ID: 999329215

View in Genome Browser
Species Human (GRCh38)
Location 5:150661423-150661445
Sequence CTCAGGTACCAGCATCCTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 104}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999329205_999329215 4 Left 999329205 5:150661396-150661418 CCCTCCTGCCTATTGTGGTCCCA 0: 1
1: 0
2: 0
3: 10
4: 174
Right 999329215 5:150661423-150661445 CTCAGGTACCAGCATCCTAGGGG 0: 1
1: 0
2: 0
3: 3
4: 104
999329206_999329215 3 Left 999329206 5:150661397-150661419 CCTCCTGCCTATTGTGGTCCCAT 0: 1
1: 0
2: 0
3: 7
4: 129
Right 999329215 5:150661423-150661445 CTCAGGTACCAGCATCCTAGGGG 0: 1
1: 0
2: 0
3: 3
4: 104
999329207_999329215 0 Left 999329207 5:150661400-150661422 CCTGCCTATTGTGGTCCCATCCT 0: 1
1: 0
2: 0
3: 8
4: 104
Right 999329215 5:150661423-150661445 CTCAGGTACCAGCATCCTAGGGG 0: 1
1: 0
2: 0
3: 3
4: 104
999329208_999329215 -4 Left 999329208 5:150661404-150661426 CCTATTGTGGTCCCATCCTCTCA 0: 1
1: 0
2: 0
3: 10
4: 164
Right 999329215 5:150661423-150661445 CTCAGGTACCAGCATCCTAGGGG 0: 1
1: 0
2: 0
3: 3
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999329215 Original CRISPR CTCAGGTACCAGCATCCTAG GGG Intronic