ID: 999330218

View in Genome Browser
Species Human (GRCh38)
Location 5:150668708-150668730
Sequence CTGCAAAAGGCTTCCTTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 184}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999330212_999330218 -4 Left 999330212 5:150668689-150668711 CCATTCTGTCCCCTCTGTCCTGC 0: 1
1: 0
2: 12
3: 68
4: 790
Right 999330218 5:150668708-150668730 CTGCAAAAGGCTTCCTTTGTTGG 0: 1
1: 1
2: 0
3: 21
4: 184
999330211_999330218 1 Left 999330211 5:150668684-150668706 CCTCACCATTCTGTCCCCTCTGT 0: 1
1: 1
2: 1
3: 41
4: 406
Right 999330218 5:150668708-150668730 CTGCAAAAGGCTTCCTTTGTTGG 0: 1
1: 1
2: 0
3: 21
4: 184
999330207_999330218 28 Left 999330207 5:150668657-150668679 CCACACAGGGCTCTCACCTGCCA 0: 1
1: 0
2: 2
3: 34
4: 298
Right 999330218 5:150668708-150668730 CTGCAAAAGGCTTCCTTTGTTGG 0: 1
1: 1
2: 0
3: 21
4: 184
999330206_999330218 29 Left 999330206 5:150668656-150668678 CCCACACAGGGCTCTCACCTGCC 0: 1
1: 0
2: 4
3: 30
4: 308
Right 999330218 5:150668708-150668730 CTGCAAAAGGCTTCCTTTGTTGG 0: 1
1: 1
2: 0
3: 21
4: 184
999330209_999330218 12 Left 999330209 5:150668673-150668695 CCTGCCAAGGTCCTCACCATTCT 0: 1
1: 1
2: 0
3: 29
4: 289
Right 999330218 5:150668708-150668730 CTGCAAAAGGCTTCCTTTGTTGG 0: 1
1: 1
2: 0
3: 21
4: 184
999330210_999330218 8 Left 999330210 5:150668677-150668699 CCAAGGTCCTCACCATTCTGTCC 0: 1
1: 0
2: 2
3: 20
4: 300
Right 999330218 5:150668708-150668730 CTGCAAAAGGCTTCCTTTGTTGG 0: 1
1: 1
2: 0
3: 21
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999330218 Original CRISPR CTGCAAAAGGCTTCCTTTGT TGG Intronic
900366295 1:2313237-2313259 CTGGAACAGGCCTCCTTTGCAGG - Intergenic
904111605 1:28130517-28130539 CCGCAAAAGGTTTCCACTGTAGG + Intergenic
905256926 1:36690850-36690872 ATGGCAAAGGCTTCCTTTGAGGG + Intergenic
906196322 1:43932736-43932758 CTGCAAAAGTGTGCCTTTGGCGG - Intergenic
906743294 1:48203537-48203559 CTGAAAAAGCCTTTTTTTGTAGG + Intergenic
907559005 1:55371324-55371346 CTGAAGAAAGCTTCCTGTGTTGG - Intergenic
908078945 1:60553632-60553654 TTCCAAAAGCCTTCTTTTGTAGG + Intergenic
909554781 1:76941499-76941521 CTGAAAAAGGCTACATTTATAGG - Intronic
910432707 1:87174805-87174827 CTGAAAGAGGCTTCCACTGTGGG - Intergenic
912747764 1:112259717-112259739 CATCAAAAGGCCACCTTTGTAGG + Intergenic
914577131 1:148983280-148983302 ATTCAGAAGGCTTCCTTGGTTGG - Intronic
917725628 1:177824842-177824864 CTGCAAAGTGCTTTCTTTTTTGG - Intergenic
919262775 1:195218836-195218858 CTGCATGTGGCTTCCTCTGTGGG - Intergenic
920878955 1:209862716-209862738 CTGCAAAAGGCTGGATTTCTGGG + Intergenic
922360366 1:224816058-224816080 CTGCAGGAAGCTTCCTTTATAGG + Intergenic
924743182 1:246809607-246809629 CTGCAGAAGGCTCCCCTTGGTGG - Intergenic
1065350796 10:24793987-24794009 CTGGAAATGGCTTCCTTCTTTGG + Intergenic
1066433859 10:35378905-35378927 CTGCACTAGGCTTGCTTTATTGG + Intronic
1067511730 10:46901124-46901146 CTGCACACTGCTTCCATTGTTGG + Intergenic
1067650517 10:48150701-48150723 CTGCACACTGCTTCCATTGTTGG - Intergenic
1068938536 10:62658566-62658588 CTACAAGCGGCTTCCATTGTGGG - Intronic
1070334181 10:75439880-75439902 AGGCAAAAGGCTTCCTTTCCTGG + Intronic
1074183065 10:111079555-111079577 CAGCAAGAAGCTTCCCTTGTAGG - Exonic
1074541157 10:114366272-114366294 CTGTAAAAGGCATGCTTGGTAGG + Intronic
1075557549 10:123444385-123444407 CTGGAAAAGTCTTGCTTGGTTGG + Intergenic
1075721627 10:124590901-124590923 CTGCAACAGGCCTCCTTTCCAGG + Intronic
1079184014 11:18220542-18220564 CTGCAAATGGCTTCCACTGAGGG + Intronic
1080822926 11:35824367-35824389 CTTAACAAGGCTTCCCTTGTGGG - Intergenic
1081857401 11:46312496-46312518 CTTCAGAGGGCTTCCTTGGTGGG + Intronic
1082635465 11:55587769-55587791 CTGTAAAACTCTTCTTTTGTTGG - Intergenic
1083592898 11:63905606-63905628 GTGCCAAAGGTTTCCTGTGTTGG + Intronic
1084291901 11:68176969-68176991 CTGCTGAATGCTTCCTTTGCTGG - Intronic
1086074792 11:82838923-82838945 CTATAAAATGCTTCCTTTGTAGG + Intronic
1086656481 11:89363215-89363237 CTCAAAAGGACTTCCTTTGTTGG - Intronic
1088025251 11:105172456-105172478 TTGGAAAAGGCTACCTTTTTGGG + Intergenic
1090456059 11:126850652-126850674 CTGGTAAAGTCTTCCTCTGTTGG - Intronic
1090474344 11:127005744-127005766 CTGGAAAAGACTTCCTTTAAAGG + Intergenic
1091571459 12:1690750-1690772 CTCCAAATTGCTTCCTTTTTCGG + Intronic
1093666567 12:21820777-21820799 TTGGAAAAGTCTTCCTTTCTTGG + Intronic
1101891992 12:108725441-108725463 ATGCAAAAGGCTTACCTTGCAGG - Intronic
1101943725 12:109120161-109120183 CTCCAAAAGCCTCACTTTGTGGG - Intronic
1105531446 13:21224328-21224350 TCACAAAAGTCTTCCTTTGTTGG + Intergenic
1105636001 13:22215965-22215987 ATGCAAAAGGCTTCCTCAGTAGG - Intergenic
1107051843 13:36059021-36059043 CTGCAAAACGCTACCTTTATAGG + Intronic
1107063431 13:36186528-36186550 CTGGAAAAGTCTTCATTTGTGGG + Intronic
1107099187 13:36570717-36570739 GGGCAAACAGCTTCCTTTGTGGG + Intergenic
1110237361 13:73230628-73230650 CAGCAAAATCCTTCCTTTGGTGG - Intergenic
1110730653 13:78876065-78876087 CTGCAAGTGGCTTCCACTGTGGG + Intergenic
1110984181 13:81941989-81942011 TTGTAGAAGGATTCCTTTGTGGG - Intergenic
1111306853 13:86425669-86425691 TTACAAAAGGCCTCCTTTTTTGG + Intergenic
1111828894 13:93301746-93301768 CTCCCAAAGGCTCCATTTGTAGG - Intronic
1113096819 13:106674203-106674225 CTGGAAAAGCCTTCCTTTTGTGG + Intergenic
1113481449 13:110624991-110625013 CGGCAAAAGTCTTTCTTTTTAGG + Intronic
1113670787 13:112174618-112174640 CCGCAACACACTTCCTTTGTTGG - Intergenic
1113882001 13:113632240-113632262 CTGCAAAAGCCTGCCTGTGTTGG + Intronic
1113970807 13:114186687-114186709 CTGCAAGAAGCTTCCATAGTTGG - Intergenic
1116955138 14:50915668-50915690 TTTCAAAAAGCTGCCTTTGTTGG + Intronic
1117751849 14:58931427-58931449 CTGCCAAGGGCTTCTTTTCTTGG + Intergenic
1118054235 14:62062718-62062740 CAGCAAATGGCTGCCTGTGTTGG - Intronic
1118093724 14:62512898-62512920 CTGCAAACGCCGCCCTTTGTTGG - Intergenic
1118530866 14:66703409-66703431 TTCCAACGGGCTTCCTTTGTAGG - Intronic
1120448875 14:84640249-84640271 CTGCCAAATGCTTTCTTTGAAGG + Intergenic
1202840288 14_GL000009v2_random:114939-114961 CTGCAAACAGCTTCCACTGTGGG - Intergenic
1202909671 14_GL000194v1_random:105136-105158 CTGCAAACAGCTTCCACTGTGGG - Intergenic
1202883621 14_KI270722v1_random:84166-84188 CTGCAAACAGCTTCCACTGTGGG + Intergenic
1124839501 15:33228702-33228724 CTGTAAAAGCCTTCCTTTCCAGG - Intergenic
1124845080 15:33282335-33282357 CTTCACAAGGCTTTCTTTGAAGG + Intergenic
1125713368 15:41804843-41804865 GTGCAAATGGCTTCTTTTCTGGG + Intronic
1128725680 15:69986910-69986932 GAGTAAAAGGCTTCCTTTCTTGG - Intergenic
1128919947 15:71601325-71601347 CTGCTAAAGGCTTCCATTCTAGG - Intronic
1131028104 15:89162404-89162426 CTGGAAGAGGCTTACTTGGTTGG - Intronic
1135915759 16:26604164-26604186 CTGCAAAAGGCCTCCCTGGAGGG + Intergenic
1135986897 16:27190455-27190477 CTGCAAGTGGCTTCCACTGTGGG - Intergenic
1138553964 16:57761625-57761647 CTGGAGAAGGCTTCCTGGGTTGG - Intronic
1138708783 16:58945308-58945330 CTGCAAACAGCTTTTTTTGTGGG + Intergenic
1138812383 16:60166228-60166250 GTGAAAAAGTCTTCCTTTCTTGG - Intergenic
1140038980 16:71392917-71392939 CTGCACAACTCTTCCTTTCTGGG - Intergenic
1140841457 16:78843293-78843315 CTGCAAAATTCTTACTTTTTGGG + Intronic
1140923544 16:79561628-79561650 GTGTAAAATGTTTCCTTTGTAGG - Intergenic
1141252308 16:82369746-82369768 CTTCGAAAGGCTGCCTGTGTTGG + Intergenic
1145393137 17:22471542-22471564 CTGCAAAAGTTGTCTTTTGTTGG - Intergenic
1146862327 17:36314001-36314023 TTGCAACAGGATTCCTTTGTGGG + Intronic
1146915303 17:36674475-36674497 CAGCAAAAGGCTTCATTTCCTGG - Intergenic
1147092655 17:38118104-38118126 TTGCAACAGGATTCCTTTGTGGG + Intergenic
1147104553 17:38202395-38202417 TTGCAACAGGATTCCTTTGTGGG - Intergenic
1147792130 17:43020534-43020556 CTGCAAGAGGCTGCATCTGTGGG + Intronic
1148424939 17:47586065-47586087 TTGCAACAGGATTCCTTTGTGGG + Intronic
1148466437 17:47867863-47867885 CTGCCAAAGGCTTCCAGTGGGGG - Intergenic
1150413703 17:64969534-64969556 CAGAAAAAGACTTCTTTTGTGGG - Intergenic
1150797927 17:68254104-68254126 CAGAAAAAGACTTCTTTTGTGGG + Intronic
1164072250 19:21779036-21779058 CAGCAAAAGGCTTACTTTTAAGG + Intergenic
1165130350 19:33628198-33628220 ATGCAAAGGGCTTCCTGTGGAGG + Intronic
1166587801 19:43966614-43966636 GTGGAAAAGGCTTCATTTGTAGG + Exonic
1166597901 19:44066790-44066812 ATGGAAAAGGCTTCATTCGTAGG + Exonic
1166602252 19:44107206-44107228 GTGGAAAAGGCTTTATTTGTAGG + Exonic
1202632767 1_KI270706v1_random:15618-15640 CTGCAAACAGCTTCCACTGTGGG + Intergenic
1202659045 1_KI270708v1_random:51314-51336 CTGCAAACAGCTTCCACTGTGGG + Intergenic
925697393 2:6595269-6595291 TTTCAAAAGGCTTCCTTTAAAGG - Intergenic
926471698 2:13268025-13268047 CTGCTAAAGACTTTCATTGTAGG + Intergenic
927370590 2:22350581-22350603 ATGCAAAAGCCTTCTTTTCTCGG - Intergenic
928210013 2:29316659-29316681 CTCAAAAAGCCTTCCTTTCTAGG + Intronic
929766694 2:44849598-44849620 CTGCAAATGGCTTGCTTTAACGG + Intergenic
933782747 2:85813401-85813423 CTGCAAAGGGTTTCCATTCTGGG + Intergenic
936607595 2:113973672-113973694 TTGGAAAAGGCCTCCTTTATAGG - Intergenic
940193660 2:151069264-151069286 CCTCAAATGGCTTCCTTTTTGGG - Intergenic
940534364 2:154920866-154920888 CTGAAAATGTCTTCATTTGTAGG - Intergenic
941084995 2:161107257-161107279 GTGAAAAAGTCTTCCTTTCTTGG - Intergenic
941925929 2:170894728-170894750 CTGCAAAAGGATTCTATTTTCGG + Intergenic
942315483 2:174693191-174693213 CAGCAAGTGGCTTCCATTGTGGG - Intergenic
943107499 2:183564419-183564441 ATGGATAAGGCTTCCTTTATGGG - Intergenic
946936876 2:224731222-224731244 CTGCAAAAGTCCTGCTTTCTGGG + Intergenic
947387514 2:229606368-229606390 CTCTAAGAGGCTTCATTTGTGGG - Intronic
1171070008 20:22059311-22059333 CAGAAAGGGGCTTCCTTTGTCGG - Intergenic
1174653299 20:52148053-52148075 CTCCAAAAGGTTTTCTTTTTTGG + Intronic
1174716140 20:52761037-52761059 CAGCAAAAGGCATCCTTGATGGG - Intergenic
1176629018 21:9119844-9119866 CTGCAAACAGCTTCCACTGTGGG - Intergenic
1176644981 21:9341498-9341520 CTGCAAACAGCTTCCACTGTGGG + Intergenic
1177037296 21:16060204-16060226 CTGCAAGAGGCTTCCACTGCAGG + Intergenic
1177758135 21:25372175-25372197 CTTCAAATGGCTTCATTTATAGG + Intergenic
1178216488 21:30605112-30605134 CTGCACCAGGCTGCCCTTGTTGG - Intergenic
1179818298 21:43922093-43922115 ATGGAAAAGGTTTCCTTTTTTGG + Intronic
1180326508 22:11434830-11434852 CTGCAAACAGCTTCCACTGTGGG + Intergenic
1180367971 22:11957736-11957758 CTGCAAACAGCTTCCACTGTGGG - Intergenic
1180378119 22:12113600-12113622 CTGCAAACAGCTTCCACTGTGGG + Intergenic
1185097824 22:48821324-48821346 CTCCAAAAGGCTGGCTTTGATGG + Intronic
950782006 3:15400151-15400173 CTGCATAAGGCAACCTTTGTGGG + Intronic
953272291 3:41457533-41457555 TTGCACAGAGCTTCCTTTGTGGG - Intronic
954500114 3:51005560-51005582 CAGCAAAATGATTCCTTTCTTGG + Intronic
956776849 3:72572297-72572319 AAGTAAAAGGCTTCCTTTCTGGG - Intergenic
958256032 3:91325807-91325829 CTGAATAAAGCTTCCTTTATTGG + Intergenic
959296784 3:104545511-104545533 CTGTCAAAGCCATCCTTTGTGGG + Intergenic
965229086 3:166028395-166028417 CTGCAAGTGGCTTCCACTGTGGG + Intergenic
965629439 3:170716586-170716608 TTGCCTCAGGCTTCCTTTGTGGG + Intronic
965783541 3:172313174-172313196 ATGTAAAAGGATTCCTGTGTTGG - Intronic
966377899 3:179315670-179315692 TAGCAAAAGGCTTACTTAGTAGG - Intergenic
967728204 3:192881696-192881718 CTCCAGAAGCCTTCCTTTCTTGG - Intronic
1202741910 3_GL000221v1_random:63570-63592 CTGCAAACAGCTTCCACTGTGGG - Intergenic
969012136 4:4074766-4074788 CTGCAAGAGGCTTTCTTCTTTGG - Intergenic
971504877 4:27355674-27355696 CTGCAAAATGCTTCCTTTGTGGG + Intergenic
974589584 4:63926830-63926852 ATGCAAATGTCTTCCTTTTTTGG - Intergenic
977410387 4:96654158-96654180 CTGCACATGGCTTCCACTGTGGG - Intergenic
982802497 4:159722360-159722382 CTGCAAGTGGCTTCCACTGTGGG + Intergenic
982959784 4:161822518-161822540 CTGCAAACAGCTTCCACTGTGGG + Intronic
983323879 4:166228170-166228192 CTGCAAGCGGCTTCCACTGTGGG - Intergenic
983793846 4:171834503-171834525 CTTCAAATGCCTTTCTTTGTAGG + Intronic
1202759736 4_GL000008v2_random:99065-99087 CTGCAAACAGCTTCCACTGTGGG + Intergenic
989218762 5:38931680-38931702 TGGCAAATGGCTTCCTGTGTTGG + Intronic
989704509 5:44312474-44312496 TTGCAACAGGGTTCCCTTGTAGG - Intronic
992352043 5:75939870-75939892 CTTCACCTGGCTTCCTTTGTTGG + Intergenic
993637294 5:90360100-90360122 ATGCAAAATGCATCGTTTGTTGG + Intergenic
994550834 5:101232732-101232754 CTGCAAAAATTTTCTTTTGTAGG + Intergenic
995313468 5:110739345-110739367 CTGGAAAAGGGTTCCTCCGTGGG - Exonic
997675162 5:135707280-135707302 GTGCACAAGGCCTCCTTTTTGGG - Intergenic
999330218 5:150668708-150668730 CTGCAAAAGGCTTCCTTTGTTGG + Intronic
1000248976 5:159475463-159475485 CTGAAAAATTGTTCCTTTGTTGG + Intergenic
1003391204 6:5714606-5714628 TCACAAAAGTCTTCCTTTGTTGG - Intronic
1003759604 6:9161921-9161943 CTCAACAAGGCCTCCTTTGTTGG + Intergenic
1005144658 6:22675027-22675049 TTGCATAAGGGTTCCCTTGTCGG - Intergenic
1007740752 6:44008203-44008225 CTTTAAAAGGCTTCCTGTGGGGG + Intergenic
1008999306 6:57695365-57695387 CTGAATAAAGCTTCCTTTATTGG - Intergenic
1009187797 6:60594770-60594792 CTGAATAAAGCTTCCTTTATTGG - Intergenic
1010280357 6:74016053-74016075 ATGCTAGAGGCTTCCTTTTTGGG + Intergenic
1011657165 6:89562370-89562392 CAGGAAAATGCTTGCTTTGTGGG - Intronic
1012442649 6:99275883-99275905 GTTCAAAAGGATTCCCTTGTTGG - Exonic
1015798435 6:137036165-137036187 CTGCAAAAGTTTTCCTTCATTGG + Intronic
1015926956 6:138320299-138320321 TTAGAAAAGGCTTCCATTGTGGG + Intronic
1016980018 6:149845428-149845450 CTGCAAAAGCCTTACTTTGGAGG + Intronic
1017865355 6:158438462-158438484 CTGCTGAGGGCTTCCTTTGTCGG + Intronic
1019502287 7:1370243-1370265 CTGCAAACTGCTCCCTGTGTGGG + Intergenic
1019754014 7:2754745-2754767 CTGCAAAAGTCCTCCTTTTGAGG - Intronic
1021818655 7:24475280-24475302 CAACAAAATGCTTCCTTTGTGGG - Intergenic
1027239590 7:76318408-76318430 CAGCAAAAGGCTTCCTTGGCCGG + Intergenic
1029155640 7:98515699-98515721 CTGCAGATGGCTCCCTGTGTAGG - Intergenic
1031121026 7:117722235-117722257 ATGCAAAAGGATTCCTGTGTTGG + Intronic
1035271250 7:157721298-157721320 CTGCAAGGGGCTTCCCTCGTCGG + Intronic
1036002179 8:4618580-4618602 CATCAAAAGCCTTCATTTGTTGG - Intronic
1036444824 8:8812209-8812231 TTGCAAATGGCTTCCTTTGAGGG + Intronic
1037249683 8:16877698-16877720 CTGTAAAATGCTTCCTATGTTGG - Intergenic
1039823929 8:41157173-41157195 CTGCATAAAGATTCCTTGGTGGG + Intergenic
1041274508 8:56143148-56143170 CTGCAAGTGGCTTCCACTGTGGG - Intergenic
1043016959 8:74950976-74950998 CTGCTAAAGACTTCCTTTTTGGG + Intergenic
1045989685 8:108291289-108291311 CTGCATAAGGATTCTTGTGTGGG + Intronic
1047568165 8:126069068-126069090 CTGCCAAGGGCTGACTTTGTGGG - Intergenic
1048003854 8:130402367-130402389 CTGCAACTGGTTTCCTTTGCCGG - Intronic
1048804737 8:138229551-138229573 GTGGAAAAGGCAGCCTTTGTGGG + Intronic
1050809027 9:9719829-9719851 CTGCAAGAGGCTTCTACTGTAGG - Intronic
1051188041 9:14481332-14481354 TTTAATAAGGCTTCCTTTGTTGG + Intergenic
1051742958 9:20268963-20268985 CTGCAAAAGGGGTCCATAGTGGG - Intergenic
1053306495 9:36987741-36987763 CAGCAAATGCCTTCCTTCGTGGG - Intronic
1058487581 9:105457904-105457926 CTGCAAGTGGCTTCCTCTGTGGG + Intronic
1061973856 9:134058610-134058632 CGGGAAAAGGCTTCCCTTGCTGG - Intronic
1203691526 Un_GL000214v1:47280-47302 CTGCAAACAGCTTCCACTGTGGG + Intergenic
1203710540 Un_KI270742v1:93494-93516 CTGCAAACAGCTTCCACTGTGGG - Intergenic
1203540512 Un_KI270743v1:83960-83982 CTGCAAACAGCTTCCACTGTGGG + Intergenic
1203644769 Un_KI270751v1:56911-56933 CTGCAAACAGCTTCCACTGTGGG - Intergenic
1185513999 X:684943-684965 GTGCAAATGACTTCCTTTGATGG - Intergenic
1186746889 X:12578633-12578655 CTTAAAAAGGCTTCTTTTGCTGG - Intronic
1188761123 X:34031264-34031286 ATGCAAAAGATTTCCTTTATAGG + Intergenic
1189167696 X:38877578-38877600 CAGGCAAAGGCTTCCTTTGGAGG - Intergenic
1190502815 X:51096415-51096437 TTGGAAAATGCTTCCTTTATGGG + Intergenic
1195950207 X:110263145-110263167 CTGCCAATGGCTACCTTTTTGGG - Intronic
1197890776 X:131268348-131268370 CCACAAAAGCCATCCTTTGTAGG + Intergenic
1198975467 X:142331066-142331088 CTGGAAAAGTCTTATTTTGTAGG + Intergenic
1199323759 X:146472422-146472444 CTACAAAAGGCTATCTTAGTAGG - Intergenic
1199888029 X:152042616-152042638 TGGCATAAGTCTTCCTTTGTGGG - Intergenic
1201165518 Y:11205145-11205167 CTGCAAACAGCTTCCACTGTGGG - Intergenic
1201599095 Y:15708360-15708382 CTGTTCAAGGCTACCTTTGTAGG + Intergenic