301 7:38370297-38370319 GGCCCTGGAGGGAGACACAATGG - Intergenic
1024546652 7:50528157-50528179 AGCCCTGGAGAGAGACAAAGCGG - Exonic
1024571594 7:50727339-50727361 AGCCCTGGAGGGAGACAGACAGG - Intronic
1025253944 7:57370424-57370446 CTCCCTGGAGTGAGAGACTGAGG + Intergenic
1025821322 7:64967568-64967590 CGTCCGGGAGGGAGGCAGGGGGG - Intergenic
1026624321 7:71978991-71979013 TTCTCTGGAGGGAGACACTGTGG - Intronic
1026895941 7:74010173-74010195 CACCCTGGAGGGAGAATAGGGGG + Intergenic
1026939311 7:74277763-74277785 GGCCCTGGAGGAAGTCAGGGGGG - Intergenic
1028505462 7:91565806-91565828 CGGCCTGGAGGGAGAGAGAGAGG + Intergenic
1030145960 7:106356013-106356035 TGATCTGGAGGTAGACACGGTGG + Intergenic
1033210012 7:139453643-139453665 GGCCCTGGAGGAAGGCACGCTGG - Exonic
1034336926 7:150329894-150329916 GCCCCTGGAGGGAGCCGCGGAGG + Exonic
1034536327 7:151728042-151728064 GGGCCTGGAGGGATCCACGGAGG - Intronic
1038459675 8:27705253-27705275 AGCCCTGGAGGGAGCCAGGTGGG - Intergenic
1040017205 8:42709251-42709273 GGCTCTGCAGGGAGACAGGGTGG + Intronic
1041673590 8:60516790-60516812 CGCCCTGCTGGAAGACAGGGCGG + Intergenic
1042021483 8:64374182-64374204 CGCCCAGGAGGGAGAAATTGTGG + Intergenic
1048362698 8:133711849-133711871 AGCCCTGGAGGGAAGCACTGAGG + Intergenic
1049293519 8:141817060-141817082 CCTCCTGGAGGGAGACACGTGGG - Intergenic
1049530407 8:143151693-143151715 TCCCCTTGAGGGAGACAGGGAGG - Intergenic
1049654738 8:143792543-143792565 CGCCCTGGACGGGGAGACGCTGG - Exonic
1049675912 8:143888943-143888965 CGCCGGGGAGGGAGAGGCGGAGG + Intergenic
1053280961 9:36819610-36819632 AGCCCTGCAAGGAAACACGGGGG + Intergenic
1056540601 9:87567769-87567791 CGCCATGGAGGGAGGTCCGGTGG - Intronic
1057509849 9:95669254-95669276 CTCCCTGGAAGGAGACCCTGAGG + Intergenic
1059656873 9:116365345-116365367 CTCCCGGGAAGGAGACGCGGAGG + Intronic
1060423829 9:123488280-123488302 CTCCCTGGAGGGAGTCAGGCTGG + Intronic
1203784083 EBV:117477-117499 CGCCCTGTCGTGAGTCACGGCGG - Intergenic
1186426237 X:9465688-9465710 CGCCTTGCGGGGAGAGACGGAGG + Intronic
1186438890 X:9567678-9567700 TGGCCTGGAAGGAGACATGGTGG - Intronic
1186459220 X:9734853-9734875 CTCCCTGGAGGGAAACCGGGAGG + Intronic
1190065188 X:47235612-47235634 CGGCCTGGATGGAGACAGGGAGG - Intronic
1192511431 X:71722662-71722684 AGCCCAGCAGGGAGACACAGAGG - Intergenic
1192515266 X:71758843-71758865 AGCCCAGCAGGGAGACACAGAGG + Intergenic
1198810297 X:140529170-140529192 CACCCAGGAGGGAGAGAAGGAGG + Intergenic
1201070981 Y:10147159-10147181 TGCTGTGGAGGGAGACACCGGGG + Intergenic