ID: 999341896

View in Genome Browser
Species Human (GRCh38)
Location 5:150779726-150779748
Sequence CCTCAGAGATGACGATAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 87}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999341896_999341902 16 Left 999341896 5:150779726-150779748 CCTGTCTATCGTCATCTCTGAGG 0: 1
1: 0
2: 1
3: 5
4: 87
Right 999341902 5:150779765-150779787 AGCAGGGCCTGGCTAACAGTAGG No data
999341896_999341898 -7 Left 999341896 5:150779726-150779748 CCTGTCTATCGTCATCTCTGAGG 0: 1
1: 0
2: 1
3: 5
4: 87
Right 999341898 5:150779742-150779764 TCTGAGGCATTCTCAGCTCTTGG No data
999341896_999341901 5 Left 999341896 5:150779726-150779748 CCTGTCTATCGTCATCTCTGAGG 0: 1
1: 0
2: 1
3: 5
4: 87
Right 999341901 5:150779754-150779776 TCAGCTCTTGGAGCAGGGCCTGG 0: 1
1: 2
2: 1
3: 81
4: 480
999341896_999341899 -1 Left 999341896 5:150779726-150779748 CCTGTCTATCGTCATCTCTGAGG 0: 1
1: 0
2: 1
3: 5
4: 87
Right 999341899 5:150779748-150779770 GCATTCTCAGCTCTTGGAGCAGG 0: 1
1: 0
2: 1
3: 16
4: 188
999341896_999341900 0 Left 999341896 5:150779726-150779748 CCTGTCTATCGTCATCTCTGAGG 0: 1
1: 0
2: 1
3: 5
4: 87
Right 999341900 5:150779749-150779771 CATTCTCAGCTCTTGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999341896 Original CRISPR CCTCAGAGATGACGATAGAC AGG (reversed) Intronic
907426195 1:54380702-54380724 CCTCAGAGGTGACCACAGCCTGG + Intronic
913978926 1:143490095-143490117 CCACAGAGAGGACGAGAGGCAGG - Intergenic
914073331 1:144315744-144315766 CCACAGAGAGGACGAGAGGCAGG - Intergenic
914105823 1:144650616-144650638 CCACAGAGAGGACGAGAGGCAGG + Intergenic
914429529 1:147608256-147608278 CCACAGAGTTGACGAGACACAGG - Intronic
917236216 1:172894542-172894564 CCTTAGAGCTGATGATTGACTGG + Intergenic
918741321 1:188134239-188134261 CATCAGAGATGAAGAAAGAAAGG - Intergenic
920206189 1:204293783-204293805 GCTCAGGGATGAGGAAAGACGGG + Intronic
921173184 1:212566923-212566945 CCTCAGAGATGGCTCGAGACAGG - Intronic
924023622 1:239810406-239810428 TCTCAGGGATGAGGATAGCCAGG + Intronic
924492088 1:244548336-244548358 ACTCAGAGATGGCCATAGCCAGG - Intronic
924727290 1:246682684-246682706 CCTCAGTGATGACGGAACACGGG - Intergenic
1067707965 10:48625111-48625133 GCTCAGAGAAGACAAGAGACTGG - Intronic
1068485827 10:57657223-57657245 CCACAGAGATGAAGTGAGACAGG + Intergenic
1069888969 10:71641246-71641268 CCCCAGAGATGATGACACACTGG + Intronic
1073425447 10:103452791-103452813 CCTCAGAGTTGTCCATTGACTGG + Intergenic
1075888143 10:125920077-125920099 CCACAGAGAGTACGAGAGACAGG - Intronic
1076441649 10:130484726-130484748 TCTCGGAGATGATGCTAGACAGG + Intergenic
1078856693 11:15211014-15211036 CCACAGAGATAAAGAGAGACAGG + Intronic
1079400739 11:20104429-20104451 CCTCAGAGATGCCCATAGAATGG - Intronic
1090567830 11:128015159-128015181 CCACAGAGGTGAAGATGGACGGG + Intergenic
1092249405 12:6884257-6884279 CCTCAGAGATGCCAATGGTCTGG - Intronic
1092720176 12:11433349-11433371 CCTCAGAGAAGCAGATAAACAGG - Intronic
1094228889 12:28080405-28080427 CATCAGAGATAAAGATAGCCTGG - Intergenic
1095223275 12:39645418-39645440 CCTCAGAGATGACTTGAAACAGG + Intronic
1098091577 12:66907679-66907701 CCAATGAGATGACGATAGAAGGG + Intergenic
1098497543 12:71153696-71153718 GCTCAGAGCTGAGCATAGACGGG + Intronic
1105220407 13:18321298-18321320 CCACAGAGAGGACGAGAGGCAGG + Intergenic
1113608182 13:111625043-111625065 CCCCAGAAATGACGAGGGACAGG - Intronic
1115945920 14:38660411-38660433 CCTGAGAAATGACTATAGAATGG - Intergenic
1121687259 14:95845783-95845805 CCTCAGAAATGATGTTAGCCAGG - Intergenic
1136036506 16:27544534-27544556 CCTCCGAGATGAGAGTAGACAGG + Intronic
1138387989 16:56649204-56649226 CCTGAGAGATGACAGAAGACTGG - Intronic
1141243704 16:82287091-82287113 AGTCAGGGATGATGATAGACTGG - Intergenic
1144159069 17:12539340-12539362 CGTAAGAGATGACGGTAGAGAGG + Intergenic
1148960505 17:51388623-51388645 CCTCAGAGAGGCAGAAAGACTGG - Intergenic
1152560636 17:81077105-81077127 CCACAGAGATGCCGTGAGACTGG + Intronic
1155129942 18:22924023-22924045 CCTCAGAGCTGAAAATAAACTGG - Intronic
1155705437 18:28804859-28804881 GCTCAGAGAAGATGATGGACAGG - Intergenic
1156365946 18:36427371-36427393 CCTGAGAGGTGATGAGAGACTGG - Intronic
1156579167 18:38355447-38355469 CTTCAGAGATGACCATTGAAGGG + Intergenic
1164691585 19:30214750-30214772 CCACAGAGATGACAGAAGACAGG + Intergenic
1166151953 19:40881316-40881338 CCTCAGAGATGGAGAGAGAGGGG + Intronic
1166178213 19:41089342-41089364 CCTCAGAGATGGAGAGAGAGGGG - Intronic
927921902 2:26979108-26979130 CTTCAGAGATGAAGACACACTGG + Intronic
929576664 2:43056624-43056646 CCTCCAAGATGAGGAGAGACAGG - Intergenic
929845957 2:45527709-45527731 CTTCAGAGATGAAGAGACACAGG + Intronic
934293935 2:91725347-91725369 CCACAGAGAGGACGAGAGGCAGG - Intergenic
934606338 2:95698448-95698470 GCTCAGAGTTCAGGATAGACTGG + Intergenic
937165702 2:119813922-119813944 AGTCAGAGATGATGAAAGACAGG + Intronic
938235736 2:129705277-129705299 TCTCAGAGATGACCAGAGAGGGG + Intergenic
946110153 2:217407988-217408010 CCTCACAGATGTTGCTAGACTGG - Intronic
1170408311 20:16062915-16062937 CCTCAGAGATGAGGATCGGGTGG - Intergenic
1170963238 20:21044060-21044082 CCTCAGAGATGAAAATAACCAGG + Intergenic
1173424151 20:42928308-42928330 CCTCAGAGATGCCCAGAGAGGGG + Intronic
1175485610 20:59343754-59343776 CTGTACAGATGACGATAGACTGG + Intergenic
1183366754 22:37410956-37410978 CCTCAGAGGTGACTCTAGAAGGG + Intronic
952544510 3:34404410-34404432 GCTCAGATAAGACGATAGACTGG + Intergenic
960984137 3:123261751-123261773 CCTCAGTGAGGACGATATAATGG - Intronic
961918969 3:130406109-130406131 CCTGAGAGATGACAATAGACAGG - Exonic
963530400 3:146467936-146467958 CCTTAGAGATGAGGATGGAAAGG + Intronic
966765587 3:183459111-183459133 TGTAAGAGATGACCATAGACTGG + Intergenic
966988064 3:185200582-185200604 CCTCACAGATGCATATAGACAGG + Intronic
975545565 4:75557021-75557043 CCTCAGAGCTCACAATAGACAGG + Intronic
975860833 4:78675069-78675091 CCTCAGTGAAGACTATAGGCCGG - Intergenic
976656104 4:87490234-87490256 TCTCAGAGATGATGGTTGACAGG + Intronic
983880049 4:172922976-172922998 CCTCAGAGATCACCAGAAACAGG + Intronic
988180537 5:27786230-27786252 CCTAAGAGATGACAAAAAACAGG + Intergenic
988348038 5:30065687-30065709 TCTCACAGATTACCATAGACTGG + Intergenic
989474645 5:41860463-41860485 CCTGAGAGATGTGGATAGACAGG + Intronic
995713055 5:115054115-115054137 CCTCAGAGATGAAAAGAGAGGGG + Intergenic
999341896 5:150779726-150779748 CCTCAGAGATGACGATAGACAGG - Intronic
1005144156 6:22668390-22668412 CCACAGAGATACCGATAGAGAGG - Intergenic
1012413679 6:98989016-98989038 TCTCAGCAATGACGATAGGCTGG + Intergenic
1017043954 6:150330045-150330067 ACTCAGAGGTGACCATAGCCAGG + Intergenic
1020402985 7:7798736-7798758 CCCCAGAGATGTCAAGAGACTGG + Intronic
1023296111 7:38716713-38716735 CCTAAGAGAAGACCACAGACTGG + Intergenic
1030192392 7:106822560-106822582 CCTCAGAGGTGACTGTAGCCAGG - Intergenic
1030486828 7:110179352-110179374 CAGCAGAGATGACGATGGTCAGG - Intergenic
1031509220 7:122627470-122627492 CATCAGAGATGTTGATAGAGTGG - Intronic
1035275315 7:157744905-157744927 CCTCAGAGATGCCGGGGGACTGG - Intronic
1037703129 8:21293303-21293325 ACACAGAGAGGACGATAGCCAGG - Intergenic
1042382080 8:68128609-68128631 CCTCATAGATGATGAGAGACAGG - Intronic
1044097702 8:88088485-88088507 CCTAAGAGATAAGGGTAGACAGG + Intronic
1052628182 9:31003726-31003748 GCTCAGAGGTGAGCATAGACTGG - Intergenic
1057334030 9:94142075-94142097 CCTCAGACATGACCAGTGACTGG - Intergenic
1060299339 9:122365677-122365699 GCTCAGAGATGACAAATGACTGG + Intergenic
1185596296 X:1308876-1308898 CCTCATAGTTGACGATGAACAGG - Intronic
1186726998 X:12367916-12367938 TGTCAGTGATGAGGATAGACAGG - Intronic
1186753877 X:12649620-12649642 ACTTAGAGATGAAGATACACAGG - Intronic
1190008248 X:46759633-46759655 CCTGAGAGATGAGGAAAGAGAGG - Intergenic
1190056645 X:47185138-47185160 CCTGCGAGATGACGAGAGGCGGG + Exonic
1192171399 X:68857479-68857501 CCTTAGAGATGAAGCTAGAGGGG + Intergenic
1196791525 X:119468854-119468876 CCTCGGAGATGCCGAGAGCCTGG - Intronic