ID: 999335287

View in Genome Browser
Species Human (GRCh38)
Location 5:150710894-150710916
Sequence GCTGCTGTTACTCAACGTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 73}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999335278_999335287 15 Left 999335278 5:150710856-150710878 CCAAGGAACACCCATCCCCTTTC 0: 1
1: 0
2: 2
3: 16
4: 221
Right 999335287 5:150710894-150710916 GCTGCTGTTACTCAACGTGCAGG 0: 1
1: 0
2: 1
3: 5
4: 73
999335284_999335287 -1 Left 999335284 5:150710872-150710894 CCCTTTCCTAGGATGGAATTATG 0: 1
1: 1
2: 1
3: 12
4: 141
Right 999335287 5:150710894-150710916 GCTGCTGTTACTCAACGTGCAGG 0: 1
1: 0
2: 1
3: 5
4: 73
999335277_999335287 20 Left 999335277 5:150710851-150710873 CCATTCCAAGGAACACCCATCCC 0: 1
1: 0
2: 1
3: 10
4: 188
Right 999335287 5:150710894-150710916 GCTGCTGTTACTCAACGTGCAGG 0: 1
1: 0
2: 1
3: 5
4: 73
999335282_999335287 4 Left 999335282 5:150710867-150710889 CCATCCCCTTTCCTAGGATGGAA 0: 1
1: 0
2: 1
3: 20
4: 242
Right 999335287 5:150710894-150710916 GCTGCTGTTACTCAACGTGCAGG 0: 1
1: 0
2: 1
3: 5
4: 73
999335285_999335287 -2 Left 999335285 5:150710873-150710895 CCTTTCCTAGGATGGAATTATGC 0: 1
1: 0
2: 1
3: 4
4: 87
Right 999335287 5:150710894-150710916 GCTGCTGTTACTCAACGTGCAGG 0: 1
1: 0
2: 1
3: 5
4: 73
999335283_999335287 0 Left 999335283 5:150710871-150710893 CCCCTTTCCTAGGATGGAATTAT 0: 1
1: 0
2: 1
3: 17
4: 176
Right 999335287 5:150710894-150710916 GCTGCTGTTACTCAACGTGCAGG 0: 1
1: 0
2: 1
3: 5
4: 73
999335281_999335287 5 Left 999335281 5:150710866-150710888 CCCATCCCCTTTCCTAGGATGGA 0: 1
1: 0
2: 0
3: 17
4: 187
Right 999335287 5:150710894-150710916 GCTGCTGTTACTCAACGTGCAGG 0: 1
1: 0
2: 1
3: 5
4: 73
999335286_999335287 -7 Left 999335286 5:150710878-150710900 CCTAGGATGGAATTATGCTGCTG 0: 1
1: 1
2: 1
3: 21
4: 171
Right 999335287 5:150710894-150710916 GCTGCTGTTACTCAACGTGCAGG 0: 1
1: 0
2: 1
3: 5
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999335287 Original CRISPR GCTGCTGTTACTCAACGTGC AGG Exonic
901759991 1:11464520-11464542 GCTGCTGTACATCAACCTGCTGG + Intergenic
913279461 1:117172116-117172138 GCTGATGTTACTCAATAGGCAGG + Intronic
913327739 1:117641720-117641742 GCTGCTGTTGCTCCACTTGCAGG + Intergenic
924436139 1:244044941-244044963 GGGGCTGTTACTCTACTTGCAGG + Intergenic
924436251 1:244046547-244046569 GGGGCTGTTACTCTACTTGCAGG + Intergenic
1065918551 10:30371676-30371698 GGTGCTGTGACTCACCTTGCCGG - Intronic
1069287642 10:66736095-66736117 GCCTCTCTTATTCAACGTGCTGG + Intronic
1069779451 10:70945648-70945670 GCTGCTGGAACTCATGGTGCAGG - Intergenic
1073522716 10:104149293-104149315 GCTGCAGATACTCAACGCCCGGG + Intronic
1082790036 11:57340814-57340836 GCTGCTCTTACTCATCCTTCGGG - Intronic
1092632498 12:10397432-10397454 GCAACTGTTACTCACTGTGCTGG - Intronic
1101921519 12:108937034-108937056 ACTGCTTTTAATCACCGTGCAGG - Intronic
1106544585 13:30718919-30718941 GCTGCTGTCACTCAAGATGAAGG - Intronic
1112988613 13:105482753-105482775 GCTTCTGCTCCTCAAAGTGCTGG + Intronic
1114368558 14:22058284-22058306 GATGCTGTTACCCCATGTGCAGG - Intergenic
1127535235 15:59883845-59883867 GCTACTGTTACTCACTTTGCTGG + Intergenic
1137726282 16:50658892-50658914 GCTCCTGTTGCTCCACATGCTGG - Intergenic
1142703699 17:1680646-1680668 GCTGATGTTACTAAACGCTCAGG - Intronic
1148661770 17:49339979-49340001 GCCTCTGTTTCTCAAAGTGCCGG + Intronic
1156980283 18:43278577-43278599 GCTGCTGCTAGCCAATGTGCAGG - Intergenic
1158348865 18:56543934-56543956 GCTGCTGTCACCCTAAGTGCTGG - Intergenic
1160494273 18:79361985-79362007 GCTGTTGTTACTCACACTGCAGG - Intronic
1160779710 19:872397-872419 GCGGCTGCTCCTCCACGTGCAGG - Intronic
1161285781 19:3467571-3467593 GCTGCTGTCTCTCAAGGTCCTGG - Intronic
1165153552 19:33774434-33774456 GCTGCTGATTCTCCACGTGGAGG + Intergenic
1167862910 19:52299427-52299449 GCTGCCGCTACTTCACGTGCTGG + Intronic
925396230 2:3535574-3535596 ACTGCCGTTCCTCAATGTGCTGG - Intronic
929327857 2:40639442-40639464 GCTGCTGATACTCAAGGGTCTGG - Intergenic
930720878 2:54636605-54636627 GCTGCTCTTACTCAGCGTGTTGG + Intronic
932085639 2:68756237-68756259 GCAGCTTGTGCTCAACGTGCAGG + Intronic
935181016 2:100691346-100691368 GCTGCTGCTACTCAAGGGCCAGG + Intergenic
945464972 2:210158424-210158446 GCTGTTGTTAATCAAGGTGTTGG - Intronic
946920810 2:224580432-224580454 ACCGCTGTTACGCAAAGTGCTGG - Intronic
948412494 2:237774909-237774931 GCTGCTGTTACTCCACCTGCTGG + Intronic
948779034 2:240305762-240305784 GCAGCTGTCACTCAAACTGCTGG + Intergenic
1176002926 20:62841458-62841480 GCTGCTGTATTGCAACGTGCAGG - Exonic
1178434189 21:32543093-32543115 GCTGCTGTCACATAATGTGCAGG + Intergenic
1179255034 21:39708426-39708448 GTTGATGTTACTCAACTAGCTGG - Intergenic
1179718353 21:43301632-43301654 GCAGCTGTCACTCACTGTGCAGG - Intergenic
1182846583 22:33436211-33436233 GCTGCTGTGACTTCACATGCTGG + Intronic
1184937958 22:47738910-47738932 TCTGCTGTTTCCCAAAGTGCCGG - Intergenic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
958564033 3:95783614-95783636 GCTGATGTTACTCAATGGGAAGG - Intergenic
965703117 3:171478782-171478804 GCTGCTGTTACTAAACAAGAAGG - Intergenic
967754366 3:193152089-193152111 GCTGCTGTTACTCACAGTTCTGG - Intergenic
976213284 4:82692792-82692814 GCTGCTGTTCCTCAGCGGACTGG - Intronic
976988333 4:91330127-91330149 ACTGCTTTTACTCCACGTACAGG + Intronic
980771466 4:137378865-137378887 GCTGCTGTGACTCATAGTGGAGG + Intergenic
984476097 4:180237052-180237074 TCTGCTGTTTCTCAAGGTACAGG - Intergenic
998920711 5:147064777-147064799 GCTGCTATTTTTCAATGTGCTGG - Intronic
999335287 5:150710894-150710916 GCTGCTGTTACTCAACGTGCAGG + Exonic
1001007080 5:168062063-168062085 GCTGCTGTTTTTCAACGACCAGG - Exonic
1002593284 5:180305710-180305732 GCTGCGGTGGCTGAACGTGCTGG - Intronic
1007373811 6:41443216-41443238 GCTCCTGTTTCTCCAGGTGCTGG - Intergenic
1008265279 6:49417629-49417651 GCTGCTCTTATTCAGCTTGCAGG - Intergenic
1008567616 6:52784606-52784628 GCTGCTGTCTCCCAAAGTGCTGG - Intergenic
1012456192 6:99408380-99408402 CCTGCTGTTACTAAAAGTGATGG - Intronic
1016091479 6:139984536-139984558 GCTGCTGCGACTGAACATGCTGG + Intergenic
1018655316 6:166028589-166028611 TCTGCAGTAACTCAAAGTGCAGG + Intergenic
1019271334 7:150617-150639 GCTGCTTTTATTCAAGGTGGGGG + Intergenic
1019635896 7:2075363-2075385 GCCGCTGTGGCTCAGCGTGCTGG - Intronic
1021801921 7:24315806-24315828 GCTTCTGCTCCTGAACGTGCTGG + Intergenic
1023176060 7:37436820-37436842 GCTGGTGTAATTGAACGTGCTGG + Intronic
1032298150 7:130661297-130661319 GCTGCTGTTACTCAGAGGGCTGG - Intronic
1035589596 8:802479-802501 GCTGCTGCTTCTCAACTTGCTGG + Intergenic
1036390479 8:8320212-8320234 GCTGCTGTGACTCACCTTGAAGG - Intronic
1036637114 8:10558836-10558858 GCTTCTGTCACTCAAGGAGCTGG + Intergenic
1037568738 8:20140849-20140871 TCAGGTGTGACTCAACGTGCAGG - Intergenic
1040831913 8:51686360-51686382 GCTTCTGTTACTCCAAGTACCGG - Intronic
1040926170 8:52686122-52686144 GCTACTGTTACACAAAGTGATGG - Intronic
1043035309 8:75190299-75190321 GCTTCTGTCCCTCAAAGTGCTGG + Intergenic
1047225076 8:122949592-122949614 GCTGCTGTCTCCCAAAGTGCTGG - Intronic
1047417067 8:124673421-124673443 CCAGCTTTTACTCCACGTGCAGG - Intronic
1055241579 9:74192660-74192682 GCTACTGTTGCTCACCGTGTGGG + Intergenic
1061849350 9:133405324-133405346 GCTGCTGTCACTCACCAGGCTGG - Exonic
1187483299 X:19677998-19678020 TCTGCTGTTCCTCAAGGGGCAGG + Intronic
1190685100 X:52866426-52866448 GCAGCTGAGACTCAAGGTGCTGG - Exonic
1197863636 X:130995940-130995962 GCTGCTGGTACTCAATGACCCGG + Intergenic
1198156935 X:133970194-133970216 GCTGCTGTTAAGCAAAGGGCTGG + Intronic
1198934572 X:141893203-141893225 GCTCCTGTTGCTCAACATACAGG - Intronic