ID: 999333706

View in Genome Browser
Species Human (GRCh38)
Location 5:150696682-150696704
Sequence TTTCTAACTCTGATGGAACA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 193}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999333706 Original CRISPR TTTCTAACTCTGATGGAACA CGG (reversed) Exonic
902201640 1:14837894-14837916 ATTCTACCTCTGATGGACCATGG + Intronic
903533009 1:24046490-24046512 TTTCTGACTCAGAATGAACAGGG + Intergenic
910488792 1:87745653-87745675 TTTTCAAATATGATGGAACAAGG + Intergenic
911895354 1:103426630-103426652 TTTCTGACTTTTAGGGAACAGGG + Intergenic
913347301 1:117821143-117821165 GTTCTACTTCTGATGGATCATGG + Intergenic
913565328 1:120068423-120068445 TTTCTAACACGGTTGGACCAAGG - Intronic
913632803 1:120725139-120725161 TTTCTAACACGGTTGGACCAAGG + Intergenic
914285917 1:146227778-146227800 TTTCTAACACGGTTGGACCAAGG - Intronic
914546949 1:148678531-148678553 TTTCTAACACGGTTGGACCAAGG - Intronic
914619559 1:149391831-149391853 TTTCTAACACGGTTGGACCAAGG + Intergenic
915759094 1:158292749-158292771 TTCCTAATGCTGATGGGACATGG + Exonic
915784037 1:158587678-158587700 CTTCTAACACTGCTGCAACAGGG - Intergenic
915850182 1:159313534-159313556 TTTCTAACTGTTCTGGAGCAGGG + Intergenic
916451990 1:164929574-164929596 TTTGTCACTCTGATGAAGCATGG + Intergenic
917344676 1:174016987-174017009 TTTCTAACACTTATTCAACAAGG + Intronic
918028400 1:180777788-180777810 TTTCTATATTTGATGGAGCATGG + Intronic
918526906 1:185474530-185474552 TTTCTATCTCTGACGGAATAGGG + Intergenic
918835474 1:189459005-189459027 TTTTTGACATTGATGGAACAGGG - Intergenic
918849564 1:189668844-189668866 TTACTGAGTCTAATGGAACAGGG - Intergenic
920186039 1:204160059-204160081 CCCCTAACTCTGATGGAGCAGGG + Intronic
921718282 1:218441460-218441482 TTTTTAACACTGATGAACCAAGG - Exonic
921982638 1:221274875-221274897 TTTCTAACTCTCCTGAAGCATGG - Intergenic
1066660290 10:37732175-37732197 TTTCTAAATCAGATGAAACTTGG - Intergenic
1068885170 10:62090858-62090880 TTTCTTGCTCTGATGAAACCTGG - Exonic
1070620426 10:78005465-78005487 TCTCCAACTTTGATGGAACTAGG + Intronic
1074549829 10:114432351-114432373 TTCCTGACTCTCATGGAAGATGG - Intronic
1075154638 10:119964419-119964441 TTAATCACTCTGATGGAGCAAGG - Intergenic
1077830123 11:5858623-5858645 TTTGCAGCTATGATGGAACATGG + Intronic
1080087686 11:28304923-28304945 GTTTTCACTCTGATGGAAAATGG + Intronic
1080099508 11:28443353-28443375 TTTCCACCTCTAATTGAACAGGG + Intergenic
1080354355 11:31424416-31424438 TTTCTTACTCAGAAGGACCAGGG - Intronic
1081093843 11:38907186-38907208 TTTATAACTCTGGTGGAATTCGG - Intergenic
1081350124 11:42041866-42041888 TTTCTCACAGTGATGGTACATGG + Intergenic
1084840845 11:71845947-71845969 TTTCTAACTCTGAAGAATGATGG + Intergenic
1086532661 11:87804022-87804044 TTTTTCACTCTGATGCAACTTGG + Intergenic
1086662376 11:89435831-89435853 TTTATAAATCTGAAGGAACATGG - Intronic
1087798165 11:102476193-102476215 ATTCTTATTCTGATGCAACACGG - Intronic
1087896593 11:103593228-103593250 TTTCTCACTCTGATTGGAAACGG + Intergenic
1088633435 11:111796298-111796320 GTTCTAACTCTCAAGGAACTTGG + Intronic
1089256873 11:117198895-117198917 CTTTTAGCTCTGATGGGACATGG - Intergenic
1090775902 11:129965583-129965605 TCTCTAACTCTTTTGGGACAGGG - Intronic
1091138058 11:133210611-133210633 ATTTCAACTTTGATGGAACAGGG - Intronic
1093625506 12:21342092-21342114 TTTCTACCTCTAATGGACCATGG + Intronic
1098321693 12:69251023-69251045 TTTAAAAATCTGATGGAAAAAGG - Intronic
1099428801 12:82555808-82555830 TTTCTAAGTCAAAGGGAACATGG - Intergenic
1099604174 12:84780730-84780752 TTGCTGTCTCAGATGGAACATGG + Intergenic
1100389398 12:94134883-94134905 TTTCAAACTTTGTTTGAACATGG - Intergenic
1100944599 12:99766829-99766851 TCTCTAAATCTGATGGAAATTGG + Intronic
1109061255 13:57623014-57623036 TTTCTCACTCTGGTGAAAGATGG - Intergenic
1109866803 13:68274950-68274972 TATCTTACCCTGGTGGAACAGGG + Intergenic
1112130645 13:96520040-96520062 TGTCTAAACTTGATGGAACAAGG - Intronic
1112739581 13:102457804-102457826 TTTGTACCCCTGGTGGAACAGGG + Intergenic
1115341858 14:32301001-32301023 TTTCCAATTGTGATGTAACATGG - Intergenic
1115400634 14:32955684-32955706 TTTCTAACTCTGTTCCAAGAAGG - Intronic
1116662667 14:47731386-47731408 TTACTTACTTGGATGGAACATGG + Intergenic
1116776938 14:49192179-49192201 TTTCTAACATTAATGGAAAAGGG + Intergenic
1122311322 14:100797012-100797034 TTTCAAAACTTGATGGAACAAGG + Intergenic
1126615133 15:50570482-50570504 TTGCTAACTAAGATGAAACAAGG - Intronic
1127536620 15:59895766-59895788 ATTTTAACTCTTCTGGAACAGGG - Intergenic
1128259121 15:66220080-66220102 TCTCTACCTCTGTTGGCACATGG - Intronic
1133198445 16:4187315-4187337 TTATTCACTCTGATGGCACACGG + Intergenic
1133552074 16:6866305-6866327 TTTCAAGCTATGATGAAACAAGG + Intronic
1136671648 16:31863963-31863985 TTGTGGACTCTGATGGAACATGG + Intergenic
1139248173 16:65468849-65468871 TATCTAACTCTTAAGGAGCAGGG + Intergenic
1142786074 17:2223953-2223975 TGAGTAAGTCTGATGGAACAAGG + Intronic
1144305166 17:13963270-13963292 TGCCTAACTCTGTTGGAGCAGGG - Intergenic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1146970934 17:37071833-37071855 TTTCTCTCTAAGATGGAACAAGG - Intergenic
1149006891 17:51815401-51815423 TTTCTCACTCTGGTGAAGCAGGG - Intronic
1149856820 17:60089662-60089684 TTCCTAACTCTGAGGTTACAGGG + Intergenic
1151178495 17:72308804-72308826 TTACTGAATCTGGTGGAACAGGG + Intergenic
1157735519 18:50045248-50045270 TTTCTATCACTGTGGGAACATGG + Intronic
1161329422 19:3679172-3679194 TTTCAAGCTCTGAAGAAACACGG + Intronic
926407049 2:12565216-12565238 TATATAACTCTGATGGACCCTGG + Intergenic
927041471 2:19234811-19234833 TTTCTAACACAGATTGAAAATGG + Intergenic
927070673 2:19525536-19525558 TGTCTAGCTCTGATTGAACCAGG + Intergenic
928791348 2:34958838-34958860 TTTCTAGCTCTAATGAAAAATGG + Intergenic
928799590 2:35071084-35071106 TTTGTACCTCTGATAGAACTCGG - Intergenic
930264405 2:49183096-49183118 TTTCTACCTCTGGTAGAACTTGG + Intergenic
932117936 2:69070082-69070104 TTTCTTACTCTGATTGTTCAAGG - Intronic
933908800 2:86919948-86919970 TATCTCACTCAGATGGAAAATGG - Intronic
934023926 2:87983437-87983459 TATCTCACTCAGATGGAAAATGG + Intergenic
936364579 2:111841155-111841177 TATCTCACTCAGATGGAAAATGG + Intronic
936671931 2:114666341-114666363 TTTCTAACACTGATATAATATGG + Intronic
938634943 2:133213532-133213554 TCTCTCACTCTGATGGCAAATGG + Intronic
939120770 2:138113818-138113840 TTTCAGACTCAGATGGAACATGG + Intergenic
939258009 2:139769930-139769952 TTTCTAACTGTGATGTATCCAGG - Intergenic
940075337 2:149735265-149735287 TTTCAAACTCTGTGGGAATATGG - Intergenic
941548753 2:166888397-166888419 AATCTGATTCTGATGGAACATGG + Intergenic
941657675 2:168161331-168161353 TTTTTAACTCTGACCCAACATGG - Intronic
943414240 2:187579222-187579244 TTTGGAACTCTGAGGAAACATGG + Intergenic
945405395 2:209441618-209441640 TTTCTTACTCTGATTGCACTGGG - Intronic
945861281 2:215125320-215125342 TTTCTAACTCTGAAGAATGATGG + Intronic
946812567 2:223541537-223541559 TTTCCAAATTTGATGGAGCATGG + Intergenic
947363984 2:229375153-229375175 TTCCCATCTCTGATGGAACCTGG - Intronic
948329218 2:237151737-237151759 TTTCTCAGTCAGATGCAACATGG + Intergenic
1170053552 20:12173807-12173829 TTTCTAATTCAGCTGGAAGAAGG - Intergenic
1170443108 20:16398498-16398520 TTTCTCTATCTGATGGCACAGGG - Intronic
1170822986 20:19770063-19770085 TTTCTATTTCTCATGGAAGATGG + Intergenic
1172844203 20:37920044-37920066 TTTCTCACGCTGCTGGAAAAGGG + Intronic
1174346982 20:49937282-49937304 TTTGTGCGTCTGATGGAACAAGG - Intronic
1175390721 20:58625693-58625715 TTTCTATCACTGCTGGGACACGG + Intergenic
1177451643 21:21275616-21275638 TTTCTACCTCTGTTGACACAAGG - Intronic
1179955762 21:44737298-44737320 TGTCTTACTCTGGTGTAACAAGG + Intergenic
950889490 3:16390647-16390669 TTTCTGACTCTGATGGTGCCTGG - Intronic
953335817 3:42093129-42093151 TTTCTCACTCTGTTGTAAAAGGG - Intronic
953363337 3:42320426-42320448 TTTCTAAGACTGTTGTAACAAGG - Intergenic
953662266 3:44899866-44899888 TTGCTCACTCTGATGGAAGCTGG - Intronic
953665246 3:44921297-44921319 TTTCTACATCTGATGATACAGGG - Intronic
955492689 3:59499035-59499057 TTTTGAATTCTGATGGAACGTGG + Intergenic
956348283 3:68305190-68305212 TTTCTCACTCTGTTGTCACATGG + Intronic
960276438 3:115734732-115734754 TTTGTAACTCTGATAGAATTCGG + Intergenic
962065163 3:131971893-131971915 TATGTAAGTCTGAAGGAACAAGG - Intronic
962961588 3:140316012-140316034 GTTCTAATTCTGAGGGAACTGGG + Intronic
963520051 3:146352833-146352855 TTTGGAACTCTAATGGAACAAGG + Intergenic
965136200 3:164772523-164772545 TTTCTTACTGTGATATAACATGG - Intergenic
965801089 3:172495057-172495079 TTTCTACCTCTGGTAGAATAAGG + Intergenic
967688580 3:192446406-192446428 TTTCTAACAGTGATGTATCACGG + Intronic
969177417 4:5409200-5409222 TTTCTAACTCTCTTGCAGCAAGG - Intronic
969781943 4:9411941-9411963 TTTCTAACTCTGAAGAATGATGG + Intergenic
970385170 4:15548788-15548810 TTCACAACTCTGATGGGACAAGG - Intronic
971539351 4:27796260-27796282 TTTCTGACTCTACTGGAACTAGG + Intergenic
974454270 4:62105919-62105941 TTTCTCACTGTGATGAAGCATGG - Intergenic
974552830 4:63401822-63401844 CTTCTAACTGTGATGCAAGATGG - Intergenic
974768251 4:66377074-66377096 TTTCTAAATGTGATGGAAGCTGG + Intergenic
974809951 4:66933462-66933484 TTTCTAGTTTTGATGGAACTGGG + Intergenic
975734445 4:77367524-77367546 TGTCTAACTGTGATTGGACAAGG - Intronic
976763514 4:88575320-88575342 TTTTAAACTCTTAGGGAACACGG - Intronic
978370116 4:108021545-108021567 TTTCAGACTCTGTTGGAACTAGG + Intronic
978392801 4:108245003-108245025 GCTCTCACTCTGTTGGAACATGG + Intergenic
980469460 4:133233154-133233176 TGTCTAACCTTGGTGGAACATGG + Intergenic
980589491 4:134866602-134866624 TTTCTATCTCTGAAGCAATAGGG + Intergenic
981047364 4:140277551-140277573 TTTCTACTTCTGGTGGAAAAGGG + Intronic
983165255 4:164468504-164468526 TTTCTAGAACTGATGTAACAAGG + Intergenic
984396246 4:179203732-179203754 ATTCTAAATCTGATGGAGTAGGG + Intergenic
985806639 5:2049215-2049237 CTTCCAGCTCTGAAGGAACACGG - Intergenic
986100296 5:4602240-4602262 TTTCTAAAGCAGATGGAAGAAGG - Intergenic
986567857 5:9133148-9133170 TTTTTAACTGAAATGGAACAAGG - Intronic
987606074 5:20137867-20137889 TTTGTACCTCTGATGGAATTCGG - Intronic
987844589 5:23266075-23266097 TTTTTATCTCACATGGAACATGG + Intergenic
988586020 5:32508207-32508229 CTTCCAGCTCTGATGGAAAACGG - Intergenic
990569129 5:57060257-57060279 TTGCAAACTCTGGTGAAACATGG - Intergenic
991615715 5:68495254-68495276 TTTCTAACTATGCTGAAAGAGGG - Intergenic
992587810 5:78259532-78259554 TTTGTAACTCAGAAGGAAAAAGG + Intronic
993505880 5:88708079-88708101 TGTCTATCACTGATGGAACAGGG + Intergenic
994251093 5:97538143-97538165 TTTCTAACTCTCATTGTCCAAGG + Intergenic
997440402 5:133905171-133905193 TTTTTAACTGGAATGGAACAGGG + Intergenic
998945287 5:147332683-147332705 TTTCTAACTCTGGTAGCAGAAGG + Intronic
999333706 5:150696682-150696704 TTTCTAACTCTGATGGAACACGG - Exonic
1001320643 5:170678134-170678156 CTTGTAGCTCTGATGGAACTGGG + Intronic
1002335416 5:178474583-178474605 TTTCTAACTGTAGAGGAACATGG + Intronic
1003738427 6:8905619-8905641 TTTCTAAATCTCAATGAACAAGG - Intergenic
1003837331 6:10085849-10085871 TTTCTATCTCAGATGTAAAAAGG + Intronic
1005001100 6:21242725-21242747 TTTATAATTCTGATGGCACAAGG - Intergenic
1005219110 6:23565758-23565780 TTTCTAACTCTGGTGGCAAAGGG + Intergenic
1005493627 6:26369742-26369764 TTTGTGACTATGATGGATCATGG - Intronic
1005498186 6:26407087-26407109 TTTGTGACTATGATGGATCATGG - Intronic
1006245145 6:32727100-32727122 TTTCTAATTCTGATTGAGTAGGG - Intergenic
1006970298 6:38037031-38037053 TTTCAAACTCTGAAGCAACTTGG - Intronic
1007435136 6:41805244-41805266 TTTCAAACTATTATGGAACCAGG + Intronic
1007875687 6:45098393-45098415 TTTCTAGCTCTGATGGAACGTGG + Intronic
1008344268 6:50407137-50407159 TCTTTAACTGTGAGGGAACAAGG - Intergenic
1008487033 6:52047645-52047667 AGTCTAACTCTGACGGACCATGG + Intronic
1009882895 6:69591426-69591448 TTTCTTTCTCTGAGGGAAAAGGG - Intergenic
1010364142 6:75030384-75030406 TTTTTAACACTAATGTAACAGGG + Intergenic
1012355987 6:98315216-98315238 TTTCTGTCTTAGATGGAACAAGG + Intergenic
1012384997 6:98670336-98670358 TTTTTAACTTTGATGCACCAAGG + Intergenic
1015188313 6:130444440-130444462 TTTCTAACTCTAAAGGTCCAGGG + Intergenic
1017096062 6:150806367-150806389 TTTCTAACCTTGATTGACCATGG - Intronic
1019727032 7:2608457-2608479 TTTCTAGCTCTGACGAAACTAGG - Intronic
1021946125 7:25729305-25729327 TTTCTAACTCTAATAGATCCTGG + Intergenic
1022033390 7:26512732-26512754 TATTTCTCTCTGATGGAACAAGG + Intergenic
1022199806 7:28105238-28105260 TTTCTAACCAAGATGGAATATGG - Intronic
1022587499 7:31628370-31628392 CTTCTGACTCTGATGGAGCCAGG + Intronic
1022649820 7:32264459-32264481 TTTTTAAGTCAGATGGAACTAGG - Intronic
1030258612 7:107539756-107539778 CTTCTAACAATGATGGAATAGGG + Intronic
1033861108 7:145629265-145629287 CTTCTTTGTCTGATGGAACATGG - Intergenic
1040585564 8:48737256-48737278 TTTTTAACTTTAAGGGAACATGG - Intergenic
1041041100 8:53846633-53846655 TTGCTCACTCTGATGAAGCAAGG + Intergenic
1041483247 8:58346015-58346037 TTTCTTACTCTCATGCTACAAGG + Intergenic
1041652540 8:60315059-60315081 TTTACAACTCTGTTGGAATAGGG + Intergenic
1041920448 8:63177131-63177153 TTTGAAACTCTGAAAGAACAAGG + Intronic
1042416419 8:68525776-68525798 TTTCTCACTGTGATGAAGCATGG - Intronic
1043655086 8:82653945-82653967 TTCCTAACTCCTATGCAACAGGG - Intergenic
1044448009 8:92300917-92300939 TTTCTGACTCTGAAGGAACTAGG - Intergenic
1045164668 8:99589925-99589947 TTTCTACCTCTGATAGAATTCGG + Intronic
1047018834 8:120753067-120753089 TTGCTAAGCCTGATGGCACAGGG + Intronic
1050745699 9:8873528-8873550 TTTCTAGCTCTTAGGGAACTTGG - Intronic
1051129742 9:13846901-13846923 TTACTTACCCTGAAGGAACAGGG - Intergenic
1056202735 9:84291979-84292001 TTTCTCCATGTGATGGAACAGGG + Intronic
1056514371 9:87336124-87336146 CTTCTAGCCCAGATGGAACATGG + Intergenic
1186877320 X:13829166-13829188 CTTCAAACTCTGATAAAACATGG + Intronic
1187786551 X:22894457-22894479 TCTCTAATTCTGATGAAAGATGG + Intergenic
1188310780 X:28613859-28613881 ATTTTAACTCTGAGAGAACATGG + Intronic
1188622046 X:32237604-32237626 TGCCTAACTCTGAGGGGACAGGG - Intronic
1189093537 X:38113485-38113507 TTTCTCACTCCGATGGAAAGTGG + Intronic
1190641586 X:52485581-52485603 TTTCTAACCCTGATAGAACATGG - Intergenic
1190646086 X:52527284-52527306 TTTCTAACCCTGATAGAACATGG + Intergenic
1192228740 X:69248606-69248628 TTTCTACCTCTGGTGGAATTCGG - Intergenic
1192322802 X:70105582-70105604 TTTCTATCTCTGATGCTAGAGGG + Intergenic
1193102022 X:77624863-77624885 TTTCTAACTCTGAAGAATGATGG - Intronic
1193103352 X:77640635-77640657 TTTCCTACTCTGAGGGATCAGGG - Intronic
1194958737 X:100211387-100211409 TTTTTAGCTCTGGTAGAACATGG + Intergenic
1197629355 X:128840638-128840660 GTTCTAGCACTGTTGGAACAGGG - Intergenic
1198663804 X:138999739-138999761 TTTCTACCTCTGGTGGAATTCGG - Intronic
1199663076 X:150072065-150072087 TTTCTCACTCTGTTGTATCAGGG + Intergenic
1200771280 Y:7127595-7127617 TTTCTAACTATGAGGGACAAGGG + Intergenic