ID: 999349348

View in Genome Browser
Species Human (GRCh38)
Location 5:150853096-150853118
Sequence CTGTAAAAGCAGTATGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2812
Summary {0: 1, 1: 0, 2: 4, 3: 127, 4: 1274}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999349348_999349352 21 Left 999349348 5:150853096-150853118 CCCTCTTCATACTGCTTTTACAG 0: 1
1: 0
2: 4
3: 127
4: 1274
Right 999349352 5:150853140-150853162 TTGTGTTTTCATTTGTCCTAAGG 0: 1
1: 0
2: 3
3: 58
4: 486

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999349348 Original CRISPR CTGTAAAAGCAGTATGAAGA GGG (reversed) Intronic
901834869 1:11917624-11917646 CTGAAAAAGCAATTTGAAAAAGG + Intergenic
901834869 1:11917624-11917646 CTGAAAAAGCAATTTGAAAAAGG + Intergenic
902119989 1:14155986-14156008 CAGTAAAAGTAGTACTAAGAGGG - Intergenic
902119989 1:14155986-14156008 CAGTAAAAGTAGTACTAAGAGGG - Intergenic
902402221 1:16164498-16164520 CTCTTAGAGCAGTATGACGATGG + Intergenic
902402221 1:16164498-16164520 CTCTTAGAGCAGTATGACGATGG + Intergenic
903567226 1:24277234-24277256 CTGTAAAATGGGTATGATGATGG - Intergenic
903567226 1:24277234-24277256 CTGTAAAATGGGTATGATGATGG - Intergenic
904774757 1:32899993-32900015 CTGGAATAGCATTGTGAAGATGG + Intronic
904774757 1:32899993-32900015 CTGGAATAGCATTGTGAAGATGG + Intronic
905053534 1:35073761-35073783 CAGGAAAAGCAGTTTTAAGAGGG - Intronic
905053534 1:35073761-35073783 CAGGAAAAGCAGTTTTAAGAGGG - Intronic
905461952 1:38127870-38127892 CAGTCAAAGCAGAGTGAAGAAGG - Intergenic
905461952 1:38127870-38127892 CAGTCAAAGCAGAGTGAAGAAGG - Intergenic
906097410 1:43233745-43233767 AGGTAAAAGCATGATGAAGAGGG + Intronic
906097410 1:43233745-43233767 AGGTAAAAGCATGATGAAGAGGG + Intronic
906352468 1:45074864-45074886 CAGCAAAAGCAGTACTAAGAGGG - Intronic
906352468 1:45074864-45074886 CAGCAAAAGCAGTACTAAGAGGG - Intronic
906369420 1:45240127-45240149 CTTTATCAGCAGTATGAAAACGG - Intronic
906369420 1:45240127-45240149 CTTTATCAGCAGTATGAAAACGG - Intronic
906598379 1:47101397-47101419 CAGTAAAAGCAGTGCTAAGATGG - Intronic
906598379 1:47101397-47101419 CAGTAAAAGCAGTGCTAAGATGG - Intronic
906993151 1:50760677-50760699 CATTCAAAGCAGTATGTAGAGGG + Intronic
906993151 1:50760677-50760699 CATTCAAAGCAGTATGTAGAGGG + Intronic
907114471 1:51956835-51956857 CTGTAAAATAAGTATGAAAATGG - Intronic
907114471 1:51956835-51956857 CTGTAAAATAAGTATGAAAATGG - Intronic
907430393 1:54407586-54407608 CTCTAAAAACAGTCTGAAAATGG - Intronic
907430393 1:54407586-54407608 CTCTAAAAACAGTCTGAAAATGG - Intronic
907618339 1:55948358-55948380 CTACAAAAGCAATATGAAGTGGG + Intergenic
907618339 1:55948358-55948380 CTACAAAAGCAATATGAAGTGGG + Intergenic
907995211 1:59624528-59624550 CCGTATCAGCAGTATGAAAACGG - Intronic
907995211 1:59624528-59624550 CCGTATCAGCAGTATGAAAACGG - Intronic
908061919 1:60359719-60359741 CTGCAAAAGAAGGTTGAAGAAGG - Intergenic
908061919 1:60359719-60359741 CTGCAAAAGAAGGTTGAAGAAGG - Intergenic
908172537 1:61520920-61520942 TTGAAAAAGAAGTATGAAGTTGG - Intergenic
908172537 1:61520920-61520942 TTGAAAAAGAAGTATGAAGTTGG - Intergenic
908180522 1:61599969-61599991 CTGTGAAAGCAGTACTAAGGGGG + Intergenic
908180522 1:61599969-61599991 CTGTGAAAGCAGTACTAAGGGGG + Intergenic
908393624 1:63705457-63705479 CTGAGGAAGCAGTATGAACAAGG - Intergenic
908393624 1:63705457-63705479 CTGAGGAAGCAGTATGAACAAGG - Intergenic
908427207 1:64018645-64018667 CAGGAAAAGCAGTATGGAGAGGG + Intronic
908427207 1:64018645-64018667 CAGGAAAAGCAGTATGGAGAGGG + Intronic
908576437 1:65465176-65465198 CTTTTAAAGCAGTGTGTAGAGGG - Intronic
908576437 1:65465176-65465198 CTTTTAAAGCAGTGTGTAGAGGG - Intronic
908624900 1:66029047-66029069 CTTTATAAGCAGTGTGAAAAAGG - Intronic
908624900 1:66029047-66029069 CTTTATAAGCAGTGTGAAAAAGG - Intronic
908787360 1:67748471-67748493 CTTTAAAAGAAGTAGCAAGAAGG + Intronic
908787360 1:67748471-67748493 CTTTAAAAGAAGTAGCAAGAAGG + Intronic
908968945 1:69801866-69801888 CAGTAAAAGTAGTACTAAGAGGG - Intronic
908968945 1:69801866-69801888 CAGTAAAAGTAGTACTAAGAGGG - Intronic
908970182 1:69819208-69819230 CAGCAAAAGCAGTTTTAAGAGGG - Intronic
908970182 1:69819208-69819230 CAGCAAAAGCAGTTTTAAGAGGG - Intronic
909082677 1:71132444-71132466 CAGCAAAAGCAGTTTTAAGAAGG + Intergenic
909082677 1:71132444-71132466 CAGCAAAAGCAGTTTTAAGAAGG + Intergenic
909250121 1:73343419-73343441 CTTTATCAGCAGTATGAAAATGG + Intergenic
909250121 1:73343419-73343441 CTTTATCAGCAGTATGAAAATGG + Intergenic
909303357 1:74040779-74040801 CAGCTAAAGCAGTATTAAGAGGG + Intronic
909303357 1:74040779-74040801 CAGCTAAAGCAGTATTAAGAGGG + Intronic
909312592 1:74172234-74172256 AAGTAAAAGCAGTATGATAAGGG - Intronic
909312592 1:74172234-74172256 AAGTAAAAGCAGTATGATAAGGG - Intronic
909320134 1:74275141-74275163 CTTTATAAGCAGTGTGAAAATGG - Intronic
909320134 1:74275141-74275163 CTTTATAAGCAGTGTGAAAATGG - Intronic
909385082 1:75045731-75045753 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
909385082 1:75045731-75045753 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
909587509 1:77307246-77307268 CAGCAAAAGCAGTATTAAGAAGG - Intronic
909587509 1:77307246-77307268 CAGCAAAAGCAGTATTAAGAAGG - Intronic
909592047 1:77361582-77361604 CTTTAACAGCAGCATGAAAATGG - Intronic
909592047 1:77361582-77361604 CTTTAACAGCAGCATGAAAATGG - Intronic
909733924 1:78932413-78932435 CAGTTAAAGCAGTATTAAGAGGG + Intronic
909733924 1:78932413-78932435 CAGTTAAAGCAGTATTAAGAGGG + Intronic
909840742 1:80319992-80320014 CTGTGAAAGAACTATGAACAAGG + Intergenic
909840742 1:80319992-80320014 CTGTGAAAGAACTATGAACAAGG + Intergenic
909869457 1:80721392-80721414 TTGCATAAGCAGTATTAAGAGGG - Intergenic
909869457 1:80721392-80721414 TTGCATAAGCAGTATTAAGAGGG - Intergenic
910314824 1:85870687-85870709 CATTTAAAGCAGTATGTAGAGGG + Intronic
910314824 1:85870687-85870709 CATTTAAAGCAGTATGTAGAGGG + Intronic
910351312 1:86301346-86301368 CAGCAAAAGCAGTATTAACAGGG - Intergenic
910351312 1:86301346-86301368 CAGCAAAAGCAGTATTAACAGGG - Intergenic
910727885 1:90357953-90357975 CAGGAAAAGCAGTATAAAAATGG + Intergenic
910727885 1:90357953-90357975 CAGGAAAAGCAGTATAAAAATGG + Intergenic
910763482 1:90758068-90758090 GTGAAAAACTAGTATGAAGATGG + Intergenic
910763482 1:90758068-90758090 GTGAAAAACTAGTATGAAGATGG + Intergenic
911358547 1:96849481-96849503 CTGTAAAAGCAGTCAGGAGTGGG + Intergenic
911358547 1:96849481-96849503 CTGTAAAAGCAGTCAGGAGTGGG + Intergenic
911424028 1:97684185-97684207 CTGCTAAAGCAGTGTTAAGAGGG - Intronic
911424028 1:97684185-97684207 CTGCTAAAGCAGTGTTAAGAGGG - Intronic
911800428 1:102131265-102131287 CAGCTAAAGCAGTATTAAGAGGG + Intergenic
911800428 1:102131265-102131287 CAGCTAAAGCAGTATTAAGAGGG + Intergenic
911876972 1:103178871-103178893 CTGGTAAACCAGTAAGAAGAAGG + Intergenic
911876972 1:103178871-103178893 CTGGTAAACCAGTAAGAAGAAGG + Intergenic
912059256 1:105644651-105644673 CAGAAAAAGCAGTACTAAGAGGG + Intergenic
912059256 1:105644651-105644673 CAGAAAAAGCAGTACTAAGAGGG + Intergenic
912117279 1:106422159-106422181 CTGTAAAAGCATTACAAAGAGGG + Intergenic
912117279 1:106422159-106422181 CTGTAAAAGCATTACAAAGAGGG + Intergenic
912136500 1:106665774-106665796 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
912136500 1:106665774-106665796 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
912588587 1:110790217-110790239 CACCAAAAGCAGTATTAAGAGGG + Intergenic
912588587 1:110790217-110790239 CACCAAAAGCAGTATTAAGAGGG + Intergenic
912636455 1:111298577-111298599 CAGTTAAAGCAGTGTGTAGAGGG + Intronic
912636455 1:111298577-111298599 CAGTTAAAGCAGTGTGTAGAGGG + Intronic
912741491 1:112202299-112202321 CTTTCAAAGCAGTGTGTAGAGGG - Intergenic
912741491 1:112202299-112202321 CTTTCAAAGCAGTGTGTAGAGGG - Intergenic
912885425 1:113467091-113467113 CAACAAAAGCAGTATTAAGAGGG - Intronic
912885425 1:113467091-113467113 CAACAAAAGCAGTATTAAGAGGG - Intronic
912894060 1:113566782-113566804 TAGTAAAAGCAGTACTAAGAGGG + Intronic
912894060 1:113566782-113566804 TAGTAAAAGCAGTACTAAGAGGG + Intronic
912898957 1:113627079-113627101 CAGCAAAAGCAGTACTAAGAGGG - Intronic
912898957 1:113627079-113627101 CAGCAAAAGCAGTACTAAGAGGG - Intronic
913071754 1:115305026-115305048 CTGTAATAGAAGTATTAATAAGG + Intronic
913071754 1:115305026-115305048 CTGTAATAGAAGTATTAATAAGG + Intronic
913158931 1:116128220-116128242 CTGGAACAGCTGGATGAAGATGG + Exonic
913158931 1:116128220-116128242 CTGGAACAGCTGGATGAAGATGG + Exonic
913473779 1:119217184-119217206 CTGGACAAGCAGAATGATGATGG - Intergenic
913473779 1:119217184-119217206 CTGGACAAGCAGAATGATGATGG - Intergenic
913943024 1:125125912-125125934 CAGTCAAAGCAGTGTGTAGAGGG + Intergenic
913943024 1:125125912-125125934 CAGTCAAAGCAGTGTGTAGAGGG + Intergenic
914830574 1:151168102-151168124 CTGTAAAAGCAGTAAGGGAAAGG - Intronic
914830574 1:151168102-151168124 CTGTAAAAGCAGTAAGGGAAAGG - Intronic
914895945 1:151673114-151673136 CAGCAAAAGCAGTACTAAGAAGG - Intronic
914895945 1:151673114-151673136 CAGCAAAAGCAGTACTAAGAAGG - Intronic
915116230 1:153601910-153601932 CAGCAAAAGTAGTATAAAGAGGG + Intergenic
915116230 1:153601910-153601932 CAGCAAAAGTAGTATAAAGAGGG + Intergenic
915337066 1:155150745-155150767 CAGTGAAAGCAGTACTAAGAGGG + Intergenic
915337066 1:155150745-155150767 CAGTGAAAGCAGTACTAAGAGGG + Intergenic
915804187 1:158827813-158827835 CTTTATCAGCAGGATGAAGATGG - Intergenic
915804187 1:158827813-158827835 CTTTATCAGCAGGATGAAGATGG - Intergenic
915851214 1:159325796-159325818 CTTTTAAAGCAGTGTGTAGAGGG + Intergenic
915851214 1:159325796-159325818 CTTTTAAAGCAGTGTGTAGAGGG + Intergenic
916616102 1:166441928-166441950 CAGCAAAAGCAGTACTAAGAAGG - Intergenic
916616102 1:166441928-166441950 CAGCAAAAGCAGTACTAAGAAGG - Intergenic
916845132 1:168642841-168642863 CTTTATAAGCAGCATGAAAATGG - Intergenic
916845132 1:168642841-168642863 CTTTATAAGCAGCATGAAAATGG - Intergenic
916911428 1:169351418-169351440 CAGTGAAAGCAGTATTAAGAGGG + Intronic
916911428 1:169351418-169351440 CAGTGAAAGCAGTATTAAGAGGG + Intronic
917300308 1:173566829-173566851 CAGCAAAAGCAGTACTAAGAGGG - Intronic
917300308 1:173566829-173566851 CAGCAAAAGCAGTACTAAGAGGG - Intronic
917372849 1:174314648-174314670 CAGCAAAAGCAGTACAAAGAGGG - Intronic
917372849 1:174314648-174314670 CAGCAAAAGCAGTACAAAGAGGG - Intronic
917842262 1:178990748-178990770 CATTCAAAGCAGTATGTAGAGGG - Intergenic
917842262 1:178990748-178990770 CATTCAAAGCAGTATGTAGAGGG - Intergenic
917991267 1:180381709-180381731 CAGTAAAAACAGTGTTAAGAAGG + Intronic
917991267 1:180381709-180381731 CAGTAAAAACAGTGTTAAGAAGG + Intronic
918007892 1:180559102-180559124 CTTTATCAGCAGTATGAAAACGG + Intergenic
918007892 1:180559102-180559124 CTTTATCAGCAGTATGAAAACGG + Intergenic
918225760 1:182480949-182480971 CAGCAAAAGCAGTACTAAGATGG + Intronic
918225760 1:182480949-182480971 CAGCAAAAGCAGTACTAAGATGG + Intronic
918415811 1:184306879-184306901 CAGCAAAAGCAGTACTAAGATGG - Intergenic
918415811 1:184306879-184306901 CAGCAAAAGCAGTACTAAGATGG - Intergenic
918418792 1:184340499-184340521 CATTCAAAGCAGTATGTAGAGGG - Intergenic
918418792 1:184340499-184340521 CATTCAAAGCAGTATGTAGAGGG - Intergenic
918518709 1:185390738-185390760 CTGTAAAATCAGGCTGATGATGG + Intergenic
918518709 1:185390738-185390760 CTGTAAAATCAGGCTGATGATGG + Intergenic
918633401 1:186746888-186746910 CTTTATCAGCAGCATGAAGATGG + Intergenic
918633401 1:186746888-186746910 CTTTATCAGCAGCATGAAGATGG + Intergenic
918671341 1:187220845-187220867 CAGCAAAAGCAGTACTAAGAAGG - Intergenic
918671341 1:187220845-187220867 CAGCAAAAGCAGTACTAAGAAGG - Intergenic
918713873 1:187765283-187765305 CAGAAAAAGCAGAATGAAAAAGG - Intergenic
918713873 1:187765283-187765305 CAGAAAAAGCAGAATGAAAAAGG - Intergenic
918955512 1:191201705-191201727 ATGCAAAAGCAGTGTTAAGAGGG + Intergenic
918955512 1:191201705-191201727 ATGCAAAAGCAGTGTTAAGAGGG + Intergenic
919008855 1:191933517-191933539 CAGTAAAAGCAATACTAAGAGGG + Intergenic
919008855 1:191933517-191933539 CAGTAAAAGCAATACTAAGAGGG + Intergenic
919012993 1:191989187-191989209 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
919012993 1:191989187-191989209 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
919135548 1:193503952-193503974 CTTTATAAGCAGCATGAAAATGG + Intergenic
919135548 1:193503952-193503974 CTTTATAAGCAGCATGAAAATGG + Intergenic
919166311 1:193898797-193898819 CTTTATAAGCAGCATGAAAATGG - Intergenic
919166311 1:193898797-193898819 CTTTATAAGCAGCATGAAAATGG - Intergenic
919269651 1:195323397-195323419 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
919269651 1:195323397-195323419 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
919316572 1:195978550-195978572 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
919316572 1:195978550-195978572 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
919433345 1:197524906-197524928 CAGTAAAAGCAGTCTGTAAAGGG - Intronic
919433345 1:197524906-197524928 CAGTAAAAGCAGTCTGTAAAGGG - Intronic
919453745 1:197800056-197800078 CAGTAAAAGCAGTTCTAAGATGG + Intergenic
919453745 1:197800056-197800078 CAGTAAAAGCAGTTCTAAGATGG + Intergenic
919457772 1:197840169-197840191 CTTTATCAGCAGTATGAAAACGG + Intergenic
919457772 1:197840169-197840191 CTTTATCAGCAGTATGAAAACGG + Intergenic
919461386 1:197881834-197881856 CATTTAAAGCAGTATGTAGAAGG - Intergenic
919461386 1:197881834-197881856 CATTTAAAGCAGTATGTAGAAGG - Intergenic
919595378 1:199555271-199555293 CAGTGAAAGCAGTACTAAGAGGG + Intergenic
919595378 1:199555271-199555293 CAGTGAAAGCAGTACTAAGAGGG + Intergenic
921004405 1:211078608-211078630 CATTTAAAGCAGTATGTAGAGGG + Intronic
921004405 1:211078608-211078630 CATTTAAAGCAGTATGTAGAGGG + Intronic
921042995 1:211452100-211452122 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
921042995 1:211452100-211452122 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
921147355 1:212370782-212370804 CAGCAAAAGCAGTACTAAGAGGG + Intronic
921147355 1:212370782-212370804 CAGCAAAAGCAGTACTAAGAGGG + Intronic
921171840 1:212557703-212557725 CTTTAAAACCAGTTTTAAGATGG + Intergenic
921171840 1:212557703-212557725 CTTTAAAACCAGTTTTAAGATGG + Intergenic
921571506 1:216784888-216784910 CTGAAATAGCAATATAAAGAGGG - Intronic
921571506 1:216784888-216784910 CTGAAATAGCAATATAAAGAGGG - Intronic
921756018 1:218856468-218856490 CTGTAACAGTATTATGAGGAGGG + Intergenic
921756018 1:218856468-218856490 CTGTAACAGTATTATGAGGAGGG + Intergenic
921910291 1:220541281-220541303 CAGCAAAAGCAGTACTAAGAGGG - Intronic
921910291 1:220541281-220541303 CAGCAAAAGCAGTACTAAGAGGG - Intronic
922332067 1:224586206-224586228 CTTTAACAGCAGCATGAAAACGG - Intronic
922332067 1:224586206-224586228 CTTTAACAGCAGCATGAAAACGG - Intronic
922381666 1:225035546-225035568 CTGCAAAAGCAGTACTAACAGGG - Intronic
922381666 1:225035546-225035568 CTGCAAAAGCAGTACTAACAGGG - Intronic
922547524 1:226469500-226469522 CTGTACAAGCAGTATGATGCTGG - Intergenic
922547524 1:226469500-226469522 CTGTACAAGCAGTATGATGCTGG - Intergenic
922870760 1:228900161-228900183 CTTTGAAAGCAGAAAGAAGATGG - Intergenic
922870760 1:228900161-228900183 CTTTGAAAGCAGAAAGAAGATGG - Intergenic
923259410 1:232252969-232252991 CTTTAAAAGCAGGGTGAAAACGG + Intergenic
923259410 1:232252969-232252991 CTTTAAAAGCAGGGTGAAAACGG + Intergenic
923461096 1:234210273-234210295 CTTTATCAGCAGCATGAAGATGG + Intronic
923461096 1:234210273-234210295 CTTTATCAGCAGCATGAAGATGG + Intronic
923769581 1:236926768-236926790 CTTTATCAGCAGTATGAAAACGG + Intergenic
923769581 1:236926768-236926790 CTTTATCAGCAGTATGAAAACGG + Intergenic
923878910 1:238082280-238082302 CAGCAAAAGCAGTATTAAGAGGG - Intergenic
923878910 1:238082280-238082302 CAGCAAAAGCAGTATTAAGAGGG - Intergenic
923893821 1:238246295-238246317 CAGCAAAAACAGTTTGAAGAGGG + Intergenic
923893821 1:238246295-238246317 CAGCAAAAACAGTTTGAAGAGGG + Intergenic
923915423 1:238497736-238497758 CTTTATAAGCAGTATGAGAATGG + Intergenic
923915423 1:238497736-238497758 CTTTATAAGCAGTATGAGAATGG + Intergenic
923935952 1:238760640-238760662 CTTTATCAGCAGTATGAAAACGG - Intergenic
923935952 1:238760640-238760662 CTTTATCAGCAGTATGAAAACGG - Intergenic
923949153 1:238927487-238927509 CTGTATCAGCAGTGTGAAAATGG - Intergenic
923949153 1:238927487-238927509 CTGTATCAGCAGTGTGAAAATGG - Intergenic
924630245 1:245731279-245731301 CAGTGAAAGCAGTACTAAGAGGG + Intergenic
924630245 1:245731279-245731301 CAGTGAAAGCAGTACTAAGAGGG + Intergenic
924863996 1:247958093-247958115 CATTCAAAGCAGTATGTAGAGGG - Intronic
924863996 1:247958093-247958115 CATTCAAAGCAGTATGTAGAGGG - Intronic
924873140 1:248070465-248070487 CATTCAAAGCAGTATGTAGAGGG + Intronic
924873140 1:248070465-248070487 CATTCAAAGCAGTATGTAGAGGG + Intronic
924892654 1:248300025-248300047 CATTCAAAGCAGTATGTAGAGGG + Intergenic
924892654 1:248300025-248300047 CATTCAAAGCAGTATGTAGAGGG + Intergenic
1063481350 10:6379448-6379470 CTTTATAAGCAGCATGAAAATGG - Intergenic
1063481350 10:6379448-6379470 CTTTATAAGCAGCATGAAAATGG - Intergenic
1063771353 10:9205833-9205855 CAGTGAAATGAGTATGAAGAAGG + Intergenic
1063771353 10:9205833-9205855 CAGTGAAATGAGTATGAAGAAGG + Intergenic
1063972624 10:11392035-11392057 ATATAAAAGCAGCATGAAAATGG - Intergenic
1063972624 10:11392035-11392057 ATATAAAAGCAGCATGAAAATGG - Intergenic
1064350822 10:14574808-14574830 CTATAAATTCTGTATGAAGATGG + Intronic
1064350822 10:14574808-14574830 CTATAAATTCTGTATGAAGATGG + Intronic
1064521293 10:16205037-16205059 CAGTGAAAGCAGTATTAAGAGGG - Intergenic
1064521293 10:16205037-16205059 CAGTGAAAGCAGTATTAAGAGGG - Intergenic
1064528836 10:16285961-16285983 CTTTATCAGCAGTATGAAAATGG - Intergenic
1064528836 10:16285961-16285983 CTTTATCAGCAGTATGAAAATGG - Intergenic
1064761951 10:18630244-18630266 CATTCAAAGCAGTATGTAGAGGG + Intronic
1064761951 10:18630244-18630266 CATTCAAAGCAGTATGTAGAGGG + Intronic
1064858593 10:19799141-19799163 CTTTAACAGCAGTGTGAAAATGG - Intergenic
1064858593 10:19799141-19799163 CTTTAACAGCAGTGTGAAAATGG - Intergenic
1064912094 10:20413771-20413793 CTGTGAAATCAGTATTAATATGG - Intergenic
1064912094 10:20413771-20413793 CTGTGAAATCAGTATTAATATGG - Intergenic
1064916321 10:20462828-20462850 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1064916321 10:20462828-20462850 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1065075724 10:22077474-22077496 CATTTAAAGCAGTATGTAGAGGG - Intergenic
1065075724 10:22077474-22077496 CATTTAAAGCAGTATGTAGAGGG - Intergenic
1065431235 10:25658987-25659009 CAGTGAAAGCAGTACTAAGAGGG - Intergenic
1065431235 10:25658987-25659009 CAGTGAAAGCAGTACTAAGAGGG - Intergenic
1065447134 10:25814574-25814596 AAGTGAAAGCAGTATGAAAATGG + Intergenic
1065447134 10:25814574-25814596 AAGTGAAAGCAGTATGAAAATGG + Intergenic
1065460238 10:25954204-25954226 CTGTAAAAGCAGTATTAATAAGG + Intronic
1065460238 10:25954204-25954226 CTGTAAAAGCAGTATTAATAAGG + Intronic
1065868172 10:29932242-29932264 CTGTAAATGCAGCATGCAGCTGG - Intergenic
1065868172 10:29932242-29932264 CTGTAAATGCAGCATGCAGCTGG - Intergenic
1066015312 10:31235972-31235994 CAGTAAAAACAGTACCAAGAGGG + Intergenic
1066015312 10:31235972-31235994 CAGTAAAAACAGTACCAAGAGGG + Intergenic
1066158782 10:32706309-32706331 CATTTAAAGCAGTATGTAGAGGG + Intronic
1066158782 10:32706309-32706331 CATTTAAAGCAGTATGTAGAGGG + Intronic
1067132858 10:43581567-43581589 CAGAAAAAGCAGTACTAAGAGGG - Intergenic
1067132858 10:43581567-43581589 CAGAAAAAGCAGTACTAAGAGGG - Intergenic
1067656166 10:48193243-48193265 CTGTAAAAGCAGAAAGCAGAAGG - Intronic
1067656166 10:48193243-48193265 CTGTAAAAGCAGAAAGCAGAAGG - Intronic
1068093915 10:52466646-52466668 CTGTGAAAGGAGTGTGAAGGGGG + Intergenic
1068093915 10:52466646-52466668 CTGTGAAAGGAGTGTGAAGGGGG + Intergenic
1068103660 10:52587728-52587750 CAGAAAAAGCAGTACTAAGAGGG - Intergenic
1068103660 10:52587728-52587750 CAGAAAAAGCAGTACTAAGAGGG - Intergenic
1068125174 10:52830880-52830902 CAATAAAAGCAGTACTAAGAGGG + Intergenic
1068125174 10:52830880-52830902 CAATAAAAGCAGTACTAAGAGGG + Intergenic
1068126538 10:52848407-52848429 CAGCAAAAGCAGTGTTAAGAAGG - Intergenic
1068126538 10:52848407-52848429 CAGCAAAAGCAGTGTTAAGAAGG - Intergenic
1068148147 10:53097782-53097804 CTGTAAAAGCAGCTAGAATAGGG + Intergenic
1068148147 10:53097782-53097804 CTGTAAAAGCAGCTAGAATAGGG + Intergenic
1068563149 10:58540114-58540136 CAGCAAAAGCAGTAGTAAGAGGG + Intronic
1068563149 10:58540114-58540136 CAGCAAAAGCAGTAGTAAGAGGG + Intronic
1068696753 10:59975979-59976001 CTTTATAAGCAGCATGAATATGG - Intergenic
1068696753 10:59975979-59976001 CTTTATAAGCAGCATGAATATGG - Intergenic
1069141893 10:64837574-64837596 CATTAAAAGCAGTGTGTAGAGGG + Intergenic
1069141893 10:64837574-64837596 CATTAAAAGCAGTGTGTAGAGGG + Intergenic
1069239501 10:66122636-66122658 CTTTATCAGCAGTATGAAAATGG - Intronic
1069239501 10:66122636-66122658 CTTTATCAGCAGTATGAAAATGG - Intronic
1070040629 10:72775383-72775405 CTGTAAAAGCCTTACTAAGAGGG + Intronic
1070040629 10:72775383-72775405 CTGTAAAAGCCTTACTAAGAGGG + Intronic
1071076951 10:81766353-81766375 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
1071076951 10:81766353-81766375 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
1071134269 10:82435598-82435620 CAGTTAAAGCAGTGTTAAGAGGG - Intronic
1071134269 10:82435598-82435620 CAGTTAAAGCAGTGTTAAGAGGG - Intronic
1071477849 10:86040087-86040109 CTGAAAAAGCAGAGTTAAGATGG + Intronic
1071477849 10:86040087-86040109 CTGAAAAAGCAGAGTTAAGATGG + Intronic
1071904349 10:90156604-90156626 CTTTCAAAGCAGTGTGTAGAGGG - Intergenic
1071904349 10:90156604-90156626 CTTTCAAAGCAGTGTGTAGAGGG - Intergenic
1071950238 10:90695818-90695840 CAGCAAAAGCAGTACTAAGAAGG - Intergenic
1071950238 10:90695818-90695840 CAGCAAAAGCAGTACTAAGAAGG - Intergenic
1072485866 10:95854584-95854606 CATTCAAAGCAGTATGTAGAGGG - Intronic
1072485866 10:95854584-95854606 CATTCAAAGCAGTATGTAGAGGG - Intronic
1072834722 10:98698480-98698502 CATTCAAAGCAGTGTGAAGAGGG + Intronic
1072834722 10:98698480-98698502 CATTCAAAGCAGTGTGAAGAGGG + Intronic
1072953226 10:99866835-99866857 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
1072953226 10:99866835-99866857 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
1074171907 10:110948720-110948742 CAGCAAAAGCAGTTTTAAGAGGG + Intronic
1074171907 10:110948720-110948742 CAGCAAAAGCAGTTTTAAGAGGG + Intronic
1074223785 10:111463320-111463342 CTTTACAAGCAGTGTGAAAATGG + Intergenic
1074223785 10:111463320-111463342 CTTTACAAGCAGTGTGAAAATGG + Intergenic
1074480146 10:113812090-113812112 CAGTTAAAGCAGTGTTAAGAGGG + Intergenic
1074480146 10:113812090-113812112 CAGTTAAAGCAGTGTTAAGAGGG + Intergenic
1074626480 10:115193849-115193871 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1074626480 10:115193849-115193871 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1074792101 10:116899769-116899791 CTGTCAAAGCACTTTGAAGTCGG - Intronic
1074792101 10:116899769-116899791 CTGTCAAAGCACTTTGAAGTCGG - Intronic
1074809186 10:117085290-117085312 CAGTAAAAGCAGTGTTCAGAGGG - Intronic
1074809186 10:117085290-117085312 CAGTAAAAGCAGTGTTCAGAGGG - Intronic
1074931878 10:118135833-118135855 CTTTATCAGCAGTATGAAAATGG - Intergenic
1074931878 10:118135833-118135855 CTTTATCAGCAGTATGAAAATGG - Intergenic
1074960062 10:118436200-118436222 CTTTATCAGCAGTATGAAAACGG + Intergenic
1074960062 10:118436200-118436222 CTTTATCAGCAGTATGAAAACGG + Intergenic
1077428574 11:2501032-2501054 CAGCAAAAGCAGTATTAAGAGGG + Intronic
1077428574 11:2501032-2501054 CAGCAAAAGCAGTATTAAGAGGG + Intronic
1078244233 11:9558925-9558947 CAGTGAAAGCAGTACTAAGAGGG - Intergenic
1078244233 11:9558925-9558947 CAGTGAAAGCAGTACTAAGAGGG - Intergenic
1078371314 11:10748491-10748513 CTGAAAAAGTAGTGTCAAGAAGG - Intergenic
1078371314 11:10748491-10748513 CTGAAAAAGTAGTGTCAAGAAGG - Intergenic
1078393862 11:10961099-10961121 CAGCAAAATCAGTTTGAAGAAGG + Intergenic
1078393862 11:10961099-10961121 CAGCAAAATCAGTTTGAAGAAGG + Intergenic
1078443539 11:11387111-11387133 ATGTAAATGCAGTCTGAAAACGG + Intronic
1078443539 11:11387111-11387133 ATGTAAATGCAGTCTGAAAACGG + Intronic
1078565862 11:12413552-12413574 CTTTAAAAGCAGTGTTATGATGG + Intronic
1078565862 11:12413552-12413574 CTTTAAAAGCAGTGTTATGATGG + Intronic
1078691892 11:13589801-13589823 CAGTGAAAGCAGTACTAAGAGGG + Intergenic
1078691892 11:13589801-13589823 CAGTGAAAGCAGTACTAAGAGGG + Intergenic
1078829076 11:14961771-14961793 GTGGAAAAGCAGTGTGTAGAGGG + Intronic
1078829076 11:14961771-14961793 GTGGAAAAGCAGTGTGTAGAGGG + Intronic
1078851138 11:15165017-15165039 CTGTATCAGCAGCATGAAAATGG + Intronic
1078851138 11:15165017-15165039 CTGTATCAGCAGCATGAAAATGG + Intronic
1079257096 11:18840604-18840626 CAGCTAAAGCAGTATTAAGAGGG + Intergenic
1079257096 11:18840604-18840626 CAGCTAAAGCAGTATTAAGAGGG + Intergenic
1079416806 11:20245257-20245279 CTGGAAAAGCAGTAAGAAAGAGG - Intergenic
1079416806 11:20245257-20245279 CTGGAAAAGCAGTAAGAAAGAGG - Intergenic
1079657687 11:23002902-23002924 CTTTATCAGCAGTGTGAAGATGG - Intergenic
1079657687 11:23002902-23002924 CTTTATCAGCAGTGTGAAGATGG - Intergenic
1079692004 11:23430511-23430533 CAGTAAAAGCAATAGTAAGATGG - Intergenic
1079692004 11:23430511-23430533 CAGTAAAAGCAATAGTAAGATGG - Intergenic
1079815120 11:25046848-25046870 ATGTAAAAGCAGAATAAAAATGG + Intronic
1079815120 11:25046848-25046870 ATGTAAAAGCAGAATAAAAATGG + Intronic
1079972395 11:27051937-27051959 CAGTAAAAGTAGTTTGAAGAAGG - Intronic
1079972395 11:27051937-27051959 CAGTAAAAGTAGTTTGAAGAAGG - Intronic
1080138136 11:28882553-28882575 CATTTAAAGCAGTATGTAGAGGG - Intergenic
1080138136 11:28882553-28882575 CATTTAAAGCAGTATGTAGAGGG - Intergenic
1080286332 11:30618101-30618123 CTGGAAAAGCACTTTAAAGAGGG + Intergenic
1080286332 11:30618101-30618123 CTGGAAAAGCACTTTAAAGAGGG + Intergenic
1080292830 11:30690138-30690160 CTGCTAAAGCAGTGTAAAGAGGG + Intergenic
1080292830 11:30690138-30690160 CTGCTAAAGCAGTGTAAAGAGGG + Intergenic
1080318217 11:30974224-30974246 CAGTAAAAGCAGTGCTAAGAGGG + Intronic
1080318217 11:30974224-30974246 CAGTAAAAGCAGTGCTAAGAGGG + Intronic
1080348663 11:31356426-31356448 CATTCAAAGCAGTATGTAGAGGG + Intronic
1080348663 11:31356426-31356448 CATTCAAAGCAGTATGTAGAGGG + Intronic
1080417008 11:32078295-32078317 CTTTATCAGCAGTATGAAAACGG - Intronic
1080417008 11:32078295-32078317 CTTTATCAGCAGTATGAAAACGG - Intronic
1080675716 11:34424497-34424519 CCCTAAAAGCTGTATAAAGAAGG - Intergenic
1080675716 11:34424497-34424519 CCCTAAAAGCTGTATAAAGAAGG - Intergenic
1080850825 11:36068409-36068431 CTGTAAAAGGAAGATAAAGATGG - Intronic
1080850825 11:36068409-36068431 CTGTAAAAGGAAGATAAAGATGG - Intronic
1081064731 11:38526763-38526785 CAGCAAAAGCAGTGTTAAGAGGG + Intergenic
1081064731 11:38526763-38526785 CAGCAAAAGCAGTGTTAAGAGGG + Intergenic
1081080433 11:38733430-38733452 CTGTGAAAGCAGTCTGGAGTGGG - Intergenic
1081080433 11:38733430-38733452 CTGTGAAAGCAGTCTGGAGTGGG - Intergenic
1081264845 11:41007829-41007851 CTGTAATAGCTGTATTAAGTTGG - Intronic
1081264845 11:41007829-41007851 CTGTAATAGCTGTATTAAGTTGG - Intronic
1081817492 11:45957626-45957648 CTGTGAAAGCAGTACTCAGAGGG + Intronic
1081817492 11:45957626-45957648 CTGTGAAAGCAGTACTCAGAGGG + Intronic
1082602076 11:55170680-55170702 CAGTCAAAGCAGTGTGTAGAGGG - Intergenic
1082602076 11:55170680-55170702 CAGTCAAAGCAGTGTGTAGAGGG - Intergenic
1082935202 11:58648983-58649005 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1082935202 11:58648983-58649005 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1083041670 11:59693856-59693878 CAGCAAAAGCAGTAGTAAGAGGG + Intergenic
1083041670 11:59693856-59693878 CAGCAAAAGCAGTAGTAAGAGGG + Intergenic
1083345513 11:61987976-61987998 CAGCTAAAGCAGTATTAAGAGGG + Intergenic
1083345513 11:61987976-61987998 CAGCTAAAGCAGTATTAAGAGGG + Intergenic
1083507290 11:63170155-63170177 CAGCAAAAGCAGTATTAAGAGGG + Intronic
1083507290 11:63170155-63170177 CAGCAAAAGCAGTATTAAGAGGG + Intronic
1083984310 11:66201440-66201462 CAGCAAAAGCAGTACCAAGAGGG + Intronic
1083984310 11:66201440-66201462 CAGCAAAAGCAGTACCAAGAGGG + Intronic
1084979087 11:72819370-72819392 CTCTGAAAGCTGTATGGAGAAGG - Intronic
1084979087 11:72819370-72819392 CTCTGAAAGCTGTATGGAGAAGG - Intronic
1085194025 11:74656227-74656249 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1085194025 11:74656227-74656249 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1085426315 11:76407721-76407743 TTGTAAAAGTAGTAAAAAGAAGG + Exonic
1085426315 11:76407721-76407743 TTGTAAAAGTAGTAAAAAGAAGG + Exonic
1085468198 11:76738339-76738361 CTGAAAAAGCAGTGTCAGGAAGG + Intergenic
1085468198 11:76738339-76738361 CTGAAAAAGCAGTGTCAGGAAGG + Intergenic
1086022981 11:82254703-82254725 GTGTTAAAGCAGAATGGAGATGG + Intergenic
1086022981 11:82254703-82254725 GTGTTAAAGCAGAATGGAGATGG + Intergenic
1086044769 11:82519925-82519947 CATTTAAAGCAGTATGTAGAGGG - Intergenic
1086044769 11:82519925-82519947 CATTTAAAGCAGTATGTAGAGGG - Intergenic
1086184899 11:84001934-84001956 CAGCAAAAGCAGTACTAAGAGGG + Intronic
1086184899 11:84001934-84001956 CAGCAAAAGCAGTACTAAGAGGG + Intronic
1086199362 11:84182593-84182615 CAGTAAAAGCAGTGTTTAGAGGG + Intronic
1086199362 11:84182593-84182615 CAGTAAAAGCAGTGTTTAGAGGG + Intronic
1086298482 11:85398268-85398290 CATTTAAAGCAGTTTGAAGAGGG + Intronic
1086298482 11:85398268-85398290 CATTTAAAGCAGTTTGAAGAGGG + Intronic
1086422221 11:86648248-86648270 CAGCTAAAGCAGTATTAAGAGGG + Intronic
1086422221 11:86648248-86648270 CAGCTAAAGCAGTATTAAGAGGG + Intronic
1086547992 11:88020940-88020962 CAACAAAAGCAGTATTAAGAGGG + Intergenic
1086547992 11:88020940-88020962 CAACAAAAGCAGTATTAAGAGGG + Intergenic
1086580203 11:88390798-88390820 CTTTATCAGCAGTATGAAAACGG - Intergenic
1086580203 11:88390798-88390820 CTTTATCAGCAGTATGAAAACGG - Intergenic
1086580818 11:88396259-88396281 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1086580818 11:88396259-88396281 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1086761192 11:90633836-90633858 CTTTAATAGCAGCATGAAAATGG - Intergenic
1086761192 11:90633836-90633858 CTTTAATAGCAGCATGAAAATGG - Intergenic
1086811773 11:91319441-91319463 CTTTTAAAGCAGTGTGTAGAGGG - Intergenic
1086811773 11:91319441-91319463 CTTTTAAAGCAGTGTGTAGAGGG - Intergenic
1086826849 11:91508766-91508788 CTTTATAAGCAGTGTGAAAATGG - Intergenic
1086826849 11:91508766-91508788 CTTTATAAGCAGTGTGAAAATGG - Intergenic
1086850989 11:91808258-91808280 CAGCAAAAGCACTATTAAGAGGG - Intergenic
1086850989 11:91808258-91808280 CAGCAAAAGCACTATTAAGAGGG - Intergenic
1087031583 11:93711253-93711275 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1087031583 11:93711253-93711275 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1087169327 11:95034734-95034756 CAGTAAAAGCAGTACTAACATGG + Intergenic
1087169327 11:95034734-95034756 CAGTAAAAGCAGTACTAACATGG + Intergenic
1087304840 11:96476365-96476387 CAGTAAAAGCAGTGCTAAGAGGG + Intronic
1087304840 11:96476365-96476387 CAGTAAAAGCAGTGCTAAGAGGG + Intronic
1087350356 11:97023554-97023576 CTGCAAAAGCAATACTAAGAGGG + Intergenic
1087350356 11:97023554-97023576 CTGCAAAAGCAATACTAAGAGGG + Intergenic
1087547631 11:99604939-99604961 CATTCAAAGCAGTATGTAGAGGG + Intronic
1087547631 11:99604939-99604961 CATTCAAAGCAGTATGTAGAGGG + Intronic
1087699588 11:101420668-101420690 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1087699588 11:101420668-101420690 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1087719118 11:101641875-101641897 CATTTAAAGCAGTATGTAGATGG + Intronic
1087719118 11:101641875-101641897 CATTTAAAGCAGTATGTAGATGG + Intronic
1087723207 11:101690266-101690288 CTTTAACAGCAGTGTGAAAATGG - Intronic
1087723207 11:101690266-101690288 CTTTAACAGCAGTGTGAAAATGG - Intronic
1088090066 11:106027345-106027367 CTTTATCAGCAGTATGAAAATGG + Intergenic
1088090066 11:106027345-106027367 CTTTATCAGCAGTATGAAAATGG + Intergenic
1088213060 11:107477393-107477415 CTGTAAAATGAGGATGATGATGG - Intergenic
1088213060 11:107477393-107477415 CTGTAAAATGAGGATGATGATGG - Intergenic
1088383109 11:109218859-109218881 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
1088383109 11:109218859-109218881 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
1088419778 11:109632718-109632740 CAGTAAAATCAGTTTTAAGAGGG - Intergenic
1088419778 11:109632718-109632740 CAGTAAAATCAGTTTTAAGAGGG - Intergenic
1089375204 11:117989135-117989157 CTGTAAAGGCAGTGGGGAGAAGG + Intronic
1089375204 11:117989135-117989157 CTGTAAAGGCAGTGGGGAGAAGG + Intronic
1089420393 11:118328662-118328684 CTGCTAAAGCAGTATTTAGAAGG + Intergenic
1089420393 11:118328662-118328684 CTGCTAAAGCAGTATTTAGAAGG + Intergenic
1090317993 11:125813961-125813983 CAGTGAAAGCAGTACTAAGAGGG - Intergenic
1090317993 11:125813961-125813983 CAGTGAAAGCAGTACTAAGAGGG - Intergenic
1090573897 11:128079214-128079236 CAGAAAATGCAGTATTAAGAGGG + Intergenic
1090573897 11:128079214-128079236 CAGAAAATGCAGTATTAAGAGGG + Intergenic
1090576459 11:128110077-128110099 CATTTAAAGCAGTATGTAGAGGG + Intergenic
1090576459 11:128110077-128110099 CATTTAAAGCAGTATGTAGAGGG + Intergenic
1090706464 11:129342071-129342093 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1090706464 11:129342071-129342093 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1090930105 11:131289998-131290020 CTGTACAAGCAGTAAGAAAAAGG - Intergenic
1090930105 11:131289998-131290020 CTGTACAAGCAGTAAGAAAAAGG - Intergenic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1091505319 12:1061920-1061942 CAGCAAAAGCAGTACAAAGAGGG - Intronic
1091505319 12:1061920-1061942 CAGCAAAAGCAGTACAAAGAGGG - Intronic
1092349927 12:7747979-7748001 CTTTATCAGCAGTATGAAAACGG + Intronic
1092349927 12:7747979-7748001 CTTTATCAGCAGTATGAAAACGG + Intronic
1092442902 12:8524850-8524872 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
1092442902 12:8524850-8524872 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
1092509416 12:9139077-9139099 CAGCAAAAGCACTATTAAGAAGG - Intergenic
1092509416 12:9139077-9139099 CAGCAAAAGCACTATTAAGAAGG - Intergenic
1092735946 12:11583042-11583064 GTGTAAAAGCAGCAGCAAGATGG - Intergenic
1092735946 12:11583042-11583064 GTGTAAAAGCAGCAGCAAGATGG - Intergenic
1092872522 12:12818658-12818680 CTGTATCAGCAGTGTGAAAAAGG - Intronic
1092872522 12:12818658-12818680 CTGTATCAGCAGTGTGAAAAAGG - Intronic
1093033413 12:14310410-14310432 CAGTGAAAGCAGTACTAAGATGG + Intergenic
1093033413 12:14310410-14310432 CAGTGAAAGCAGTACTAAGATGG + Intergenic
1093339472 12:17954351-17954373 CAGTAAAAGCAGTTTTAAGAAGG + Intergenic
1093339472 12:17954351-17954373 CAGTAAAAGCAGTTTTAAGAAGG + Intergenic
1093344736 12:18026754-18026776 CATTCAAAGCAGTATGTAGAGGG + Intergenic
1093344736 12:18026754-18026776 CATTCAAAGCAGTATGTAGAGGG + Intergenic
1093419720 12:18961338-18961360 CAGTGAAAGCAGTACTAAGAGGG - Intergenic
1093419720 12:18961338-18961360 CAGTGAAAGCAGTACTAAGAGGG - Intergenic
1093538477 12:20251357-20251379 CAGTGAAAGCAGTACTAAGAGGG + Intergenic
1093538477 12:20251357-20251379 CAGTGAAAGCAGTACTAAGAGGG + Intergenic
1093601912 12:21037299-21037321 CAGTAAAAGTAGTACCAAGAGGG - Intronic
1093601912 12:21037299-21037321 CAGTAAAAGTAGTACCAAGAGGG - Intronic
1093620334 12:21281084-21281106 CAGTGAAAGCAGTACTAAGAAGG + Intronic
1093620334 12:21281084-21281106 CAGTGAAAGCAGTACTAAGAAGG + Intronic
1093691251 12:22111959-22111981 GTGCAAAAGCAGTACAAAGAGGG + Intronic
1093691251 12:22111959-22111981 GTGCAAAAGCAGTACAAAGAGGG + Intronic
1093926758 12:24916217-24916239 CTGTAAAACCTGTATGAATTGGG + Intronic
1093926758 12:24916217-24916239 CTGTAAAACCTGTATGAATTGGG + Intronic
1093987793 12:25556527-25556549 CAGAAAAAGCAGGATGAAGCTGG - Intronic
1093987793 12:25556527-25556549 CAGAAAAAGCAGGATGAAGCTGG - Intronic
1094030589 12:26007479-26007501 CTGCAAGAGCAGAATGAAGAAGG + Intronic
1094030589 12:26007479-26007501 CTGCAAGAGCAGAATGAAGAAGG + Intronic
1094271108 12:28616244-28616266 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1094271108 12:28616244-28616266 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1094312079 12:29095153-29095175 CATTTAAAGCAGTATGTAGAGGG + Intergenic
1094312079 12:29095153-29095175 CATTTAAAGCAGTATGTAGAGGG + Intergenic
1094440796 12:30474082-30474104 CAGCAAAAGCAGTATTAAAAGGG + Intergenic
1094440796 12:30474082-30474104 CAGCAAAAGCAGTATTAAAAGGG + Intergenic
1094575775 12:31683773-31683795 CTGTATCAGCAGTGTGAAAACGG + Intronic
1094575775 12:31683773-31683795 CTGTATCAGCAGTGTGAAAACGG + Intronic
1094655410 12:32414932-32414954 CAGTGAAAGCAGTACTAAGAAGG - Intronic
1094655410 12:32414932-32414954 CAGTGAAAGCAGTACTAAGAAGG - Intronic
1094786753 12:33858170-33858192 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1094786753 12:33858170-33858192 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1095212937 12:39514552-39514574 CAGTGAAAGCAGTACTAAGAGGG + Intergenic
1095212937 12:39514552-39514574 CAGTGAAAGCAGTACTAAGAGGG + Intergenic
1095227874 12:39698830-39698852 CAGCAAAAGCAGTACTAAGAGGG + Intronic
1095227874 12:39698830-39698852 CAGCAAAAGCAGTACTAAGAGGG + Intronic
1095510055 12:42941612-42941634 CAGTCAAAGCAGTATTAAGAGGG - Intergenic
1095510055 12:42941612-42941634 CAGTCAAAGCAGTATTAAGAGGG - Intergenic
1095899238 12:47310706-47310728 CAGCAAAAGCAGTAGTAAGAGGG + Intergenic
1095899238 12:47310706-47310728 CAGCAAAAGCAGTAGTAAGAGGG + Intergenic
1096563911 12:52459797-52459819 CAGCAAAGGCAGTATTAAGAAGG - Intergenic
1096563911 12:52459797-52459819 CAGCAAAGGCAGTATTAAGAAGG - Intergenic
1096930674 12:55205199-55205221 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1096930674 12:55205199-55205221 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1097139746 12:56890891-56890913 CATTTAAAGCAGTATGTAGAGGG + Intergenic
1097139746 12:56890891-56890913 CATTTAAAGCAGTATGTAGAGGG + Intergenic
1097314722 12:58159707-58159729 CTTTATAAGCAGTGTGAAAATGG + Intergenic
1097314722 12:58159707-58159729 CTTTATAAGCAGTGTGAAAATGG + Intergenic
1097410337 12:59244784-59244806 CAGCTAAAGCAGTATTAAGAAGG + Intergenic
1097410337 12:59244784-59244806 CAGCTAAAGCAGTATTAAGAAGG + Intergenic
1097410424 12:59245960-59245982 CAGCTAAAGCAGTATTAAGAAGG - Intergenic
1097410424 12:59245960-59245982 CAGCTAAAGCAGTATTAAGAAGG - Intergenic
1097580844 12:61454561-61454583 CTGTATCAGCAGTGTGAAAATGG + Intergenic
1097580844 12:61454561-61454583 CTGTATCAGCAGTGTGAAAATGG + Intergenic
1097634931 12:62111138-62111160 CAGTTAAAGCAGTATTTAGAGGG - Intronic
1097634931 12:62111138-62111160 CAGTTAAAGCAGTATTTAGAGGG - Intronic
1097642784 12:62202662-62202684 CAGTTAAAGCAGTATTAAGAGGG - Intronic
1097642784 12:62202662-62202684 CAGTTAAAGCAGTATTAAGAGGG - Intronic
1097645363 12:62230359-62230381 TAGTAAAAGCAGTACTAAGAGGG - Intronic
1097645363 12:62230359-62230381 TAGTAAAAGCAGTACTAAGAGGG - Intronic
1097654116 12:62340539-62340561 CTGCTAAAGCAGTGTGTAGAGGG - Intronic
1097654116 12:62340539-62340561 CTGCTAAAGCAGTGTGTAGAGGG - Intronic
1097714412 12:62951281-62951303 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1097714412 12:62951281-62951303 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1097770231 12:63575309-63575331 CAGCAAAAGCAGTATTAAGAGGG + Intronic
1097770231 12:63575309-63575331 CAGCAAAAGCAGTATTAAGAGGG + Intronic
1097791586 12:63821332-63821354 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1097791586 12:63821332-63821354 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1097898220 12:64847528-64847550 CAGTGAAAGCAGTACTAAGAGGG - Intronic
1097898220 12:64847528-64847550 CAGTGAAAGCAGTACTAAGAGGG - Intronic
1097924034 12:65108109-65108131 TTATAATTGCAGTATGAAGAAGG - Intronic
1097924034 12:65108109-65108131 TTATAATTGCAGTATGAAGAAGG - Intronic
1097977520 12:65703429-65703451 CAGCAAAAGCAGTATTAAGATGG - Intergenic
1097977520 12:65703429-65703451 CAGCAAAAGCAGTATTAAGATGG - Intergenic
1098115946 12:67176791-67176813 CTTTTAAAGCAGTGTGTAGAGGG + Intergenic
1098115946 12:67176791-67176813 CTTTTAAAGCAGTGTGTAGAGGG + Intergenic
1098207575 12:68129009-68129031 CAGTAAAAGCAGTACTAAGAGGG - Intergenic
1098207575 12:68129009-68129031 CAGTAAAAGCAGTACTAAGAGGG - Intergenic
1098373699 12:69789036-69789058 CAGAAAAAGCAGTACTAAGAGGG + Intronic
1098373699 12:69789036-69789058 CAGAAAAAGCAGTACTAAGAGGG + Intronic
1098514759 12:71361538-71361560 CTGCAAAAGCAGTTTTAAGAAGG + Intronic
1098514759 12:71361538-71361560 CTGCAAAAGCAGTTTTAAGAAGG + Intronic
1098559971 12:71861834-71861856 CAGCAAAAGTAGTATTAAGAAGG - Intronic
1098559971 12:71861834-71861856 CAGCAAAAGTAGTATTAAGAAGG - Intronic
1098582657 12:72119188-72119210 CGGCAAAAGCAGTACTAAGAGGG - Intronic
1098582657 12:72119188-72119210 CGGCAAAAGCAGTACTAAGAGGG - Intronic
1098621734 12:72609245-72609267 ATGTAAAAGCATTATGTACAAGG + Intronic
1098621734 12:72609245-72609267 ATGTAAAAGCATTATGTACAAGG + Intronic
1098624546 12:72647318-72647340 CAGTAAAAGCAGTACTAAGAGGG + Intronic
1098624546 12:72647318-72647340 CAGTAAAAGCAGTACTAAGAGGG + Intronic
1098699705 12:73608670-73608692 CATTGAAAGCAGTATGTAGAGGG + Intergenic
1098699705 12:73608670-73608692 CATTGAAAGCAGTATGTAGAGGG + Intergenic
1098734995 12:74090458-74090480 CTGCAACAGCAGTACTAAGAAGG - Intergenic
1098734995 12:74090458-74090480 CTGCAACAGCAGTACTAAGAAGG - Intergenic
1098795724 12:74886825-74886847 CTTTATAAGCAGTGTGAAAATGG - Intergenic
1098795724 12:74886825-74886847 CTTTATAAGCAGTGTGAAAATGG - Intergenic
1098830277 12:75352985-75353007 CAGCTAAAGCAGTATTAAGAGGG + Intronic
1098830277 12:75352985-75353007 CAGCTAAAGCAGTATTAAGAGGG + Intronic
1098856823 12:75662466-75662488 CTGTATTAGCAGTGTGAAAATGG - Intergenic
1098856823 12:75662466-75662488 CTGTATTAGCAGTGTGAAAATGG - Intergenic
1099110887 12:78559433-78559455 CTGTTAAAGCAGGCTGAAAATGG + Intergenic
1099110887 12:78559433-78559455 CTGTTAAAGCAGGCTGAAAATGG + Intergenic
1099388083 12:82042867-82042889 CAGCAAAAGCAGTACCAAGAAGG + Intergenic
1099388083 12:82042867-82042889 CAGCAAAAGCAGTACCAAGAAGG + Intergenic
1099512195 12:83552265-83552287 CTTTCAAAGCAGTGTGTAGAGGG - Intergenic
1099512195 12:83552265-83552287 CTTTCAAAGCAGTGTGTAGAGGG - Intergenic
1099732469 12:86523241-86523263 CAGCAAAGGCAGTATTAAGAGGG - Intronic
1099732469 12:86523241-86523263 CAGCAAAGGCAGTATTAAGAGGG - Intronic
1099839343 12:87946168-87946190 CATTTAAAGCAGTATGTAGAGGG + Intergenic
1099839343 12:87946168-87946190 CATTTAAAGCAGTATGTAGAGGG + Intergenic
1099841500 12:87972915-87972937 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1099841500 12:87972915-87972937 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1099992549 12:89740293-89740315 CAGCAAAAGCAGTACTAAGAAGG + Intergenic
1099992549 12:89740293-89740315 CAGCAAAAGCAGTACTAAGAAGG + Intergenic
1100012867 12:89974582-89974604 CTGTAAAAACAGTCTCAGGAAGG - Intergenic
1100012867 12:89974582-89974604 CTGTAAAAACAGTCTCAGGAAGG - Intergenic
1100091466 12:90977015-90977037 CTTTATCAGCAGTATGAAAATGG + Intronic
1100091466 12:90977015-90977037 CTTTATCAGCAGTATGAAAATGG + Intronic
1100289682 12:93201933-93201955 ATGTGAAAGCAGTCTTAAGAAGG - Intergenic
1100289682 12:93201933-93201955 ATGTGAAAGCAGTCTTAAGAAGG - Intergenic
1100740324 12:97584374-97584396 CAGTTAAAGCAGTGTGTAGAGGG + Intergenic
1100740324 12:97584374-97584396 CAGTTAAAGCAGTGTGTAGAGGG + Intergenic
1100908061 12:99324280-99324302 CTGTAAAATTAGTATTAAAATGG - Intronic
1100908061 12:99324280-99324302 CTGTAAAATTAGTATTAAAATGG - Intronic
1100996424 12:100305494-100305516 CAGCTAAAGCAGTATGTAGAGGG + Intronic
1100996424 12:100305494-100305516 CAGCTAAAGCAGTATGTAGAGGG + Intronic
1101025856 12:100605639-100605661 CAGTGAAAGCAGTCTTAAGAGGG - Intronic
1101025856 12:100605639-100605661 CAGTGAAAGCAGTCTTAAGAGGG - Intronic
1101226982 12:102698074-102698096 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1101226982 12:102698074-102698096 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1101401486 12:104391716-104391738 CATTAAAAGCAGTGTGTAGAGGG - Intergenic
1101401486 12:104391716-104391738 CATTAAAAGCAGTGTGTAGAGGG - Intergenic
1102528828 12:113531405-113531427 CTGTATCAGCAGTGTGAAAATGG + Intergenic
1102528828 12:113531405-113531427 CTGTATCAGCAGTGTGAAAATGG + Intergenic
1103677758 12:122669970-122669992 CTCTAACAGCACTATGAAGGAGG - Intergenic
1103677758 12:122669970-122669992 CTCTAACAGCACTATGAAGGAGG - Intergenic
1104128915 12:125873900-125873922 CTTTATCAGCAGTGTGAAGATGG + Intergenic
1104128915 12:125873900-125873922 CTTTATCAGCAGTGTGAAGATGG + Intergenic
1104838013 12:131804459-131804481 CTGCAAAAGCAAGATGAAGCTGG - Intergenic
1104838013 12:131804459-131804481 CTGCAAAAGCAAGATGAAGCTGG - Intergenic
1104924502 12:132306833-132306855 CCGTAAAAGCAGAATGACCACGG - Intronic
1104924502 12:132306833-132306855 CCGTAAAAGCAGAATGACCACGG - Intronic
1105068896 12:133221959-133221981 CTGTAAAACAAGCATTAAGATGG + Intronic
1105068896 12:133221959-133221981 CTGTAAAACAAGCATTAAGATGG + Intronic
1105648680 13:22349046-22349068 CATTCAAAGCAGTATGTAGAGGG + Intergenic
1105648680 13:22349046-22349068 CATTCAAAGCAGTATGTAGAGGG + Intergenic
1106036409 13:26049332-26049354 GTTTAAAAGTAGCATGAAGAAGG + Intronic
1106036409 13:26049332-26049354 GTTTAAAAGTAGCATGAAGAAGG + Intronic
1106273391 13:28176973-28176995 CTGAAAAACCAGGAAGAAGAAGG + Intronic
1106273391 13:28176973-28176995 CTGAAAAACCAGGAAGAAGAAGG + Intronic
1106367412 13:29095402-29095424 CTGTCAACCCAGAATGAAGAGGG - Intronic
1106367412 13:29095402-29095424 CTGTCAACCCAGAATGAAGAGGG - Intronic
1107019861 13:35740333-35740355 CTTTATCAGCAGTATGAAAATGG + Intergenic
1107019861 13:35740333-35740355 CTTTATCAGCAGTATGAAAATGG + Intergenic
1107155319 13:37159739-37159761 CAGCAAAAGCAGTATTAAGAGGG - Intergenic
1107155319 13:37159739-37159761 CAGCAAAAGCAGTATTAAGAGGG - Intergenic
1107200836 13:37714813-37714835 TTTGAAAAGCATTATGAAGAAGG - Intronic
1107200836 13:37714813-37714835 TTTGAAAAGCATTATGAAGAAGG - Intronic
1107226031 13:38048379-38048401 CAGTAAAAACAGCATTAAGAGGG + Intergenic
1107226031 13:38048379-38048401 CAGTAAAAACAGCATTAAGAGGG + Intergenic
1107344148 13:39441057-39441079 CTTTAACAGCAGCATGAAAATGG + Intronic
1107344148 13:39441057-39441079 CTTTAACAGCAGCATGAAAATGG + Intronic
1107383774 13:39885941-39885963 CAGCAAAAGCAGTATTAAGAGGG + Intergenic
1107383774 13:39885941-39885963 CAGCAAAAGCAGTATTAAGAGGG + Intergenic
1107487078 13:40838709-40838731 CATTTAAAGCAGTATGTAGAGGG + Intergenic
1107487078 13:40838709-40838731 CATTTAAAGCAGTATGTAGAGGG + Intergenic
1107551860 13:41483945-41483967 CAGCAAAAGCAGTACTAAGAAGG - Intergenic
1107551860 13:41483945-41483967 CAGCAAAAGCAGTACTAAGAAGG - Intergenic
1107771794 13:43794627-43794649 CTGCAGAGGCAGTATGTAGATGG - Intergenic
1107771794 13:43794627-43794649 CTGCAGAGGCAGTATGTAGATGG - Intergenic
1108138286 13:47389372-47389394 CAGTGAAAGCAGTATTAACAGGG + Intergenic
1108138286 13:47389372-47389394 CAGTGAAAGCAGTATTAACAGGG + Intergenic
1108199654 13:48030485-48030507 CTTTATAAGCAGTGTGAAAATGG + Intergenic
1108199654 13:48030485-48030507 CTTTATAAGCAGTGTGAAAATGG + Intergenic
1108304899 13:49121335-49121357 CATTTAAAGCAGTATGTAGAGGG + Intronic
1108304899 13:49121335-49121357 CATTTAAAGCAGTATGTAGAGGG + Intronic
1108366211 13:49716736-49716758 TTTTAAAAGTAGTATGATGATGG - Intronic
1108366211 13:49716736-49716758 TTTTAAAAGTAGTATGATGATGG - Intronic
1108504757 13:51102715-51102737 CTTTAATAGCAGTGTGAACATGG - Intergenic
1108504757 13:51102715-51102737 CTTTAATAGCAGTGTGAACATGG - Intergenic
1108985781 13:56585450-56585472 CTTTAACAGCAGCATGAAAATGG - Intergenic
1108985781 13:56585450-56585472 CTTTAACAGCAGCATGAAAATGG - Intergenic
1109265663 13:60197229-60197251 CAATAAAAGCAGTACTAAGAGGG - Intergenic
1109265663 13:60197229-60197251 CAATAAAAGCAGTACTAAGAGGG - Intergenic
1109336359 13:60999909-60999931 CAGTGAAAGCAGTGTCAAGAGGG - Intergenic
1109336359 13:60999909-60999931 CAGTGAAAGCAGTGTCAAGAGGG - Intergenic
1109554370 13:63952269-63952291 CAGAAAAAGCAATATTAAGAGGG - Intergenic
1109554370 13:63952269-63952291 CAGAAAAAGCAATATTAAGAGGG - Intergenic
1109659401 13:65438371-65438393 CATTTAAAGCAGTATGTAGAGGG + Intergenic
1109659401 13:65438371-65438393 CATTTAAAGCAGTATGTAGAGGG + Intergenic
1109697397 13:65978162-65978184 CTGTGAAAGCAGTCAGGAGAGGG + Intergenic
1109697397 13:65978162-65978184 CTGTGAAAGCAGTCAGGAGAGGG + Intergenic
1109721232 13:66278426-66278448 CTTTATCAGCAGTATGAAAATGG - Intergenic
1109721232 13:66278426-66278448 CTTTATCAGCAGTATGAAAATGG - Intergenic
1109905897 13:68841250-68841272 CGGCAAAAGCAGTACTAAGAGGG + Intergenic
1109905897 13:68841250-68841272 CGGCAAAAGCAGTACTAAGAGGG + Intergenic
1110171294 13:72503843-72503865 CTGTAAAATCAGGATGATAATGG - Intergenic
1110171294 13:72503843-72503865 CTGTAAAATCAGGATGATAATGG - Intergenic
1110486857 13:76055728-76055750 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1110486857 13:76055728-76055750 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1110491542 13:76115188-76115210 CAGCAAAAGCAGTACAAAGAGGG + Intergenic
1110491542 13:76115188-76115210 CAGCAAAAGCAGTACAAAGAGGG + Intergenic
1110501549 13:76234051-76234073 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1110501549 13:76234051-76234073 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1110605676 13:77429561-77429583 CTTTACCAGCAGCATGAAGAAGG - Intergenic
1110605676 13:77429561-77429583 CTTTACCAGCAGCATGAAGAAGG - Intergenic
1110970417 13:81754295-81754317 CTGTAAAAGCAGCAAGAATGGGG + Intergenic
1110970417 13:81754295-81754317 CTGTAAAAGCAGCAAGAATGGGG + Intergenic
1110995457 13:82102302-82102324 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1110995457 13:82102302-82102324 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1111001118 13:82183711-82183733 CTCTAAAACCACTTTGAAGAAGG - Intergenic
1111001118 13:82183711-82183733 CTCTAAAACCACTTTGAAGAAGG - Intergenic
1111030769 13:82594568-82594590 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1111030769 13:82594568-82594590 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1111121668 13:83859638-83859660 CTTAAAAAGGAGTATAAAGAAGG - Intergenic
1111121668 13:83859638-83859660 CTTAAAAAGGAGTATAAAGAAGG - Intergenic
1111356076 13:87104066-87104088 CTGCAAAAGCAGTACTAAGAGGG - Intergenic
1111356076 13:87104066-87104088 CTGCAAAAGCAGTACTAAGAGGG - Intergenic
1111471889 13:88694731-88694753 CTTTATCAGCAGTATGAAAACGG - Intergenic
1111471889 13:88694731-88694753 CTTTATCAGCAGTATGAAAACGG - Intergenic
1111617817 13:90683412-90683434 CTTTATCAGCAGTATGAAAATGG + Intergenic
1111617817 13:90683412-90683434 CTTTATCAGCAGTATGAAAATGG + Intergenic
1111779175 13:92699579-92699601 CATTTAAAGCAGTATGTAGAGGG - Intronic
1111779175 13:92699579-92699601 CATTTAAAGCAGTATGTAGAGGG - Intronic
1112033840 13:95479949-95479971 CTTTATTAGCAGTGTGAAGATGG - Intronic
1112033840 13:95479949-95479971 CTTTATTAGCAGTGTGAAGATGG - Intronic
1112312879 13:98335216-98335238 CTTTAACAGCAGTGTGAAAATGG - Intronic
1112312879 13:98335216-98335238 CTTTAACAGCAGTGTGAAAATGG - Intronic
1112411681 13:99169822-99169844 CATTTAAAGCAGTATGTAGAGGG - Intergenic
1112411681 13:99169822-99169844 CATTTAAAGCAGTATGTAGAGGG - Intergenic
1112820794 13:103332610-103332632 CTTTAACAGCAGTGTGAAAACGG - Intergenic
1112820794 13:103332610-103332632 CTTTAACAGCAGTGTGAAAACGG - Intergenic
1112913524 13:104519565-104519587 CTGATAAAGCAGTAGTAAGAGGG - Intergenic
1112913524 13:104519565-104519587 CTGATAAAGCAGTAGTAAGAGGG - Intergenic
1113137318 13:107106949-107106971 CAGTAAAAGCAGTATTCAGAGGG - Intergenic
1113137318 13:107106949-107106971 CAGTAAAAGCAGTATTCAGAGGG - Intergenic
1113703448 13:112407207-112407229 CATTTAAAGCAGTATGTAGAGGG + Intronic
1113703448 13:112407207-112407229 CATTTAAAGCAGTATGTAGAGGG + Intronic
1114818834 14:25991827-25991849 CTCTATCAGCAGTATGAAAATGG - Intergenic
1114818834 14:25991827-25991849 CTCTATCAGCAGTATGAAAATGG - Intergenic
1115007817 14:28508278-28508300 CATTTAAAGCAGTATGTAGAGGG - Intergenic
1115007817 14:28508278-28508300 CATTTAAAGCAGTATGTAGAGGG - Intergenic
1115134608 14:30094078-30094100 CTTTATAAGCAGCATGAAAATGG - Intronic
1115134608 14:30094078-30094100 CTTTATAAGCAGCATGAAAATGG - Intronic
1115278712 14:31637240-31637262 CATTCAAAGCAGTATGTAGAGGG - Intronic
1115278712 14:31637240-31637262 CATTCAAAGCAGTATGTAGAGGG - Intronic
1115279379 14:31644301-31644323 CAGGAAAAACAGTATGAAGATGG - Intronic
1115279379 14:31644301-31644323 CAGGAAAAACAGTATGAAGATGG - Intronic
1115381260 14:32742517-32742539 CAGTAAAAGCAGTACTAAGAGGG - Intronic
1115381260 14:32742517-32742539 CAGTAAAAGCAGTACTAAGAGGG - Intronic
1115390942 14:32854312-32854334 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1115390942 14:32854312-32854334 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1115514632 14:34173327-34173349 CTGGAAAGGTGGTATGAAGATGG - Intronic
1115514632 14:34173327-34173349 CTGGAAAGGTGGTATGAAGATGG - Intronic
1115673250 14:35640076-35640098 CAGTGAAAGCAGTACTAAGAGGG + Intronic
1115673250 14:35640076-35640098 CAGTGAAAGCAGTACTAAGAGGG + Intronic
1115723443 14:36187522-36187544 CTTTCAAAGCAGTGTGCAGAGGG + Intergenic
1115723443 14:36187522-36187544 CTTTCAAAGCAGTGTGCAGAGGG + Intergenic
1115734834 14:36314682-36314704 CTGGAAAAGCAGAAGTAAGAAGG - Exonic
1115734834 14:36314682-36314704 CTGGAAAAGCAGAAGTAAGAAGG - Exonic
1116027240 14:39530056-39530078 TGGGAAAAGCAGTATGAAGAGGG - Intergenic
1116027240 14:39530056-39530078 TGGGAAAAGCAGTATGAAGAGGG - Intergenic
1116032225 14:39587423-39587445 CATTCAAAGCAGTATGTAGAAGG - Intergenic
1116032225 14:39587423-39587445 CATTCAAAGCAGTATGTAGAAGG - Intergenic
1116058207 14:39889530-39889552 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1116058207 14:39889530-39889552 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1116061061 14:39924662-39924684 CATTCAAAGCAGTGTGAAGAGGG - Intergenic
1116061061 14:39924662-39924684 CATTCAAAGCAGTGTGAAGAGGG - Intergenic
1116164018 14:41310752-41310774 CTTTATCAGCAGTATGAAAATGG + Intergenic
1116164018 14:41310752-41310774 CTTTATCAGCAGTATGAAAATGG + Intergenic
1116284659 14:42956382-42956404 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1116284659 14:42956382-42956404 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1116420705 14:44728511-44728533 CCTGAAAAGCAGTATGAAAAAGG - Intergenic
1116420705 14:44728511-44728533 CCTGAAAAGCAGTATGAAAAAGG - Intergenic
1116450331 14:45057599-45057621 CAGCAAAAGCAGTGTTAAGAGGG - Intronic
1116450331 14:45057599-45057621 CAGCAAAAGCAGTGTTAAGAGGG - Intronic
1116484652 14:45433064-45433086 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
1116484652 14:45433064-45433086 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
1116768431 14:49099558-49099580 CATTAAAAGCAGTGTGTAGAGGG + Intergenic
1116768431 14:49099558-49099580 CATTAAAAGCAGTGTGTAGAGGG + Intergenic
1116959054 14:50951666-50951688 TGGTAAAAGCATTATTAAGATGG + Intergenic
1116959054 14:50951666-50951688 TGGTAAAAGCATTATTAAGATGG + Intergenic
1116986356 14:51223923-51223945 CTTTAAGAGCAGTGTGAAAACGG - Intergenic
1116986356 14:51223923-51223945 CTTTAAGAGCAGTGTGAAAACGG - Intergenic
1117109303 14:52432821-52432843 CTTTAAAAAAAGTATGAATAGGG + Intronic
1117109303 14:52432821-52432843 CTTTAAAAAAAGTATGAATAGGG + Intronic
1117184284 14:53224192-53224214 CAGCAAAAGCAGTATTAAGGGGG - Intergenic
1117184284 14:53224192-53224214 CAGCAAAAGCAGTATTAAGGGGG - Intergenic
1117635895 14:57743062-57743084 CATTTAAAGCAGTATGCAGAGGG + Intronic
1117635895 14:57743062-57743084 CATTTAAAGCAGTATGCAGAGGG + Intronic
1117639178 14:57778962-57778984 CTGATAAAGCAGTGTTAAGAGGG + Intronic
1117639178 14:57778962-57778984 CTGATAAAGCAGTGTTAAGAGGG + Intronic
1117751327 14:58926712-58926734 CAGCAAAAGCAGTGTTAAGAAGG + Intergenic
1117751327 14:58926712-58926734 CAGCAAAAGCAGTGTTAAGAAGG + Intergenic
1117808160 14:59516157-59516179 CATTCAAAGCAGTATGTAGAGGG + Intronic
1117808160 14:59516157-59516179 CATTCAAAGCAGTATGTAGAGGG + Intronic
1117811756 14:59554455-59554477 CATTTAAAGCAGTATGTAGAGGG + Intronic
1117811756 14:59554455-59554477 CATTTAAAGCAGTATGTAGAGGG + Intronic
1118528361 14:66672093-66672115 CAGTAAAAGCAGTGTTTAGAGGG - Intronic
1118528361 14:66672093-66672115 CAGTAAAAGCAGTGTTTAGAGGG - Intronic
1118538715 14:66798963-66798985 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1118538715 14:66798963-66798985 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1118793692 14:69119941-69119963 CTGTAAAAGCATTCAGAATAGGG + Intronic
1118793692 14:69119941-69119963 CTGTAAAAGCATTCAGAATAGGG + Intronic
1118798090 14:69162850-69162872 CAGTAAAAACAGTACTAAGAGGG + Intergenic
1118798090 14:69162850-69162872 CAGTAAAAACAGTACTAAGAGGG + Intergenic
1119019042 14:71090591-71090613 CTCTAAAACTAGTCTGAAGATGG - Intronic
1119019042 14:71090591-71090613 CTCTAAAACTAGTCTGAAGATGG - Intronic
1119256284 14:73200741-73200763 CTGGAAAAGCAGTTTCAAGAAGG + Intronic
1119256284 14:73200741-73200763 CTGGAAAAGCAGTTTCAAGAAGG + Intronic
1119460961 14:74803225-74803247 CTGTTCAGGCAGTATGAAAAGGG + Intronic
1119460961 14:74803225-74803247 CTGTTCAGGCAGTATGAAAAGGG + Intronic
1120113343 14:80584050-80584072 TTTTTAAATCAGTATGAAGAAGG - Intronic
1120113343 14:80584050-80584072 TTTTTAAATCAGTATGAAGAAGG - Intronic
1120337310 14:83173410-83173432 TAGTAAAATCTGTATGAAGAAGG + Intergenic
1120337310 14:83173410-83173432 TAGTAAAATCTGTATGAAGAAGG + Intergenic
1120351163 14:83360178-83360200 ATGTAAAAACAGTATAAAGATGG - Intergenic
1120351163 14:83360178-83360200 ATGTAAAAACAGTATAAAGATGG - Intergenic
1120591003 14:86373067-86373089 CTGTGAAAGCAGCTTGGAGAGGG + Intergenic
1120591003 14:86373067-86373089 CTGTGAAAGCAGCTTGGAGAGGG + Intergenic
1121376985 14:93420946-93420968 TAGCAAAAGCAGTATGAAGATGG + Intronic
1121376985 14:93420946-93420968 TAGCAAAAGCAGTATGAAGATGG + Intronic
1121430361 14:93882137-93882159 CTTTATCAGCAGTATGAAAATGG - Intergenic
1121430361 14:93882137-93882159 CTTTATCAGCAGTATGAAAATGG - Intergenic
1122756634 14:103985512-103985534 CTTTATCAGCAGCATGAAGATGG + Intronic
1122756634 14:103985512-103985534 CTTTATCAGCAGCATGAAGATGG + Intronic
1123111758 14:105873369-105873391 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1123111758 14:105873369-105873391 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1123411007 15:20059558-20059580 CTGCAAAAGCAGTACTAAGAGGG + Intergenic
1123411007 15:20059558-20059580 CTGCAAAAGCAGTACTAAGAGGG + Intergenic
1123520338 15:21066246-21066268 CTGCAAAAGCAGTACTAAGAGGG + Intergenic
1123520338 15:21066246-21066268 CTGCAAAAGCAGTACTAAGAGGG + Intergenic
1123956016 15:25335514-25335536 CTGTAAGGGCAGTATAAAGAAGG + Intronic
1123956016 15:25335514-25335536 CTGTAAGGGCAGTATAAAGAAGG + Intronic
1124586183 15:31010423-31010445 CAGTAAAAGCAGTATTCAGAAGG - Intronic
1124586183 15:31010423-31010445 CAGTAAAAGCAGTATTCAGAAGG - Intronic
1125565410 15:40674129-40674151 CAGTAAAAGCAGTACTAAGAGGG - Intergenic
1125565410 15:40674129-40674151 CAGTAAAAGCAGTACTAAGAGGG - Intergenic
1126126595 15:45299542-45299564 CTTTATAAGCAGCATGAAAATGG + Intergenic
1126126595 15:45299542-45299564 CTTTATAAGCAGCATGAAAATGG + Intergenic
1126185345 15:45825887-45825909 CCGCAAAAGCAGTAGTAAGAGGG + Intergenic
1126185345 15:45825887-45825909 CCGCAAAAGCAGTAGTAAGAGGG + Intergenic
1126942397 15:53780941-53780963 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
1126942397 15:53780941-53780963 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
1127019018 15:54724464-54724486 CGGTGAAAGTAGTAAGAAGAGGG - Intergenic
1127019018 15:54724464-54724486 CGGTGAAAGTAGTAAGAAGAGGG - Intergenic
1127217529 15:56839558-56839580 CTGTATAAGAACTATGAACATGG - Intronic
1127217529 15:56839558-56839580 CTGTATAAGAACTATGAACATGG - Intronic
1127355622 15:58196383-58196405 CATTAAAAGCAGTGTGTAGAGGG + Intronic
1127355622 15:58196383-58196405 CATTAAAAGCAGTGTGTAGAGGG + Intronic
1127564981 15:60178577-60178599 CTTTCAAAGCAGTATGAGGGGGG + Intergenic
1127564981 15:60178577-60178599 CTTTCAAAGCAGTATGAGGGGGG + Intergenic
1127697683 15:61467803-61467825 CTGTTATAGCTGTATGAACAGGG + Intergenic
1127697683 15:61467803-61467825 CTGTTATAGCTGTATGAACAGGG + Intergenic
1127749490 15:62019440-62019462 CATTAAAAGCAGTGTGTAGAGGG - Intronic
1127749490 15:62019440-62019462 CATTAAAAGCAGTGTGTAGAGGG - Intronic
1128160521 15:65420746-65420768 CTGTAGAAGGAGAATGATGATGG - Intronic
1128160521 15:65420746-65420768 CTGTAGAAGGAGAATGATGATGG - Intronic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1128895585 15:71370433-71370455 CATTTAAAGCAGTATGTAGAGGG - Intronic
1128895585 15:71370433-71370455 CATTTAAAGCAGTATGTAGAGGG - Intronic
1129093806 15:73181930-73181952 CTTTAACAGCAGTGTGAAAATGG - Intronic
1129093806 15:73181930-73181952 CTTTAACAGCAGTGTGAAAATGG - Intronic
1129585646 15:76861771-76861793 CTTTATAAGCAGTATGAAAATGG - Intronic
1129585646 15:76861771-76861793 CTTTATAAGCAGTATGAAAATGG - Intronic
1129991724 15:79970875-79970897 ATGGAAAAGGAGTTTGAAGACGG - Exonic
1129991724 15:79970875-79970897 ATGGAAAAGGAGTTTGAAGACGG - Exonic
1130432624 15:83863604-83863626 CATTCAAAGCAGTATGTAGAGGG + Intronic
1130432624 15:83863604-83863626 CATTCAAAGCAGTATGTAGAGGG + Intronic
1130452887 15:84075069-84075091 CATTTAAAGCAGTATGTAGAGGG + Intergenic
1130452887 15:84075069-84075091 CATTTAAAGCAGTATGTAGAGGG + Intergenic
1130778299 15:87008499-87008521 CTTTATCAGCAGTATGAAAAGGG + Intronic
1130778299 15:87008499-87008521 CTTTATCAGCAGTATGAAAAGGG + Intronic
1130795223 15:87200807-87200829 CTGTGATAGCAGCATGAAGATGG + Intergenic
1130795223 15:87200807-87200829 CTGTGATAGCAGCATGAAGATGG + Intergenic
1130835903 15:87649706-87649728 GTATAAAAGCAGTATGGAGAAGG - Intergenic
1130835903 15:87649706-87649728 GTATAAAAGCAGTATGGAGAAGG - Intergenic
1131942419 15:97582264-97582286 CTGCTAAAGCAGTGTTAAGAGGG - Intergenic
1131942419 15:97582264-97582286 CTGCTAAAGCAGTGTTAAGAGGG - Intergenic
1132124196 15:99206952-99206974 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1132124196 15:99206952-99206974 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1133424681 16:5677828-5677850 GTGTAAAAGTCTTATGAAGATGG + Intergenic
1133424681 16:5677828-5677850 GTGTAAAAGTCTTATGAAGATGG + Intergenic
1133543578 16:6782315-6782337 CAGCAAAAGCAGTACTAAGATGG - Intronic
1133543578 16:6782315-6782337 CAGCAAAAGCAGTACTAAGATGG - Intronic
1133663750 16:7944916-7944938 CTTTCAAAACAGTGTGAAGATGG - Intergenic
1133663750 16:7944916-7944938 CTTTCAAAACAGTGTGAAGATGG - Intergenic
1133693247 16:8236386-8236408 CTTTATTAGCAGTATGAAAATGG - Intergenic
1133693247 16:8236386-8236408 CTTTATTAGCAGTATGAAAATGG - Intergenic
1134349255 16:13421273-13421295 CTTTATCAGCAGTATGAAAACGG - Intergenic
1134349255 16:13421273-13421295 CTTTATCAGCAGTATGAAAACGG - Intergenic
1134987766 16:18669709-18669731 CATTAAAAGCAGCATGTAGAGGG - Intergenic
1134987766 16:18669709-18669731 CATTAAAAGCAGCATGTAGAGGG - Intergenic
1135275874 16:21112353-21112375 CTCTATCAGCAGTATGAAAATGG - Intronic
1135275874 16:21112353-21112375 CTCTATCAGCAGTATGAAAATGG - Intronic
1135865286 16:26095606-26095628 CATTTAAAGCAGTATGTAGAGGG + Intronic
1135865286 16:26095606-26095628 CATTTAAAGCAGTATGTAGAGGG + Intronic
1136770876 16:32839833-32839855 CAGTCAAAGCAGTGTGTAGAGGG - Intergenic
1136770876 16:32839833-32839855 CAGTCAAAGCAGTGTGTAGAGGG - Intergenic
1137000790 16:35228899-35228921 CATTCAAAGCAGTGTGAAGAGGG - Intergenic
1137000790 16:35228899-35228921 CATTCAAAGCAGTGTGAAGAGGG - Intergenic
1137032408 16:35535815-35535837 CAGTCAAAGCAGTGTGTAGAGGG - Intergenic
1137032408 16:35535815-35535837 CAGTCAAAGCAGTGTGTAGAGGG - Intergenic
1137335441 16:47544239-47544261 CACTTAAAGCAGTATGTAGAGGG - Intronic
1137335441 16:47544239-47544261 CACTTAAAGCAGTATGTAGAGGG - Intronic
1137402748 16:48166576-48166598 CGTAAAAAGCAGAATGAAGATGG + Intergenic
1137402748 16:48166576-48166598 CGTAAAAAGCAGAATGAAGATGG + Intergenic
1138078244 16:54063921-54063943 CCTTAAAAGCAGTCAGAAGAAGG - Intronic
1138078244 16:54063921-54063943 CCTTAAAAGCAGTCAGAAGAAGG - Intronic
1140024698 16:71275345-71275367 CTTTAAAAGCACTATAAAGGTGG + Intergenic
1140024698 16:71275345-71275367 CTTTAAAAGCACTATAAAGGTGG + Intergenic
1140178977 16:72695174-72695196 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1140178977 16:72695174-72695196 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1141003963 16:80334985-80335007 CTTTAGGAGCAGGATGAAGATGG - Intergenic
1141003963 16:80334985-80335007 CTTTAGGAGCAGGATGAAGATGG - Intergenic
1141038259 16:80648002-80648024 CAGCTAAAGCAGTATTAAGAGGG + Intronic
1141038259 16:80648002-80648024 CAGCTAAAGCAGTATTAAGAGGG + Intronic
1141191585 16:81828913-81828935 CTGTAAAATCAGAATGCAGTTGG - Intronic
1141191585 16:81828913-81828935 CTGTAAAATCAGAATGCAGTTGG - Intronic
1141234896 16:82206917-82206939 CATTTAAAGCAGTATGTAGAGGG - Intergenic
1141234896 16:82206917-82206939 CATTTAAAGCAGTATGTAGAGGG - Intergenic
1203073300 16_KI270728v1_random:1101946-1101968 CAGTCAAAGCAGTGTGTAGAGGG - Intergenic
1203073300 16_KI270728v1_random:1101946-1101968 CAGTCAAAGCAGTGTGTAGAGGG - Intergenic
1142946068 17:3428312-3428334 CAGCAAAAGCAATATTAAGAGGG + Intergenic
1142946068 17:3428312-3428334 CAGCAAAAGCAATATTAAGAGGG + Intergenic
1143936246 17:10487467-10487489 CTGAAAAAGCAGTTATAAGAGGG - Intergenic
1143936246 17:10487467-10487489 CTGAAAAAGCAGTTATAAGAGGG - Intergenic
1144028820 17:11301851-11301873 CTTTATCAGCAGTATGAAAACGG - Intronic
1144028820 17:11301851-11301873 CTTTATCAGCAGTATGAAAACGG - Intronic
1144673448 17:17146066-17146088 CTGACTAAGCAGTATGAGGACGG + Exonic
1144673448 17:17146066-17146088 CTGACTAAGCAGTATGAGGACGG + Exonic
1144701110 17:17340968-17340990 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1144701110 17:17340968-17340990 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1145069575 17:19792068-19792090 CAGTGAAAGCAGTACTAAGAGGG + Intronic
1145069575 17:19792068-19792090 CAGTGAAAGCAGTACTAAGAGGG + Intronic
1146049529 17:29538184-29538206 CTGCAAAACCAGTATTAATATGG + Intronic
1146049529 17:29538184-29538206 CTGCAAAACCAGTATTAATATGG + Intronic
1146738232 17:35258194-35258216 CTTTAACAGCAGTGTGAAAATGG - Intronic
1146738232 17:35258194-35258216 CTTTAACAGCAGTGTGAAAATGG - Intronic
1146967977 17:37049050-37049072 CTGTAAAAACAGTATGTTTAAGG + Intronic
1146967977 17:37049050-37049072 CTGTAAAAACAGTATGTTTAAGG + Intronic
1149147130 17:53507669-53507691 ATGTGAAAGCAGTACTAAGAGGG + Intergenic
1149147130 17:53507669-53507691 ATGTGAAAGCAGTACTAAGAGGG + Intergenic
1149160179 17:53683984-53684006 CAGCAAAAGCAGTATTTAGAGGG - Intergenic
1149160179 17:53683984-53684006 CAGCAAAAGCAGTATTTAGAGGG - Intergenic
1149191668 17:54070563-54070585 CATTTAAAGCAGTATGTAGAGGG - Intergenic
1149191668 17:54070563-54070585 CATTTAAAGCAGTATGTAGAGGG - Intergenic
1149225247 17:54463046-54463068 CATTAAAAGCAGTGTGTAGAGGG - Intergenic
1149225247 17:54463046-54463068 CATTAAAAGCAGTGTGTAGAGGG - Intergenic
1149235954 17:54591186-54591208 CATTTAAAGCAGTATGTAGATGG - Intergenic
1149235954 17:54591186-54591208 CATTTAAAGCAGTATGTAGATGG - Intergenic
1149573883 17:57697561-57697583 CTTTATCAGCAGTATGAAAATGG - Intergenic
1149573883 17:57697561-57697583 CTTTATCAGCAGTATGAAAATGG - Intergenic
1149951235 17:60989029-60989051 CAGTAAAAGCAGTACTAAGAGGG - Intronic
1149951235 17:60989029-60989051 CAGTAAAAGCAGTACTAAGAGGG - Intronic
1150196162 17:63301929-63301951 CAGCAAAAGCAGTGTTAAGAGGG - Intronic
1150196162 17:63301929-63301951 CAGCAAAAGCAGTGTTAAGAGGG - Intronic
1150897558 17:69231416-69231438 CAGCAAAAGCAGTTTTAAGAGGG - Intronic
1150897558 17:69231416-69231438 CAGCAAAAGCAGTTTTAAGAGGG - Intronic
1150971365 17:70031940-70031962 CTGTATCAGCAGCATGAAAACGG - Intergenic
1150971365 17:70031940-70031962 CTGTATCAGCAGCATGAAAACGG - Intergenic
1151195071 17:72425509-72425531 CTGTATCAGCAGCATGAAAATGG + Intergenic
1151195071 17:72425509-72425531 CTGTATCAGCAGCATGAAAATGG + Intergenic
1153099890 18:1454999-1455021 CAGCAAAAGCAGTACTAAGAAGG + Intergenic
1153099890 18:1454999-1455021 CAGCAAAAGCAGTACTAAGAAGG + Intergenic
1153104781 18:1513943-1513965 CTGTAAAGGAAGCATGAAGCTGG + Intergenic
1153104781 18:1513943-1513965 CTGTAAAGGAAGCATGAAGCTGG + Intergenic
1153173435 18:2343438-2343460 CATTCAAAGCAGTATGTAGAGGG + Intergenic
1153173435 18:2343438-2343460 CATTCAAAGCAGTATGTAGAGGG + Intergenic
1153420109 18:4895559-4895581 CATTTAAAGCAGTATGTAGAGGG + Intergenic
1153420109 18:4895559-4895581 CATTTAAAGCAGTATGTAGAGGG + Intergenic
1153455117 18:5272118-5272140 CTTTATCAGCAGTGTGAAGATGG - Intergenic
1153455117 18:5272118-5272140 CTTTATCAGCAGTGTGAAGATGG - Intergenic
1153593778 18:6702780-6702802 CATTTAAAGCAGTATGTAGAGGG + Intergenic
1153593778 18:6702780-6702802 CATTTAAAGCAGTATGTAGAGGG + Intergenic
1154229234 18:12539473-12539495 CTTTATCAGCAGTATGAAAAAGG + Intronic
1154229234 18:12539473-12539495 CTTTATCAGCAGTATGAAAAAGG + Intronic
1155011419 18:21782459-21782481 CAGAAAAAGCAGTAGTAAGAGGG - Intronic
1155011419 18:21782459-21782481 CAGAAAAAGCAGTAGTAAGAGGG - Intronic
1155178996 18:23327038-23327060 CATTTAAAGCAGTATGTAGAGGG + Intronic
1155178996 18:23327038-23327060 CATTTAAAGCAGTATGTAGAGGG + Intronic
1155534180 18:26798883-26798905 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1155534180 18:26798883-26798905 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1155610621 18:27663435-27663457 CTTTATCAGCAGCATGAAGAAGG - Intergenic
1155610621 18:27663435-27663457 CTTTATCAGCAGCATGAAGAAGG - Intergenic
1155724775 18:29067078-29067100 CTGGTAAAGCAGCATGAGGATGG - Intergenic
1155724775 18:29067078-29067100 CTGGTAAAGCAGCATGAGGATGG - Intergenic
1155731824 18:29169356-29169378 CAGTAAAAGCAATACTAAGAGGG - Intergenic
1155731824 18:29169356-29169378 CAGTAAAAGCAATACTAAGAGGG - Intergenic
1156265736 18:35487311-35487333 CTGTATCAGCAGCATGAAAATGG - Intronic
1156265736 18:35487311-35487333 CTGTATCAGCAGCATGAAAATGG - Intronic
1156353278 18:36319976-36319998 CATTTAAAGCAGTATGTAGAGGG + Intronic
1156353278 18:36319976-36319998 CATTTAAAGCAGTATGTAGAGGG + Intronic
1156647117 18:39178156-39178178 CTGTAAAACCAGCAAGAATAGGG + Intergenic
1156647117 18:39178156-39178178 CTGTAAAACCAGCAAGAATAGGG + Intergenic
1156673434 18:39498750-39498772 CTTTATAAGCAGCATGAATATGG - Intergenic
1156673434 18:39498750-39498772 CTTTATAAGCAGCATGAATATGG - Intergenic
1156738109 18:40288267-40288289 CAGCAAAAGCACTATTAAGATGG + Intergenic
1156738109 18:40288267-40288289 CAGCAAAAGCACTATTAAGATGG + Intergenic
1156965462 18:43086037-43086059 CTTTATCAGCAGTGTGAAGATGG + Intronic
1156965462 18:43086037-43086059 CTTTATCAGCAGTGTGAAGATGG + Intronic
1157022469 18:43802547-43802569 CAGCAAAAGCAGTAATAAGAGGG - Intergenic
1157022469 18:43802547-43802569 CAGCAAAAGCAGTAATAAGAGGG - Intergenic
1157074010 18:44444992-44445014 CATTAAAAGCAGTGTGTAGAGGG + Intergenic
1157074010 18:44444992-44445014 CATTAAAAGCAGTGTGTAGAGGG + Intergenic
1157379347 18:47197700-47197722 CAGGAAAAGCAGTACTAAGAGGG + Intergenic
1157379347 18:47197700-47197722 CAGGAAAAGCAGTACTAAGAGGG + Intergenic
1157536279 18:48460312-48460334 CTTTATCAGCAGTATGAAAATGG + Intergenic
1157536279 18:48460312-48460334 CTTTATCAGCAGTATGAAAATGG + Intergenic
1157543338 18:48528838-48528860 CTGTAAAATGAGAATGATGATGG + Intergenic
1157543338 18:48528838-48528860 CTGTAAAATGAGAATGATGATGG + Intergenic
1157819628 18:50756620-50756642 CTTTAACAGCAGCATGAAAATGG + Intergenic
1157819628 18:50756620-50756642 CTTTAACAGCAGCATGAAAATGG + Intergenic
1157886669 18:51374131-51374153 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1157886669 18:51374131-51374153 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1158054048 18:53258363-53258385 CATTAAAAGCAGTGTGTAGAGGG - Intronic
1158054048 18:53258363-53258385 CATTAAAAGCAGTGTGTAGAGGG - Intronic
1158176880 18:54667340-54667362 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1158176880 18:54667340-54667362 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1159507006 18:69351671-69351693 CTTTATAAGCAGCATGAAAATGG - Intergenic
1159507006 18:69351671-69351693 CTTTATAAGCAGCATGAAAATGG - Intergenic
1159522313 18:69542029-69542051 CTGAAAAGGCAGAATGGAGATGG + Intronic
1159522313 18:69542029-69542051 CTGAAAAGGCAGAATGGAGATGG + Intronic
1159732508 18:72047533-72047555 CAGAAAAAGCAGTACTAAGAGGG + Intergenic
1159732508 18:72047533-72047555 CAGAAAAAGCAGTACTAAGAGGG + Intergenic
1159803151 18:72924874-72924896 CTTTAATAGCAGTATGAAAATGG - Intergenic
1159803151 18:72924874-72924896 CTTTAATAGCAGTATGAAAATGG - Intergenic
1161826550 19:6570484-6570506 CAGTGAAAGCAGTACTAAGAGGG - Intergenic
1161826550 19:6570484-6570506 CAGTGAAAGCAGTACTAAGAGGG - Intergenic
1162688014 19:12403899-12403921 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1162688014 19:12403899-12403921 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1162692332 19:12443692-12443714 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1162692332 19:12443692-12443714 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1163194853 19:15709701-15709723 CAGCAAAAGCAGTATTAAGAAGG + Intergenic
1163194853 19:15709701-15709723 CAGCAAAAGCAGTATTAAGAAGG + Intergenic
1163219579 19:15906606-15906628 CAGCAAAAGCAGTATTAAGAAGG - Intergenic
1163219579 19:15906606-15906628 CAGCAAAAGCAGTATTAAGAAGG - Intergenic
1163914288 19:20226341-20226363 CATTTAAAGCAGTATGTAGAGGG - Intergenic
1163914288 19:20226341-20226363 CATTTAAAGCAGTATGTAGAGGG - Intergenic
1164644987 19:29852201-29852223 CTGCAAGAGCAGGATGAACAGGG + Intergenic
1164644987 19:29852201-29852223 CTGCAAGAGCAGGATGAACAGGG + Intergenic
1164839791 19:31384245-31384267 CTGTAAAAGCAATTTGAGGCCGG - Intergenic
1164839791 19:31384245-31384267 CTGTAAAAGCAATTTGAGGCCGG - Intergenic
1164887524 19:31794981-31795003 CAGTAAAACCAATATGAAGATGG + Intergenic
1164887524 19:31794981-31795003 CAGTAAAACCAATATGAAGATGG + Intergenic
1165057775 19:33189365-33189387 CTTTAACAGCAGTGTGAAAACGG - Intronic
1165057775 19:33189365-33189387 CTTTAACAGCAGTGTGAAAACGG - Intronic
1165367827 19:35380198-35380220 CTGGAAAAGCTGTAAGCAGAAGG - Intergenic
1165367827 19:35380198-35380220 CTGGAAAAGCTGTAAGCAGAAGG - Intergenic
1165566511 19:36733829-36733851 CAGCAAAAGCAGTATTAAGAAGG + Intronic
1165566511 19:36733829-36733851 CAGCAAAAGCAGTATTAAGAAGG + Intronic
1166022087 19:40041057-40041079 CATTCAAAGCAGTATGTAGAGGG - Intronic
1166022087 19:40041057-40041079 CATTCAAAGCAGTATGTAGAGGG - Intronic
1166904497 19:46097659-46097681 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
1166904497 19:46097659-46097681 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
1167401183 19:49271070-49271092 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1167401183 19:49271070-49271092 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1167764704 19:51473842-51473864 CTGAACAATCAGGATGAAGATGG - Intergenic
1167764704 19:51473842-51473864 CTGAACAATCAGGATGAAGATGG - Intergenic
1168331239 19:55570421-55570443 CTGTAAAAAAGGAATGAAGAGGG + Intergenic
1168331239 19:55570421-55570443 CTGTAAAAAAGGAATGAAGAGGG + Intergenic
1202670601 1_KI270709v1_random:46764-46786 CAGTCAAAGCAGTGTGTAGAGGG + Intergenic
1202670601 1_KI270709v1_random:46764-46786 CAGTCAAAGCAGTGTGTAGAGGG + Intergenic
925028717 2:632234-632256 CAGCTAAAGCAGTATGTAGAGGG + Intergenic
925028717 2:632234-632256 CAGCTAAAGCAGTATGTAGAGGG + Intergenic
925232626 2:2247878-2247900 CAGTGAAAGCAGTACTAAGAGGG + Intronic
925232626 2:2247878-2247900 CAGTGAAAGCAGTACTAAGAGGG + Intronic
925817142 2:7764567-7764589 CTTTATCAGCAGTGTGAAGATGG - Intergenic
925817142 2:7764567-7764589 CTTTATCAGCAGTGTGAAGATGG - Intergenic
926678124 2:15643420-15643442 CTGTTAAGGCAGTATGATGATGG + Intergenic
926678124 2:15643420-15643442 CTGTTAAGGCAGTATGATGATGG + Intergenic
926873439 2:17448541-17448563 CAGCTAAAGCAGTATTAAGAGGG + Intergenic
926873439 2:17448541-17448563 CAGCTAAAGCAGTATTAAGAGGG + Intergenic
927340802 2:21981676-21981698 CTTTATCAGCAGTATGAAAATGG - Intergenic
927340802 2:21981676-21981698 CTTTATCAGCAGTATGAAAATGG - Intergenic
927401998 2:22722199-22722221 CTTTATCAGCAGTATGAAAATGG - Intergenic
927401998 2:22722199-22722221 CTTTATCAGCAGTATGAAAATGG - Intergenic
928361503 2:30665738-30665760 TTGTAAAAGCAGGATGATGGGGG - Intergenic
928361503 2:30665738-30665760 TTGTAAAAGCAGGATGATGGGGG - Intergenic
928459725 2:31459320-31459342 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
928459725 2:31459320-31459342 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
928582663 2:32724819-32724841 CTGTATCAGCAGCATGAAAATGG - Intronic
928582663 2:32724819-32724841 CTGTATCAGCAGCATGAAAATGG - Intronic
928783877 2:34857912-34857934 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
928783877 2:34857912-34857934 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
928821586 2:35367523-35367545 CTTTAACAGCAGCATGAAAATGG + Intergenic
928821586 2:35367523-35367545 CTTTAACAGCAGCATGAAAATGG + Intergenic
929275459 2:40020506-40020528 CTTTATAAGCAGTGTGAAAATGG + Intergenic
929275459 2:40020506-40020528 CTTTATAAGCAGTGTGAAAATGG + Intergenic
929427810 2:41861936-41861958 CTTTAACAGCAGTGTGAAAATGG - Intergenic
929427810 2:41861936-41861958 CTTTAACAGCAGTGTGAAAATGG - Intergenic
929560317 2:42952483-42952505 CTTTATAAGCAGCATGAAAACGG + Intergenic
929560317 2:42952483-42952505 CTTTATAAGCAGCATGAAAACGG + Intergenic
930177935 2:48319103-48319125 CTGTAAAAACACTAGCAAGAAGG - Intronic
930177935 2:48319103-48319125 CTGTAAAAACACTAGCAAGAAGG - Intronic
930216717 2:48705041-48705063 CATTTAAAGCAGTATGTAGAGGG - Intronic
930216717 2:48705041-48705063 CATTTAAAGCAGTATGTAGAGGG - Intronic
930268724 2:49230861-49230883 CATTTAAAGCAGTATGTAGAGGG - Intergenic
930268724 2:49230861-49230883 CATTTAAAGCAGTATGTAGAGGG - Intergenic
930317948 2:49820432-49820454 CTTTATCAGCAGTGTGAAGATGG - Intergenic
930317948 2:49820432-49820454 CTTTATCAGCAGTGTGAAGATGG - Intergenic
930461891 2:51691748-51691770 CTGGAGAAGTAGTATGAACAAGG + Intergenic
930461891 2:51691748-51691770 CTGGAGAAGTAGTATGAACAAGG + Intergenic
930527776 2:52551888-52551910 CAGCAAAAGCAGTATTAAGAGGG + Intergenic
930527776 2:52551888-52551910 CAGCAAAAGCAGTATTAAGAGGG + Intergenic
930546207 2:52770485-52770507 CAGCTAAAGCAGTGTGAAGAGGG + Intergenic
930546207 2:52770485-52770507 CAGCTAAAGCAGTGTGAAGAGGG + Intergenic
930961644 2:57268953-57268975 CAGAAAAAGCAGTAATAAGAGGG + Intergenic
930961644 2:57268953-57268975 CAGAAAAAGCAGTAATAAGAGGG + Intergenic
930972419 2:57412136-57412158 CAGCAAAAGCAGTACTAAGAAGG + Intergenic
930972419 2:57412136-57412158 CAGCAAAAGCAGTACTAAGAAGG + Intergenic
931290169 2:60865703-60865725 CTTTAGAAGCAGTATGAGAACGG + Intergenic
931290169 2:60865703-60865725 CTTTAGAAGCAGTATGAGAACGG + Intergenic
931887192 2:66630237-66630259 CATTAAAAGCAGTGTGTAGAGGG - Intergenic
931887192 2:66630237-66630259 CATTAAAAGCAGTGTGTAGAGGG - Intergenic
931989966 2:67780187-67780209 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
931989966 2:67780187-67780209 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
932089697 2:68795417-68795439 CTGCAAAAGCAGTGCAAAGAGGG - Intronic
932089697 2:68795417-68795439 CTGCAAAAGCAGTGCAAAGAGGG - Intronic
932478614 2:72024683-72024705 CTGTAAAAGGAGCCTGAAGGGGG + Intergenic
932478614 2:72024683-72024705 CTGTAAAAGGAGCCTGAAGGGGG + Intergenic
932669466 2:73724374-73724396 CATTCAAAGCAGTATGTAGAGGG + Intergenic
932669466 2:73724374-73724396 CATTCAAAGCAGTATGTAGAGGG + Intergenic
932680852 2:73824155-73824177 CTGTAAAACCAGTAACATGAAGG - Intergenic
932680852 2:73824155-73824177 CTGTAAAACCAGTAACATGAAGG - Intergenic
932707708 2:74039406-74039428 CTGTGAAAGCAGTATCTACAGGG - Intronic
932707708 2:74039406-74039428 CTGTGAAAGCAGTATCTACAGGG - Intronic
933023359 2:77222196-77222218 CATTCAAAGCAGTATGTAGAGGG + Intronic
933023359 2:77222196-77222218 CATTCAAAGCAGTATGTAGAGGG + Intronic
933068310 2:77826993-77827015 CAGCAAAAGCAGTAGTAAGAGGG - Intergenic
933068310 2:77826993-77827015 CAGCAAAAGCAGTAGTAAGAGGG - Intergenic
933332925 2:80917605-80917627 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
933332925 2:80917605-80917627 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
933386004 2:81610982-81611004 CTCAAAAAGCAGCAGGAAGAAGG + Intergenic
933386004 2:81610982-81611004 CTCAAAAAGCAGCAGGAAGAAGG + Intergenic
933388458 2:81640881-81640903 CAGCAAAAGCAGTACAAAGAGGG + Intergenic
933388458 2:81640881-81640903 CAGCAAAAGCAGTACAAAGAGGG + Intergenic
933564330 2:83931264-83931286 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
933564330 2:83931264-83931286 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
933583696 2:84156523-84156545 TTGAAAAAGAAGTATGAAGTTGG - Intergenic
933583696 2:84156523-84156545 TTGAAAAAGAAGTATGAAGTTGG - Intergenic
933906773 2:86901925-86901947 CAGTTTAAGAAGTATGAAGAGGG + Intergenic
933906773 2:86901925-86901947 CAGTTTAAGAAGTATGAAGAGGG + Intergenic
934024703 2:87991709-87991731 CAGTTTAAGAAGTATGAAGAGGG - Intergenic
934024703 2:87991709-87991731 CAGTTTAAGAAGTATGAAGAGGG - Intergenic
935192573 2:100790808-100790830 CTGGAAAAGGAGTATGATGATGG - Intergenic
935192573 2:100790808-100790830 CTGGAAAAGGAGTATGATGATGG - Intergenic
935626093 2:105173441-105173463 CTGTATCAGCAGTGTGAAAACGG - Intergenic
935626093 2:105173441-105173463 CTGTATCAGCAGTGTGAAAACGG - Intergenic
936365391 2:111849746-111849768 CAGTTTAAGAAGTATGAAGAGGG - Intronic
936365391 2:111849746-111849768 CAGTTTAAGAAGTATGAAGAGGG - Intronic
936605696 2:113950778-113950800 CTTTATTAGCAGTATGAAAACGG - Intronic
936605696 2:113950778-113950800 CTTTATTAGCAGTATGAAAACGG - Intronic
936642957 2:114336070-114336092 CATTGAAAGCAGTATGTAGAGGG + Intergenic
936642957 2:114336070-114336092 CATTGAAAGCAGTATGTAGAGGG + Intergenic
936997338 2:118429289-118429311 CTATAATAGAAGTATGAACAAGG + Intergenic
936997338 2:118429289-118429311 CTATAATAGAAGTATGAACAAGG + Intergenic
937148138 2:119664998-119665020 CAGCTAAAGCAGTGTGAAGAGGG + Intergenic
937148138 2:119664998-119665020 CAGCTAAAGCAGTGTGAAGAGGG + Intergenic
937633164 2:124125903-124125925 CATTTAAAGCAGTATGTAGAGGG + Intronic
937633164 2:124125903-124125925 CATTTAAAGCAGTATGTAGAGGG + Intronic
938136547 2:128763364-128763386 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
938136547 2:128763364-128763386 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
938235517 2:129703192-129703214 CTGTATTAGCAGTGTGAAAATGG - Intergenic
938235517 2:129703192-129703214 CTGTATTAGCAGTGTGAAAATGG - Intergenic
938659155 2:133468162-133468184 CATTCAAAGCAGTATGTAGAGGG - Intronic
938659155 2:133468162-133468184 CATTCAAAGCAGTATGTAGAGGG - Intronic
939080231 2:137651705-137651727 CAGCAAAAGCAGTATTAAGAGGG - Intronic
939080231 2:137651705-137651727 CAGCAAAAGCAGTATTAAGAGGG - Intronic
939113743 2:138037690-138037712 CTGTGGAAGCAGTAAGGAGAAGG + Intergenic
939113743 2:138037690-138037712 CTGTGGAAGCAGTAAGGAGAAGG + Intergenic
939445827 2:142309515-142309537 TTGTTATAGCAGTATGAAAATGG - Intergenic
939445827 2:142309515-142309537 TTGTTATAGCAGTATGAAAATGG - Intergenic
939453640 2:142404129-142404151 CAGCAAAAGAAGTATCAAGAGGG + Intergenic
939453640 2:142404129-142404151 CAGCAAAAGAAGTATCAAGAGGG + Intergenic
939552633 2:143634661-143634683 ATATTAAAGCAGAATGAAGATGG - Intronic
939552633 2:143634661-143634683 ATATTAAAGCAGAATGAAGATGG - Intronic
939577545 2:143914585-143914607 CTTGGAAAGCAGTATGAAGATGG + Intergenic
939577545 2:143914585-143914607 CTTGGAAAGCAGTATGAAGATGG + Intergenic
939628711 2:144510041-144510063 CTGAAAAAAAAGTATGGAGAAGG + Intronic
939628711 2:144510041-144510063 CTGAAAAAAAAGTATGGAGAAGG + Intronic
939938916 2:148325987-148326009 CATTCAAAGCAGTATGTAGAGGG - Intronic
939938916 2:148325987-148326009 CATTCAAAGCAGTATGTAGAGGG - Intronic
940135810 2:150435022-150435044 CTTTATCAGCAGTATGAAAATGG + Intergenic
940135810 2:150435022-150435044 CTTTATCAGCAGTATGAAAATGG + Intergenic
940417198 2:153436977-153436999 CATTCAAAGCAGTATGTAGAGGG - Intergenic
940417198 2:153436977-153436999 CATTCAAAGCAGTATGTAGAGGG - Intergenic
940462165 2:153978729-153978751 CTTTATCAGCAGCATGAAGATGG + Intronic
940462165 2:153978729-153978751 CTTTATCAGCAGCATGAAGATGG + Intronic
940564871 2:155348674-155348696 CAGTTAAAGCAGTGTTAAGATGG - Intergenic
940564871 2:155348674-155348696 CAGTTAAAGCAGTGTTAAGATGG - Intergenic
940593724 2:155764269-155764291 CATTTAAAGCAGTATGTAGAGGG - Intergenic
940593724 2:155764269-155764291 CATTTAAAGCAGTATGTAGAGGG - Intergenic
940598201 2:155821106-155821128 CTACAAAAGCAGTATGGAAATGG + Intergenic
940598201 2:155821106-155821128 CTACAAAAGCAGTATGGAAATGG + Intergenic
940616078 2:156050071-156050093 CAGCAAAAGCAGTGTTAAGAGGG + Intergenic
940616078 2:156050071-156050093 CAGCAAAAGCAGTGTTAAGAGGG + Intergenic
940644185 2:156373401-156373423 CATTTAAAGCAGTATGTAGAGGG - Intergenic
940644185 2:156373401-156373423 CATTTAAAGCAGTATGTAGAGGG - Intergenic
940695766 2:156976074-156976096 CAGAAAAAGCAGTACCAAGAGGG - Intergenic
940695766 2:156976074-156976096 CAGAAAAAGCAGTACCAAGAGGG - Intergenic
940828122 2:158436466-158436488 CATTAAAAGCAGTGTGTAGAGGG + Intronic
940828122 2:158436466-158436488 CATTAAAAGCAGTGTGTAGAGGG + Intronic
941216124 2:162711505-162711527 CTGAAAATGCAGGATGAAGATGG - Intronic
941216124 2:162711505-162711527 CTGAAAATGCAGGATGAAGATGG - Intronic
941459180 2:165746930-165746952 CTTTAACAGCAGTGTGAAAACGG + Intergenic
941459180 2:165746930-165746952 CTTTAACAGCAGTGTGAAAACGG + Intergenic
941518434 2:166508734-166508756 CAGCAAAAGCAGTGTTAAGAGGG - Intergenic
941518434 2:166508734-166508756 CAGCAAAAGCAGTGTTAAGAGGG - Intergenic
941674792 2:168332212-168332234 CAGTAAAAGCAGTGCTAAGAAGG + Intergenic
941674792 2:168332212-168332234 CAGTAAAAGCAGTGCTAAGAAGG + Intergenic
941780134 2:169434833-169434855 CAGTGAAAGCAGTACTAAGAGGG + Intergenic
941780134 2:169434833-169434855 CAGTGAAAGCAGTACTAAGAGGG + Intergenic
941845945 2:170133251-170133273 CAGCAAAAGCAGTATGAAGAGGG + Intergenic
941845945 2:170133251-170133273 CAGCAAAAGCAGTATGAAGAGGG + Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942367203 2:175240097-175240119 CTTTATCAGCAGTATGAAAATGG - Intergenic
942367203 2:175240097-175240119 CTTTATCAGCAGTATGAAAATGG - Intergenic
942392145 2:175506452-175506474 CATTTAAAGCAGTATGTAGAGGG + Intergenic
942392145 2:175506452-175506474 CATTTAAAGCAGTATGTAGAGGG + Intergenic
942395442 2:175542757-175542779 CTTTATCAGCAGTATGAAAATGG - Intergenic
942395442 2:175542757-175542779 CTTTATCAGCAGTATGAAAATGG - Intergenic
942651298 2:178171188-178171210 CAGCAAAAGCAGTACTAAGATGG - Intergenic
942651298 2:178171188-178171210 CAGCAAAAGCAGTACTAAGATGG - Intergenic
942669158 2:178355076-178355098 CATTTAAAGCAGTATGTAGAGGG + Intronic
942669158 2:178355076-178355098 CATTTAAAGCAGTATGTAGAGGG + Intronic
942873850 2:180768068-180768090 CATTCAAAGCAGTATGTAGAGGG + Intergenic
942873850 2:180768068-180768090 CATTCAAAGCAGTATGTAGAGGG + Intergenic
942898421 2:181086154-181086176 TTGGATAAGAAGTATGAAGAAGG + Intergenic
942898421 2:181086154-181086176 TTGGATAAGAAGTATGAAGAAGG + Intergenic
943102292 2:183502444-183502466 CTGCAGAAGCAGTACTAAGAGGG - Intergenic
943102292 2:183502444-183502466 CTGCAGAAGCAGTACTAAGAGGG - Intergenic
943118750 2:183708035-183708057 CTTTATCAGCAGCATGAAGACGG + Intergenic
943118750 2:183708035-183708057 CTTTATCAGCAGCATGAAGACGG + Intergenic
943219985 2:185091640-185091662 CTTTAAGAGCAGCATGAAAAGGG + Intergenic
943219985 2:185091640-185091662 CTTTAAGAGCAGCATGAAAAGGG + Intergenic
943484465 2:188462076-188462098 CAGCAAAAGCAGTACGAAGAGGG - Intronic
943484465 2:188462076-188462098 CAGCAAAAGCAGTACGAAGAGGG - Intronic
943501149 2:188691133-188691155 CAGACAAAGCAGTATTAAGAGGG - Intergenic
943501149 2:188691133-188691155 CAGACAAAGCAGTATTAAGAGGG - Intergenic
943652690 2:190474055-190474077 CAGTCAAAGCAGTGTGTAGAGGG + Intronic
943652690 2:190474055-190474077 CAGTCAAAGCAGTGTGTAGAGGG + Intronic
943913397 2:193597054-193597076 CAGTGAAAGCAGTACTAAGAGGG + Intergenic
943913397 2:193597054-193597076 CAGTGAAAGCAGTACTAAGAGGG + Intergenic
943929712 2:193834020-193834042 CCTTTAAAGCAGTATGTAGAGGG - Intergenic
943929712 2:193834020-193834042 CCTTTAAAGCAGTATGTAGAGGG - Intergenic
944002247 2:194853700-194853722 CATTTAAAGCAGTATGTAGAGGG - Intergenic
944002247 2:194853700-194853722 CATTTAAAGCAGTATGTAGAGGG - Intergenic
944031823 2:195243497-195243519 CAGCCAAAGCAGTATTAAGAGGG + Intergenic
944031823 2:195243497-195243519 CAGCCAAAGCAGTATTAAGAGGG + Intergenic
944346997 2:198680357-198680379 TAGCAAAAGCAGTATTAAGAGGG + Intergenic
944346997 2:198680357-198680379 TAGCAAAAGCAGTATTAAGAGGG + Intergenic
944737575 2:202581696-202581718 CAGCAAAAGCAGTTAGAAGAGGG - Intergenic
944737575 2:202581696-202581718 CAGCAAAAGCAGTTAGAAGAGGG - Intergenic
944805063 2:203272727-203272749 CGGAAAAAACAATATGAAGATGG + Exonic
944805063 2:203272727-203272749 CGGAAAAAACAATATGAAGATGG + Exonic
944918172 2:204382603-204382625 CAGTTAAAGCAGTGTTAAGAGGG - Intergenic
944918172 2:204382603-204382625 CAGTTAAAGCAGTGTTAAGAGGG - Intergenic
944965199 2:204924036-204924058 CTGTAAAAGCTGTAAAATGAAGG + Intronic
944965199 2:204924036-204924058 CTGTAAAAGCTGTAAAATGAAGG + Intronic
945024107 2:205604208-205604230 CTTTAACAGCAGTGTGAAAATGG - Intronic
945024107 2:205604208-205604230 CTTTAACAGCAGTGTGAAAATGG - Intronic
945378313 2:209106718-209106740 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
945378313 2:209106718-209106740 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
945475965 2:210282902-210282924 CAGCAAAAGCAGTATTAAGAGGG - Intergenic
945475965 2:210282902-210282924 CAGCAAAAGCAGTATTAAGAGGG - Intergenic
945713714 2:213331872-213331894 CAGTGAAAGCAGTACTAAGAGGG + Intronic
945713714 2:213331872-213331894 CAGTGAAAGCAGTACTAAGAGGG + Intronic
946139502 2:217677274-217677296 CATTCAAAGCAGTATGTAGAGGG - Intronic
946139502 2:217677274-217677296 CATTCAAAGCAGTATGTAGAGGG - Intronic
946513749 2:220388438-220388460 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
946513749 2:220388438-220388460 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
946562338 2:220927249-220927271 CTTTATAAGCAGCATGAAAATGG - Intergenic
946562338 2:220927249-220927271 CTTTATAAGCAGCATGAAAATGG - Intergenic
946984995 2:225261675-225261697 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
946984995 2:225261675-225261697 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
947209181 2:227691261-227691283 CAGTGAAAGCAGTATTAAGAGGG + Intronic
947209181 2:227691261-227691283 CAGTGAAAGCAGTATTAAGAGGG + Intronic
947248456 2:228076240-228076262 CTTTATCAGCAGTATGAATACGG + Intronic
947248456 2:228076240-228076262 CTTTATCAGCAGTATGAATACGG + Intronic
947248723 2:228078156-228078178 CTGTATCAGCAGCATGAAAATGG + Intronic
947248723 2:228078156-228078178 CTGTATCAGCAGCATGAAAATGG + Intronic
947311932 2:228813229-228813251 CAGCAAAAGCAGTACAAAGAAGG - Intergenic
947311932 2:228813229-228813251 CAGCAAAAGCAGTACAAAGAAGG - Intergenic
947396743 2:229694468-229694490 CTGTGAAAGCAGACAGAAGAGGG + Intronic
947396743 2:229694468-229694490 CTGTGAAAGCAGACAGAAGAGGG + Intronic
947479899 2:230489665-230489687 CAGCTAAAGCAGTATTAAGAGGG - Intronic
947479899 2:230489665-230489687 CAGCTAAAGCAGTATTAAGAGGG - Intronic
947730042 2:232422952-232422974 CTGGAAAGGCAGTCTGCAGAGGG - Intergenic
947730042 2:232422952-232422974 CTGGAAAGGCAGTCTGCAGAGGG - Intergenic
947795482 2:232891388-232891410 CTGGAAAGGCAGGATGAGGAAGG + Exonic
947795482 2:232891388-232891410 CTGGAAAGGCAGGATGAGGAAGG + Exonic
947886360 2:233575344-233575366 CTTTATAAGCAGCATGAAAATGG - Intergenic
947886360 2:233575344-233575366 CTTTATAAGCAGCATGAAAATGG - Intergenic
947923370 2:233898967-233898989 CTGTAAAAAAATGATGAAGATGG - Intergenic
947923370 2:233898967-233898989 CTGTAAAAAAATGATGAAGATGG - Intergenic
948310703 2:236983799-236983821 CTTTATCAGCAGTATGAAAATGG + Intergenic
948310703 2:236983799-236983821 CTTTATCAGCAGTATGAAAATGG + Intergenic
948475130 2:238212841-238212863 CAGCAAAAGCAGTACCAAGAGGG - Intergenic
948475130 2:238212841-238212863 CAGCAAAAGCAGTACCAAGAGGG - Intergenic
1168744194 20:222463-222485 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1168744194 20:222463-222485 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1170167597 20:13378225-13378247 CAGTTAAAGCAGTGTTAAGAGGG - Intergenic
1170167597 20:13378225-13378247 CAGTTAAAGCAGTGTTAAGAGGG - Intergenic
1170182050 20:13542816-13542838 CAGTAAAAGTAGTACTAAGAGGG + Intronic
1170182050 20:13542816-13542838 CAGTAAAAGTAGTACTAAGAGGG + Intronic
1170209367 20:13833177-13833199 CTGCAAATGCAGAATGAAAATGG - Intergenic
1170209367 20:13833177-13833199 CTGCAAATGCAGAATGAAAATGG - Intergenic
1170474900 20:16705240-16705262 CTTTATCAGCAGCATGAAGATGG + Intergenic
1170474900 20:16705240-16705262 CTTTATCAGCAGCATGAAGATGG + Intergenic
1170490459 20:16867803-16867825 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1170490459 20:16867803-16867825 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1170648488 20:18217561-18217583 CTTTATCAGCAGTATGAAAAAGG + Intergenic
1170648488 20:18217561-18217583 CTTTATCAGCAGTATGAAAAAGG + Intergenic
1170777250 20:19387470-19387492 CAGTAAAAGCAGTTTTAAGAGGG - Intronic
1170777250 20:19387470-19387492 CAGTAAAAGCAGTTTTAAGAGGG - Intronic
1170778341 20:19400763-19400785 CTCTCAAAGCAGTAAGCAGAGGG + Intronic
1170778341 20:19400763-19400785 CTCTCAAAGCAGTAAGCAGAGGG + Intronic
1171076521 20:22132163-22132185 CATTCAAAGCAGTATGTAGAGGG + Intergenic
1171076521 20:22132163-22132185 CATTCAAAGCAGTATGTAGAGGG + Intergenic
1171200679 20:23239290-23239312 CAGCTAAAGCAGTGTGAAGAGGG - Intergenic
1171200679 20:23239290-23239312 CAGCTAAAGCAGTGTGAAGAGGG - Intergenic
1171323578 20:24269449-24269471 CAGTGAAAGCAGTATACAGAGGG - Intergenic
1171323578 20:24269449-24269471 CAGTGAAAGCAGTATACAGAGGG - Intergenic
1171736428 20:28791416-28791438 CATTCAAAGCAGTGTGAAGAAGG - Intergenic
1171736428 20:28791416-28791438 CATTCAAAGCAGTGTGAAGAAGG - Intergenic
1172720456 20:36995964-36995986 CTTTATCAGCAGTATGAAAATGG + Intergenic
1172720456 20:36995964-36995986 CTTTATCAGCAGTATGAAAATGG + Intergenic
1172951888 20:38727569-38727591 CTGTACGAGGAGAATGAAGACGG + Exonic
1172951888 20:38727569-38727591 CTGTACGAGGAGAATGAAGACGG + Exonic
1173162558 20:40663544-40663566 CTTTGAAAACAGTATGAAGTAGG - Intergenic
1173162558 20:40663544-40663566 CTTTGAAAACAGTATGAAGTAGG - Intergenic
1173203927 20:40976621-40976643 CAGTGAAAGCAGTACCAAGAGGG - Intergenic
1173203927 20:40976621-40976643 CAGTGAAAGCAGTACCAAGAGGG - Intergenic
1173765521 20:45605329-45605351 CAGCAAAAGCAGTACCAAGAGGG - Intergenic
1173765521 20:45605329-45605351 CAGCAAAAGCAGTACCAAGAGGG - Intergenic
1174196435 20:48775884-48775906 CTTTATCAGCAGTATGAAAATGG + Intronic
1174196435 20:48775884-48775906 CTTTATCAGCAGTATGAAAATGG + Intronic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1174831469 20:53816777-53816799 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1174831469 20:53816777-53816799 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1176638178 21:9268894-9268916 CATTCAAAGCAGTGTGAAGAGGG + Intergenic
1176638178 21:9268894-9268916 CATTCAAAGCAGTGTGAAGAGGG + Intergenic
1176777074 21:13147270-13147292 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1176777074 21:13147270-13147292 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1176969078 21:15245124-15245146 CTGTAAAAGAAGGATAAACATGG + Intergenic
1176969078 21:15245124-15245146 CTGTAAAAGAAGGATAAACATGG + Intergenic
1177089410 21:16748245-16748267 CTGTATAAGAAGTATGATGCTGG - Intergenic
1177089410 21:16748245-16748267 CTGTATAAGAAGTATGATGCTGG - Intergenic
1177108253 21:16988728-16988750 CAGTAAAATCAGTACTAAGAGGG - Intergenic
1177108253 21:16988728-16988750 CAGTAAAATCAGTACTAAGAGGG - Intergenic
1177484909 21:21745125-21745147 CTTTATCAGCAGTGTGAAGATGG + Intergenic
1177484909 21:21745125-21745147 CTTTATCAGCAGTGTGAAGATGG + Intergenic
1177685795 21:24435565-24435587 CTGTATGAGCAGCATGAAAATGG + Intergenic
1177685795 21:24435565-24435587 CTGTATGAGCAGCATGAAAATGG + Intergenic
1177873746 21:26605864-26605886 CAGTGAAAGCAGTACTAAGAGGG - Intergenic
1177873746 21:26605864-26605886 CAGTGAAAGCAGTACTAAGAGGG - Intergenic
1179310342 21:40189871-40189893 CTGTATCAGCAGCATGAAAACGG + Intronic
1179310342 21:40189871-40189893 CTGTATCAGCAGCATGAAAACGG + Intronic
1179927616 21:44545749-44545771 CAGTGAAAGCAGTATGTAGAGGG + Intronic
1179927616 21:44545749-44545771 CAGTGAAAGCAGTATGTAGAGGG + Intronic
1180118696 21:45730174-45730196 CAGTAAAAGCAGTACCAAGAGGG - Intronic
1180118696 21:45730174-45730196 CAGTAAAAGCAGTACCAAGAGGG - Intronic
1180305585 22:11120555-11120577 CTTTAACAGCAGAATGAAAACGG + Intergenic
1180305585 22:11120555-11120577 CTTTAACAGCAGAATGAAAACGG + Intergenic
1180337524 22:11592173-11592195 CTTTCAAAGCAGTGTGTAGAGGG - Intergenic
1180337524 22:11592173-11592195 CTTTCAAAGCAGTGTGTAGAGGG - Intergenic
1180370791 22:12034515-12034537 CATTCAAAGCAGTGTGAAGAGGG - Intergenic
1180370791 22:12034515-12034537 CATTCAAAGCAGTGTGAAGAGGG - Intergenic
1180422220 22:12876391-12876413 CATTCAAAGCAGTGTGAAGAGGG + Intergenic
1180422220 22:12876391-12876413 CATTCAAAGCAGTGTGAAGAGGG + Intergenic
1180519752 22:16186563-16186585 CAGTCAAAGCAGTGTGTAGAGGG + Intergenic
1180519752 22:16186563-16186585 CAGTCAAAGCAGTGTGTAGAGGG + Intergenic
1180544104 22:16482734-16482756 CTTTAACAGCAGAATGAAAACGG + Intergenic
1180544104 22:16482734-16482756 CTTTAACAGCAGAATGAAAACGG + Intergenic
1180556414 22:16581277-16581299 GTGTAAAAGCACTAGGAATATGG + Intergenic
1180556414 22:16581277-16581299 GTGTAAAAGCACTAGGAATATGG + Intergenic
1181344148 22:22205345-22205367 ATTTAAAAGGAGTATTAAGACGG - Intergenic
1181344148 22:22205345-22205367 ATTTAAAAGGAGTATTAAGACGG - Intergenic
1181730236 22:24840779-24840801 CTATAAAAGCAGTGCTAAGAAGG - Intronic
1181730236 22:24840779-24840801 CTATAAAAGCAGTGCTAAGAAGG - Intronic
1182165290 22:28166662-28166684 CATTTAAAGCAGTGTGAAGAGGG + Intronic
1182165290 22:28166662-28166684 CATTTAAAGCAGTGTGAAGAGGG + Intronic
1182646437 22:31813621-31813643 CTCTAAAAGCAACAGGAAGAAGG - Intronic
1182646437 22:31813621-31813643 CTCTAAAAGCAACAGGAAGAAGG - Intronic
1183758749 22:39796205-39796227 CAGCAAAAGCAGTAGTAAGAGGG - Intronic
1183758749 22:39796205-39796227 CAGCAAAAGCAGTAGTAAGAGGG - Intronic
1184327830 22:43804313-43804335 CAGCAAAAGCAGTACTAAGAAGG + Intronic
1184327830 22:43804313-43804335 CAGCAAAAGCAGTACTAAGAAGG + Intronic
1184432956 22:44452285-44452307 CTGTACAAGCAGCATGGAGCCGG - Intergenic
1184432956 22:44452285-44452307 CTGTACAAGCAGCATGGAGCCGG - Intergenic
1185106639 22:48874045-48874067 CTGAAAATGCAGATTGAAGAAGG - Intergenic
1185106639 22:48874045-48874067 CTGAAAATGCAGATTGAAGAAGG - Intergenic
949330221 3:2914146-2914168 CAGCAAAAGCAGTAATAAGAGGG + Intronic
949330221 3:2914146-2914168 CAGCAAAAGCAGTAATAAGAGGG + Intronic
949426194 3:3918729-3918751 CTGTAAGAGCAGAGTGAAGCAGG + Intronic
949426194 3:3918729-3918751 CTGTAAGAGCAGAGTGAAGCAGG + Intronic
949944105 3:9176703-9176725 CTGTAAAAGCAGAAGCAAGTGGG + Intronic
949944105 3:9176703-9176725 CTGTAAAAGCAGAAGCAAGTGGG + Intronic
950115589 3:10448684-10448706 CAGACAAAGCAGTAGGAAGATGG - Intronic
950115589 3:10448684-10448706 CAGACAAAGCAGTAGGAAGATGG - Intronic
950164350 3:10782550-10782572 ATTTAAAAGCAGTAGTAAGAAGG + Intergenic
950164350 3:10782550-10782572 ATTTAAAAGCAGTAGTAAGAAGG + Intergenic
950340080 3:12235605-12235627 TTGTAGCACCAGTATGAAGAAGG + Intergenic
950340080 3:12235605-12235627 TTGTAGCACCAGTATGAAGAAGG + Intergenic
950844884 3:16005766-16005788 CTTTATCAGCAGTATGAAAACGG - Intergenic
950844884 3:16005766-16005788 CTTTATCAGCAGTATGAAAACGG - Intergenic
950992394 3:17453155-17453177 CAGCAAAAGCAGTAGTAAGAGGG + Intronic
950992394 3:17453155-17453177 CAGCAAAAGCAGTAGTAAGAGGG + Intronic
951151150 3:19291395-19291417 CATTCAAAGCAGTGTGAAGAGGG - Intronic
951151150 3:19291395-19291417 CATTCAAAGCAGTGTGAAGAGGG - Intronic
951259634 3:20492182-20492204 CAGTGAAAGCAGTACTAAGAGGG - Intergenic
951259634 3:20492182-20492204 CAGTGAAAGCAGTACTAAGAGGG - Intergenic
951614744 3:24529896-24529918 CTGTAAAAGCAGGGTGAGGAGGG - Intergenic
951614744 3:24529896-24529918 CTGTAAAAGCAGGGTGAGGAGGG - Intergenic
951763638 3:26172425-26172447 CTGTATAAGCAGCATGAAAATGG + Intergenic
951763638 3:26172425-26172447 CTGTATAAGCAGCATGAAAATGG + Intergenic
952006710 3:28849640-28849662 CTGAATCAGCAGTCTGAAGATGG + Intergenic
952006710 3:28849640-28849662 CTGAATCAGCAGTCTGAAGATGG + Intergenic
952132358 3:30380021-30380043 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
952132358 3:30380021-30380043 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
952133278 3:30388836-30388858 CATTTAAAGCAGTATGTAGAGGG - Intergenic
952133278 3:30388836-30388858 CATTTAAAGCAGTATGTAGAGGG - Intergenic
952683831 3:36126808-36126830 CAGCAAAAGCAGTATTATGAGGG + Intergenic
952683831 3:36126808-36126830 CAGCAAAAGCAGTATTATGAGGG + Intergenic
952741650 3:36739699-36739721 CTCTATAAGCAGCATGAAAAGGG + Intronic
952741650 3:36739699-36739721 CTCTATAAGCAGCATGAAAAGGG + Intronic
953316157 3:41928340-41928362 CTGCTAAAGCAGTGTGTAGAGGG + Intronic
953316157 3:41928340-41928362 CTGCTAAAGCAGTGTGTAGAGGG + Intronic
953358469 3:42274583-42274605 CTTTATAAGCAGTGTGAAAATGG - Intergenic
953358469 3:42274583-42274605 CTTTATAAGCAGTGTGAAAATGG - Intergenic
953451345 3:43009103-43009125 CTGAAAAATGAGTATGAAAATGG - Intronic
953451345 3:43009103-43009125 CTGAAAAATGAGTATGAAAATGG - Intronic
954130579 3:48558715-48558737 CTGCAAAAGGAGGATGAGGAAGG - Intronic
954130579 3:48558715-48558737 CTGCAAAAGGAGGATGAGGAAGG - Intronic
954949416 3:54457208-54457230 CAGCAAAGGCAGTATTAAGAGGG - Intronic
954949416 3:54457208-54457230 CAGCAAAGGCAGTATTAAGAGGG - Intronic
955217323 3:56995129-56995151 CTTTAATAGCAGTGTGAAAATGG + Intronic
955217323 3:56995129-56995151 CTTTAATAGCAGTGTGAAAATGG + Intronic
955269219 3:57479910-57479932 CAGTCAAAGCAGTGTGTAGAGGG + Intronic
955269219 3:57479910-57479932 CAGTCAAAGCAGTGTGTAGAGGG + Intronic
955472122 3:59296754-59296776 CAGCCAAAGCAGTGTGAAGAGGG + Intergenic
955472122 3:59296754-59296776 CAGCCAAAGCAGTGTGAAGAGGG + Intergenic
955657539 3:61260975-61260997 CAGTTAAAGCAGTATTTAGAGGG - Intergenic
955657539 3:61260975-61260997 CAGTTAAAGCAGTATTTAGAGGG - Intergenic
955754857 3:62216654-62216676 CTATAAAAGCATTATGTTGATGG + Intronic
955754857 3:62216654-62216676 CTATAAAAGCATTATGTTGATGG + Intronic
955831843 3:63013208-63013230 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
955831843 3:63013208-63013230 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
956018872 3:64912664-64912686 CTTTATCAGCAGTATGAAAAAGG + Intergenic
956018872 3:64912664-64912686 CTTTATCAGCAGTATGAAAAAGG + Intergenic
956242991 3:67150626-67150648 CAGTCAAAGCAGTGTGTAGAGGG + Intergenic
956242991 3:67150626-67150648 CAGTCAAAGCAGTGTGTAGAGGG + Intergenic
956687248 3:71841476-71841498 CTTTAACAGCAGTAAGAAGGTGG + Intergenic
956687248 3:71841476-71841498 CTTTAACAGCAGTAAGAAGGTGG + Intergenic
956983050 3:74662637-74662659 CTGTAAAAGCAGAATCTAGGTGG - Intergenic
956983050 3:74662637-74662659 CTGTAAAAGCAGAATCTAGGTGG - Intergenic
957034967 3:75285557-75285579 CTGTAAATGCAGAATGAGCAGGG + Intergenic
957034967 3:75285557-75285579 CTGTAAATGCAGAATGAGCAGGG + Intergenic
957173053 3:76764801-76764823 CTGTAACAGAAGTATGTACAGGG - Intronic
957173053 3:76764801-76764823 CTGTAACAGAAGTATGTACAGGG - Intronic
957615973 3:82528016-82528038 CTGTAAAGGAAGTAAGGAGAAGG - Intergenic
957615973 3:82528016-82528038 CTGTAAAGGAAGTAAGGAGAAGG - Intergenic
957629807 3:82704558-82704580 CAGTTAAAGCAGTGTTAAGAGGG - Intergenic
957629807 3:82704558-82704580 CAGTTAAAGCAGTGTTAAGAGGG - Intergenic
957773407 3:84723302-84723324 ATATAAAAGCAGTAAAAAGAAGG + Intergenic
957773407 3:84723302-84723324 ATATAAAAGCAGTAAAAAGAAGG + Intergenic
957787612 3:84902149-84902171 CTTTATAAGCAGAATGAAAATGG + Intergenic
957787612 3:84902149-84902171 CTTTATAAGCAGAATGAAAATGG + Intergenic
957815562 3:85292779-85292801 CATTAAAAGCAGTGTGTAGAGGG + Intronic
957815562 3:85292779-85292801 CATTAAAAGCAGTGTGTAGAGGG + Intronic
957987320 3:87589172-87589194 CTTTATAAGCAGCATGAAAAAGG - Intergenic
957987320 3:87589172-87589194 CTTTATAAGCAGCATGAAAAAGG - Intergenic
958057210 3:88428009-88428031 CTGTAAAAGCAGCCAGAAGGGGG + Intergenic
958057210 3:88428009-88428031 CTGTAAAAGCAGCCAGAAGGGGG + Intergenic
958098369 3:88976225-88976247 CAGCAAAAGCAGTACCAAGAGGG + Intergenic
958098369 3:88976225-88976247 CAGCAAAAGCAGTACCAAGAGGG + Intergenic
958409986 3:93804539-93804561 CATTAAAAGCAGTGTGTAGAGGG - Intergenic
958409986 3:93804539-93804561 CATTAAAAGCAGTGTGTAGAGGG - Intergenic
958525101 3:95246923-95246945 CTTTATCAGCAGCATGAAGATGG + Intergenic
958525101 3:95246923-95246945 CTTTATCAGCAGCATGAAGATGG + Intergenic
958588050 3:96117222-96117244 CTTTATCAGCAGTATGAAAATGG + Intergenic
958588050 3:96117222-96117244 CTTTATCAGCAGTATGAAAATGG + Intergenic
958607297 3:96375422-96375444 CAGTTAAAGCAGTGTTAAGAGGG - Intergenic
958607297 3:96375422-96375444 CAGTTAAAGCAGTGTTAAGAGGG - Intergenic
958625929 3:96624331-96624353 CTTTTAAAGCAGTGTGTAGAGGG - Intergenic
958625929 3:96624331-96624353 CTTTTAAAGCAGTGTGTAGAGGG - Intergenic
958631929 3:96696190-96696212 CAGCAAAAGCAGTATTCAGAGGG - Intergenic
958631929 3:96696190-96696212 CAGCAAAAGCAGTATTCAGAGGG - Intergenic
958788309 3:98623054-98623076 CTGTACAAGAAGCATGATGAGGG + Intergenic
958788309 3:98623054-98623076 CTGTACAAGAAGCATGATGAGGG + Intergenic
959013944 3:101111313-101111335 CATTCAAAGCAGTGTGAAGAGGG + Intergenic
959013944 3:101111313-101111335 CATTCAAAGCAGTGTGAAGAGGG + Intergenic
959054344 3:101552892-101552914 CTTTATCAGCAGCATGAAGATGG + Intergenic
959054344 3:101552892-101552914 CTTTATCAGCAGCATGAAGATGG + Intergenic
959118256 3:102203470-102203492 CTGTAAAAAAAAGATGAAGATGG - Intronic
959118256 3:102203470-102203492 CTGTAAAAAAAAGATGAAGATGG - Intronic
959191405 3:103116314-103116336 CAGTAAAAGCAGTAATAAGAAGG + Intergenic
959191405 3:103116314-103116336 CAGTAAAAGCAGTAATAAGAAGG + Intergenic
959218273 3:103481307-103481329 CATTCAAAGCAGTATGTAGAGGG - Intergenic
959218273 3:103481307-103481329 CATTCAAAGCAGTATGTAGAGGG - Intergenic
959273072 3:104239392-104239414 CGGCAAAAGCAGTTCGAAGAGGG - Intergenic
959273072 3:104239392-104239414 CGGCAAAAGCAGTTCGAAGAGGG - Intergenic
959301867 3:104612823-104612845 CTGTAACAGCAATATCAATACGG + Intergenic
959301867 3:104612823-104612845 CTGTAACAGCAATATCAATACGG + Intergenic
959479680 3:106856043-106856065 CAGCTAAAGCAGTATTAAGAAGG + Intergenic
959479680 3:106856043-106856065 CAGCTAAAGCAGTATTAAGAAGG + Intergenic
959717424 3:109448299-109448321 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
959717424 3:109448299-109448321 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
959766297 3:110033574-110033596 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
959766297 3:110033574-110033596 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
959846482 3:111039728-111039750 CTTTATCAGCAGTATGAAAATGG + Intergenic
959846482 3:111039728-111039750 CTTTATCAGCAGTATGAAAATGG + Intergenic
960214389 3:115013057-115013079 CAGCAAAAGCAGTACTAAGAGGG + Intronic
960214389 3:115013057-115013079 CAGCAAAAGCAGTACTAAGAGGG + Intronic
960297966 3:115967573-115967595 CTTTATCAGCAGTATGAAAATGG - Intronic
960297966 3:115967573-115967595 CTTTATCAGCAGTATGAAAATGG - Intronic
960306278 3:116065209-116065231 CTGTATGAGCAGTATGCTGAAGG + Intronic
960306278 3:116065209-116065231 CTGTATGAGCAGTATGCTGAAGG + Intronic
960764336 3:121109377-121109399 CAGAAAAAGCAGTGTTAAGAGGG - Intronic
960764336 3:121109377-121109399 CAGAAAAAGCAGTGTTAAGAGGG - Intronic
960976437 3:123179384-123179406 CTGCAAAAGCCGTATGAACTGGG - Intronic
960976437 3:123179384-123179406 CTGCAAAAGCCGTATGAACTGGG - Intronic
961078855 3:124007143-124007165 CTGTAAATGCAGAATGAGCAGGG + Intergenic
961078855 3:124007143-124007165 CTGTAAATGCAGAATGAGCAGGG + Intergenic
961257955 3:125572775-125572797 CTTTATCAGCAGTATGAATATGG + Intronic
961257955 3:125572775-125572797 CTTTATCAGCAGTATGAATATGG + Intronic
961304623 3:125949298-125949320 CTGTAAATGCAGAATGAGCAGGG - Intergenic
961304623 3:125949298-125949320 CTGTAAATGCAGAATGAGCAGGG - Intergenic
961912568 3:130334914-130334936 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
961912568 3:130334914-130334936 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
962038438 3:131679579-131679601 CAGTTAAAGCAGTATTAAGAGGG - Intronic
962038438 3:131679579-131679601 CAGTTAAAGCAGTATTAAGAGGG - Intronic
962125239 3:132610216-132610238 CATTCAAAGCAGTATGTAGAGGG + Intronic
962125239 3:132610216-132610238 CATTCAAAGCAGTATGTAGAGGG + Intronic
962617364 3:137140353-137140375 CATTCAAAGCAGTATGTAGAGGG + Intergenic
962617364 3:137140353-137140375 CATTCAAAGCAGTATGTAGAGGG + Intergenic
963442144 3:145354414-145354436 CTGGATAAGCTGTTTGAAGAGGG + Intergenic
963442144 3:145354414-145354436 CTGGATAAGCTGTTTGAAGAGGG + Intergenic
963557181 3:146807128-146807150 CTTTAAAATAAGTAGGAAGATGG + Intergenic
963557181 3:146807128-146807150 CTTTAAAATAAGTAGGAAGATGG + Intergenic
963818944 3:149866686-149866708 CAGCAAAAGCAGTATTAAGAGGG - Intronic
963818944 3:149866686-149866708 CAGCAAAAGCAGTATTAAGAGGG - Intronic
964081590 3:152765253-152765275 CAGCTAAAGCAGTATTAAGAGGG + Intergenic
964081590 3:152765253-152765275 CAGCTAAAGCAGTATTAAGAGGG + Intergenic
964208779 3:154204671-154204693 CACTAAAAGCAGTATAAAGAGGG - Intronic
964208779 3:154204671-154204693 CACTAAAAGCAGTATAAAGAGGG - Intronic
964420602 3:156498613-156498635 CTTTATCAGCAGCATGAAGATGG + Intronic
964420602 3:156498613-156498635 CTTTATCAGCAGCATGAAGATGG + Intronic
964738069 3:159936503-159936525 CTGTAAAACCAGCATGATGCTGG - Intergenic
964738069 3:159936503-159936525 CTGTAAAACCAGCATGATGCTGG - Intergenic
964759304 3:160118885-160118907 CATTTAAAGCAGTATGTAGACGG + Intergenic
964759304 3:160118885-160118907 CATTTAAAGCAGTATGTAGACGG + Intergenic
964901723 3:161668005-161668027 CAGCAAAAGCAGTGTTAAGAGGG - Intergenic
964901723 3:161668005-161668027 CAGCAAAAGCAGTGTTAAGAGGG - Intergenic
965047762 3:163600856-163600878 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
965047762 3:163600856-163600878 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
965236626 3:166133041-166133063 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
965236626 3:166133041-166133063 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
965275433 3:166676806-166676828 CTGTGAAAGCAGTCAGAAGGAGG - Intergenic
965275433 3:166676806-166676828 CTGTGAAAGCAGTCAGAAGGAGG - Intergenic
965351106 3:167612318-167612340 CAGTAAAAGCAGTACTAAGAGGG + Intronic
965351106 3:167612318-167612340 CAGTAAAAGCAGTACTAAGAGGG + Intronic
965380457 3:167981751-167981773 CTGTAAAAACAAGAAGAAGAAGG - Intergenic
965380457 3:167981751-167981773 CTGTAAAAACAAGAAGAAGAAGG - Intergenic
965380771 3:167984886-167984908 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
965380771 3:167984886-167984908 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
965458013 3:168928854-168928876 CTTTATCAGCAGTATGAAAATGG - Intergenic
965458013 3:168928854-168928876 CTTTATCAGCAGTATGAAAATGG - Intergenic
965763088 3:172101593-172101615 CTGTAAAATAAGTATAAAGCAGG - Intronic
965763088 3:172101593-172101615 CTGTAAAATAAGTATAAAGCAGG - Intronic
965888840 3:173484607-173484629 CTCTAAAAGGAGAATGAAGATGG + Intronic
965888840 3:173484607-173484629 CTCTAAAAGGAGAATGAAGATGG + Intronic
966370165 3:179243274-179243296 GTGTAAAAGCACTAGGAATATGG + Exonic
966370165 3:179243274-179243296 GTGTAAAAGCACTAGGAATATGG + Exonic
966490237 3:180519440-180519462 CAGTTAAGGCAGTATTAAGAGGG + Intergenic
966490237 3:180519440-180519462 CAGTTAAGGCAGTATTAAGAGGG + Intergenic
966550677 3:181200880-181200902 CTTTACAAGCAGCATGATGATGG + Intergenic
966550677 3:181200880-181200902 CTTTACAAGCAGCATGATGATGG + Intergenic
967551687 3:190802352-190802374 CAGCAAAAGCAGTACTAAGAAGG + Intergenic
967551687 3:190802352-190802374 CAGCAAAAGCAGTACTAAGAAGG + Intergenic
967582913 3:191180313-191180335 CTGTATTAGCAGTGTGAGGACGG + Intergenic
967582913 3:191180313-191180335 CTGTATTAGCAGTGTGAGGACGG + Intergenic
968114709 3:196081018-196081040 CTCTACAAGCAGTAAGCAGAGGG + Intronic
968114709 3:196081018-196081040 CTCTACAAGCAGTAAGCAGAGGG + Intronic
968223972 3:196961025-196961047 CAGTCAAAGCAGCAGGAAGATGG - Intronic
968223972 3:196961025-196961047 CAGTCAAAGCAGCAGGAAGATGG - Intronic
968253232 3:197242760-197242782 CAGCAAAAGCAGTATTAAGCAGG + Intronic
968253232 3:197242760-197242782 CAGCAAAAGCAGTATTAAGCAGG + Intronic
968315574 3:197721735-197721757 CTGCAAAAGTAGTACTAAGAGGG - Intronic
968315574 3:197721735-197721757 CTGCAAAAGTAGTACTAAGAGGG - Intronic
1202748716 3_GL000221v1_random:136127-136149 CATTCAAAGCAGTGTGAAGAGGG - Intergenic
1202748716 3_GL000221v1_random:136127-136149 CATTCAAAGCAGTGTGAAGAGGG - Intergenic
969187371 4:5486429-5486451 TTGTAAAAGCAGTATTAGGGTGG + Intronic
969187371 4:5486429-5486451 TTGTAAAAGCAGTATTAGGGTGG + Intronic
969580801 4:8063767-8063789 CTGGATAAGCTGTTTGAAGAGGG - Intronic
969580801 4:8063767-8063789 CTGGATAAGCTGTTTGAAGAGGG - Intronic
969685405 4:8671224-8671246 CTTTATCAGCAGTATGAAAATGG + Intergenic
969685405 4:8671224-8671246 CTTTATCAGCAGTATGAAAATGG + Intergenic
969726961 4:8925389-8925411 CAGCAAAAGCAGTACCAAGAGGG + Intergenic
969726961 4:8925389-8925411 CAGCAAAAGCAGTACCAAGAGGG + Intergenic
970057568 4:11993029-11993051 CTTCAAAAGCAGTTTTAAGAAGG + Intergenic
970057568 4:11993029-11993051 CTTCAAAAGCAGTTTTAAGAAGG + Intergenic
970080155 4:12273767-12273789 TTGTAAATGAGGTATGAAGAGGG + Intergenic
970080155 4:12273767-12273789 TTGTAAATGAGGTATGAAGAGGG + Intergenic
970204586 4:13643338-13643360 ATGTAAAAAAAGTATGAAAAAGG + Intergenic
970204586 4:13643338-13643360 ATGTAAAAAAAGTATGAAAAAGG + Intergenic
970442828 4:16097705-16097727 CAGTGAAAGCAGTACTAAGAGGG + Intergenic
970442828 4:16097705-16097727 CAGTGAAAGCAGTACTAAGAGGG + Intergenic
970451537 4:16171338-16171360 CTGTGAAAGAAGTAAGAAAATGG - Intronic
970451537 4:16171338-16171360 CTGTGAAAGAAGTAAGAAAATGG - Intronic
970643517 4:18093625-18093647 CAGTTAAAGCAGTGTGTAGAGGG + Intergenic
970643517 4:18093625-18093647 CAGTTAAAGCAGTGTGTAGAGGG + Intergenic
971072093 4:23105669-23105691 CTTTATCAGCAGTATGAAAATGG + Intergenic
971072093 4:23105669-23105691 CTTTATCAGCAGTATGAAAATGG + Intergenic
971243586 4:24909958-24909980 CTTTATAAGCAGCATGAAAACGG + Intronic
971243586 4:24909958-24909980 CTTTATAAGCAGCATGAAAACGG + Intronic
971306301 4:25485038-25485060 CTGTTAAAGCAGACTAAAGATGG + Intergenic
971306301 4:25485038-25485060 CTGTTAAAGCAGACTAAAGATGG + Intergenic
971438403 4:26653019-26653041 CATTCAAAGCAGTATGTAGAAGG - Intronic
971438403 4:26653019-26653041 CATTCAAAGCAGTATGTAGAAGG - Intronic
971649594 4:29255776-29255798 CTATAAAAGCAGCATGAAAATGG + Intergenic
971649594 4:29255776-29255798 CTATAAAAGCAGCATGAAAATGG + Intergenic
971657643 4:29370076-29370098 CTGTGAAAGGATTTTGAAGAAGG + Intergenic
971657643 4:29370076-29370098 CTGTGAAAGGATTTTGAAGAAGG + Intergenic
971807463 4:31378343-31378365 CTTTATCAGCAGTATGAAAACGG + Intergenic
971807463 4:31378343-31378365 CTTTATCAGCAGTATGAAAACGG + Intergenic
971868632 4:32206789-32206811 CTTTATTAGCAGTATGAAAATGG - Intergenic
971868632 4:32206789-32206811 CTTTATTAGCAGTATGAAAATGG - Intergenic
972009697 4:34161772-34161794 CAGCAAAAGCAGTGTTAAGAGGG + Intergenic
972009697 4:34161772-34161794 CAGCAAAAGCAGTGTTAAGAGGG + Intergenic
972236860 4:37145341-37145363 CAGCAAAAGCAGTACCAAGAGGG - Intergenic
972236860 4:37145341-37145363 CAGCAAAAGCAGTACCAAGAGGG - Intergenic
972416968 4:38850219-38850241 CAGTTAAAGCAGTGTGTAGAGGG + Intronic
972416968 4:38850219-38850241 CAGTTAAAGCAGTGTGTAGAGGG + Intronic
972452454 4:39216003-39216025 CTGTTGAAGGAGTATGAAAATGG + Exonic
972452454 4:39216003-39216025 CTGTTGAAGGAGTATGAAAATGG + Exonic
972928693 4:44044000-44044022 TGGTAAAAGCAGTACTAAGAGGG + Intergenic
972928693 4:44044000-44044022 TGGTAAAAGCAGTACTAAGAGGG + Intergenic
972996243 4:44882428-44882450 CTTTCAAAGCAGTGTGTAGAGGG + Intergenic
972996243 4:44882428-44882450 CTTTCAAAGCAGTGTGTAGAGGG + Intergenic
972996823 4:44890349-44890371 CTGTGAAAGCAATATTAAGAGGG - Intergenic
972996823 4:44890349-44890371 CTGTGAAAGCAATATTAAGAGGG - Intergenic
973065702 4:45789069-45789091 CTGCAAAAGCAGTACTAAGAGGG + Intergenic
973065702 4:45789069-45789091 CTGCAAAAGCAGTACTAAGAGGG + Intergenic
973115876 4:46458361-46458383 CTGCAAAAGCAGTTTTAAGAGGG + Intronic
973115876 4:46458361-46458383 CTGCAAAAGCAGTTTTAAGAGGG + Intronic
973678996 4:53296789-53296811 CTTTTAAAGCAGTGTGCAGAGGG - Intronic
973678996 4:53296789-53296811 CTTTTAAAGCAGTGTGCAGAGGG - Intronic
973763624 4:54143673-54143695 CAGCAAAAGCAGTACTAAGAGGG + Intronic
973763624 4:54143673-54143695 CAGCAAAAGCAGTACTAAGAGGG + Intronic
973853839 4:54990044-54990066 CAGTAAAAGCAGTGCTAAGAGGG + Intergenic
973853839 4:54990044-54990066 CAGTAAAAGCAGTGCTAAGAGGG + Intergenic
974023939 4:56715602-56715624 CAGTTAAAGCAGTGTGTAGAGGG + Intergenic
974023939 4:56715602-56715624 CAGTTAAAGCAGTGTGTAGAGGG + Intergenic
974101535 4:57422675-57422697 CTGTAAAAGCAGCCAGGAGAGGG + Intergenic
974101535 4:57422675-57422697 CTGTAAAAGCAGCCAGGAGAGGG + Intergenic
974111852 4:57535006-57535028 CATTCAAAGCAGTATGTAGAGGG - Intergenic
974111852 4:57535006-57535028 CATTCAAAGCAGTATGTAGAGGG - Intergenic
974180947 4:58384107-58384129 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
974180947 4:58384107-58384129 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
974257614 4:59480983-59481005 CAGTAAAAGCAGTACTAAGAAGG + Intergenic
974257614 4:59480983-59481005 CAGTAAAAGCAGTACTAAGAAGG + Intergenic
974265859 4:59584867-59584889 CATTTAAAGCAGTGTGAAGAGGG + Intergenic
974265859 4:59584867-59584889 CATTTAAAGCAGTGTGAAGAGGG + Intergenic
974290944 4:59929501-59929523 CAGTGAAAGCAGTACTAAGAGGG + Intergenic
974290944 4:59929501-59929523 CAGTGAAAGCAGTACTAAGAGGG + Intergenic
974678896 4:65136211-65136233 CAGGAAAAGCAGTACTAAGAAGG + Intergenic
974678896 4:65136211-65136233 CAGGAAAAGCAGTACTAAGAAGG + Intergenic
974899460 4:67979468-67979490 CAGTTAAAGCAGTGTTAAGAGGG - Intergenic
974899460 4:67979468-67979490 CAGTTAAAGCAGTGTTAAGAGGG - Intergenic
975063338 4:70032602-70032624 CTCTAATATCAGTATGAATAGGG + Intronic
975063338 4:70032602-70032624 CTCTAATATCAGTATGAATAGGG + Intronic
975308004 4:72870862-72870884 CAGCAAAAGCAGTGTGCAGAGGG + Intergenic
975308004 4:72870862-72870884 CAGCAAAAGCAGTGTGCAGAGGG + Intergenic
975630070 4:76391519-76391541 CAGTGAAAGCAGTACAAAGAGGG + Intronic
975630070 4:76391519-76391541 CAGTGAAAGCAGTACAAAGAGGG + Intronic
975803323 4:78086265-78086287 CATTAAAAGCAGTGTGTAGAGGG + Intronic
975803323 4:78086265-78086287 CATTAAAAGCAGTGTGTAGAGGG + Intronic
975806251 4:78115981-78116003 CATTAAAAGCAGTGTGTAGACGG - Intronic
975806251 4:78115981-78116003 CATTAAAAGCAGTGTGTAGACGG - Intronic
976041366 4:80888963-80888985 CAGCAAAAGCAGTATTCAGAGGG + Intronic
976041366 4:80888963-80888985 CAGCAAAAGCAGTATTCAGAGGG + Intronic
976253921 4:83081433-83081455 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
976253921 4:83081433-83081455 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
976295675 4:83468878-83468900 CAGTAACAGGAGTATGAGGAAGG + Intronic
976295675 4:83468878-83468900 CAGTAACAGGAGTATGAGGAAGG + Intronic
976310858 4:83611734-83611756 CAGCAAAAGCAGTATTAAGAGGG - Intergenic
976310858 4:83611734-83611756 CAGCAAAAGCAGTATTAAGAGGG - Intergenic
976487495 4:85625223-85625245 CATTCAAAGCAGTATGTAGAGGG - Intronic
976487495 4:85625223-85625245 CATTCAAAGCAGTATGTAGAGGG - Intronic
976880449 4:89916722-89916744 CTTTAAAATCAGTGAGAAGAAGG - Intronic
976880449 4:89916722-89916744 CTTTAAAATCAGTGAGAAGAAGG - Intronic
976910071 4:90293115-90293137 GTGTAAAAGATGTATAAAGATGG - Intronic
976910071 4:90293115-90293137 GTGTAAAAGATGTATAAAGATGG - Intronic
976974634 4:91151625-91151647 CAGTTAAAGCAGTGTGTAGAGGG - Intronic
976974634 4:91151625-91151647 CAGTTAAAGCAGTGTGTAGAGGG - Intronic
977014034 4:91670161-91670183 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
977014034 4:91670161-91670183 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
977053843 4:92164174-92164196 CTTTATCAGCAGTGTGAAGATGG - Intergenic
977053843 4:92164174-92164196 CTTTATCAGCAGTGTGAAGATGG - Intergenic
977270473 4:94911919-94911941 CTTTATAAGCAGCATGAAAAAGG - Intronic
977270473 4:94911919-94911941 CTTTATAAGCAGCATGAAAAAGG - Intronic
977470392 4:97435746-97435768 CTTTATCAGCAGTATGAAAATGG + Intronic
977470392 4:97435746-97435768 CTTTATCAGCAGTATGAAAATGG + Intronic
977514949 4:98010242-98010264 CAGTGAAAGCAGTGTCAAGAGGG - Intronic
977514949 4:98010242-98010264 CAGTGAAAGCAGTGTCAAGAGGG - Intronic
977515262 4:98014121-98014143 CAGCTAAAGCAGTATTAAGAGGG - Intronic
977515262 4:98014121-98014143 CAGCTAAAGCAGTATTAAGAGGG - Intronic
977563027 4:98552343-98552365 CTGCAAAAGCAGTACTAAGAGGG - Intronic
977563027 4:98552343-98552365 CTGCAAAAGCAGTACTAAGAGGG - Intronic
977855016 4:101878942-101878964 CAGCAAAAGCAGTACTAAGAGGG + Intronic
977855016 4:101878942-101878964 CAGCAAAAGCAGTACTAAGAGGG + Intronic
977873309 4:102119911-102119933 CAGTGAAAGCAGTACTAAGAGGG - Intergenic
977873309 4:102119911-102119933 CAGTGAAAGCAGTACTAAGAGGG - Intergenic
978117420 4:105037594-105037616 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
978117420 4:105037594-105037616 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
978137941 4:105285837-105285859 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
978137941 4:105285837-105285859 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
978252273 4:106646488-106646510 CAGGAAAAGCAGTACTAAGAGGG - Intergenic
978252273 4:106646488-106646510 CAGGAAAAGCAGTACTAAGAGGG - Intergenic
978709969 4:111768152-111768174 CAGTTAAAGCAGTATTAAGAGGG - Intergenic
978709969 4:111768152-111768174 CAGTTAAAGCAGTATTAAGAGGG - Intergenic
978743084 4:112161151-112161173 CAGTTAAAGCAGTGTGTAGAGGG + Intronic
978743084 4:112161151-112161173 CAGTTAAAGCAGTGTGTAGAGGG + Intronic
978752812 4:112271497-112271519 CAGCAAAAGCAGTATCAGGATGG - Intergenic
978752812 4:112271497-112271519 CAGCAAAAGCAGTATCAGGATGG - Intergenic
978792334 4:112675814-112675836 CTGTAAAAGAAGGATGCAGATGG - Intergenic
978792334 4:112675814-112675836 CTGTAAAAGAAGGATGCAGATGG - Intergenic
978904441 4:113989001-113989023 CATTCAAAGCAGTATGTAGAGGG + Intergenic
978904441 4:113989001-113989023 CATTCAAAGCAGTATGTAGAGGG + Intergenic
979512513 4:121570285-121570307 CATTTAAAGCAGTATGTAGAGGG + Intergenic
979512513 4:121570285-121570307 CATTTAAAGCAGTATGTAGAGGG + Intergenic
979594740 4:122522117-122522139 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
979594740 4:122522117-122522139 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
979628250 4:122870974-122870996 CAGCTAAAGCAGTATTAAGAGGG - Intronic
979628250 4:122870974-122870996 CAGCTAAAGCAGTATTAAGAGGG - Intronic
979747896 4:124240218-124240240 CATTTAAAGCAGTATGTAGAGGG + Intergenic
979747896 4:124240218-124240240 CATTTAAAGCAGTATGTAGAGGG + Intergenic
979793382 4:124814577-124814599 CTTTATAAGCAGCATGAAAATGG - Intergenic
979793382 4:124814577-124814599 CTTTATAAGCAGCATGAAAATGG - Intergenic
979879237 4:125933495-125933517 CAGCAAAGGCAGTATTAAGAAGG + Intergenic
979879237 4:125933495-125933517 CAGCAAAGGCAGTATTAAGAAGG + Intergenic
980477131 4:133332701-133332723 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
980477131 4:133332701-133332723 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
980489668 4:133508515-133508537 CAGCTAAAGCAGTATTAAGAGGG + Intergenic
980489668 4:133508515-133508537 CAGCTAAAGCAGTATTAAGAGGG + Intergenic
980514710 4:133840625-133840647 CAATAAAAGCAGTGTTAAGAGGG - Intergenic
980514710 4:133840625-133840647 CAATAAAAGCAGTGTTAAGAGGG - Intergenic
980542315 4:134210754-134210776 CAGTCAAAGCAGTGTGTAGAGGG + Intergenic
980542315 4:134210754-134210776 CAGTCAAAGCAGTGTGTAGAGGG + Intergenic
980731795 4:136833385-136833407 CTTTAACAGCAGTGTGAAGACGG + Intergenic
980731795 4:136833385-136833407 CTTTAACAGCAGTGTGAAGACGG + Intergenic
981076555 4:140598301-140598323 CTGTAAAAGCATTCTAAAGGGGG + Intergenic
981076555 4:140598301-140598323 CTGTAAAAGCATTCTAAAGGGGG + Intergenic
981517962 4:145630801-145630823 CAGCAAAAGCAGTACTAAGAGGG - Intronic
981517962 4:145630801-145630823 CAGCAAAAGCAGTACTAAGAGGG - Intronic
981832462 4:149018097-149018119 CTTCAACAGCAGTATGAAAATGG - Intergenic
981832462 4:149018097-149018119 CTTCAACAGCAGTATGAAAATGG - Intergenic
981947383 4:150363592-150363614 CTGTATAACCAGTATGTAGTAGG + Intronic
981947383 4:150363592-150363614 CTGTATAACCAGTATGTAGTAGG + Intronic
982063822 4:151632818-151632840 CAGTGAAAGCAGTACTAAGAGGG + Intronic
982063822 4:151632818-151632840 CAGTGAAAGCAGTACTAAGAGGG + Intronic
982278961 4:153664652-153664674 CTCTAAGTGCAGTATGGAGAAGG + Intergenic
982278961 4:153664652-153664674 CTCTAAGTGCAGTATGGAGAAGG + Intergenic
983069261 4:163249839-163249861 CTTTAACAGCAGCATGAAAATGG - Intergenic
983069261 4:163249839-163249861 CTTTAACAGCAGCATGAAAATGG - Intergenic
983169317 4:164518185-164518207 CAGTTAAAGCAGTGTTAAGAGGG - Intergenic
983169317 4:164518185-164518207 CAGTTAAAGCAGTGTTAAGAGGG - Intergenic
983179725 4:164633430-164633452 CTGCTAAAGCAGTGTTAAGAGGG + Intergenic
983179725 4:164633430-164633452 CTGCTAAAGCAGTGTTAAGAGGG + Intergenic
983315795 4:166131715-166131737 CAGATAAAGCAGTATTAAGAGGG - Intergenic
983315795 4:166131715-166131737 CAGATAAAGCAGTATTAAGAGGG - Intergenic
983473816 4:168190168-168190190 CAGTAAAAGCAGTGCTAAGAAGG + Intergenic
983473816 4:168190168-168190190 CAGTAAAAGCAGTGCTAAGAAGG + Intergenic
983594992 4:169456206-169456228 CAGCAAAAGCAGTACTAAGACGG + Intronic
983594992 4:169456206-169456228 CAGCAAAAGCAGTACTAAGACGG + Intronic
983700229 4:170582997-170583019 CATTTAAAGCAGTATGAAGAAGG + Intergenic
983700229 4:170582997-170583019 CATTTAAAGCAGTATGAAGAAGG + Intergenic
983808136 4:172020156-172020178 CAATAAAAGCAGTACTAAGATGG + Intronic
983808136 4:172020156-172020178 CAATAAAAGCAGTACTAAGATGG + Intronic
983877560 4:172894348-172894370 CAGCAAAAGCAGTACTAAGAGGG - Intronic
983877560 4:172894348-172894370 CAGCAAAAGCAGTACTAAGAGGG - Intronic
983972103 4:173888209-173888231 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
983972103 4:173888209-173888231 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
984235864 4:177157905-177157927 CAGCAAAAGCAGTACTAAGAAGG + Intergenic
984235864 4:177157905-177157927 CAGCAAAAGCAGTACTAAGAAGG + Intergenic
984287597 4:177752453-177752475 CAGTAAAAGCAGTTGTAAGAGGG + Intronic
984287597 4:177752453-177752475 CAGTAAAAGCAGTTGTAAGAGGG + Intronic
984326981 4:178267819-178267841 CTGTATTAGCAGCATGAAAATGG - Intergenic
984326981 4:178267819-178267841 CTGTATTAGCAGCATGAAAATGG - Intergenic
985155933 4:186987270-186987292 CTGTGAAAGCAGTCAGGAGAGGG - Intergenic
985155933 4:186987270-186987292 CTGTGAAAGCAGTCAGGAGAGGG - Intergenic
985253710 4:188048170-188048192 CTGCCAAAGCAGTATCTAGAGGG + Intergenic
985253710 4:188048170-188048192 CTGCCAAAGCAGTATCTAGAGGG + Intergenic
986113474 5:4745330-4745352 TAGCAAAAGCAGTATTAAGAGGG - Intergenic
986113474 5:4745330-4745352 TAGCAAAAGCAGTATTAAGAGGG - Intergenic
986654131 5:9993695-9993717 CATTTAAAGCAGTATGCAGAGGG + Intergenic
986654131 5:9993695-9993717 CATTTAAAGCAGTATGCAGAGGG + Intergenic
986884965 5:12222818-12222840 CAGCAAAAGCAGTACGAAGTGGG - Intergenic
986884965 5:12222818-12222840 CAGCAAAAGCAGTACGAAGTGGG - Intergenic
986907310 5:12510778-12510800 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
986907310 5:12510778-12510800 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
987172624 5:15274252-15274274 CATTCAAAGCAGTATGTAGAGGG + Intergenic
987172624 5:15274252-15274274 CATTCAAAGCAGTATGTAGAGGG + Intergenic
987306957 5:16646356-16646378 CAGTCAAAGCAGTGTGTAGAGGG - Intergenic
987306957 5:16646356-16646378 CAGTCAAAGCAGTGTGTAGAGGG - Intergenic
987444919 5:18005925-18005947 CATTTAAAGCAGTATGTAGAAGG - Intergenic
987444919 5:18005925-18005947 CATTTAAAGCAGTATGTAGAAGG - Intergenic
987496318 5:18649648-18649670 CAGCAAAAGCAGTACTAAGAAGG - Intergenic
987496318 5:18649648-18649670 CAGCAAAAGCAGTACTAAGAAGG - Intergenic
987554561 5:19430571-19430593 CTTTATAAGCAGTGTGAAAACGG + Intergenic
987554561 5:19430571-19430593 CTTTATAAGCAGTGTGAAAACGG + Intergenic
987675350 5:21066177-21066199 TTGTAAAAGCAGGAGGAAGAGGG - Intergenic
987675350 5:21066177-21066199 TTGTAAAAGCAGGAGGAAGAGGG - Intergenic
988021784 5:25630224-25630246 CAGCTAAAGCAGTATTAAGAGGG + Intergenic
988021784 5:25630224-25630246 CAGCTAAAGCAGTATTAAGAGGG + Intergenic
988080715 5:26411095-26411117 TTGTTAAAGCAGTTGGAAGAGGG + Intergenic
988080715 5:26411095-26411117 TTGTTAAAGCAGTTGGAAGAGGG + Intergenic
988091681 5:26549600-26549622 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
988091681 5:26549600-26549622 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
988310711 5:29553636-29553658 CAGTAAAAGCAGCATTAACAGGG - Intergenic
988310711 5:29553636-29553658 CAGTAAAAGCAGCATTAACAGGG - Intergenic
988700951 5:33673968-33673990 CTGTGAACCAAGTATGAAGAAGG - Intronic
988700951 5:33673968-33673990 CTGTGAACCAAGTATGAAGAAGG - Intronic
988744523 5:34121314-34121336 CTTTATAAGCAGCATGAAAATGG - Intronic
988744523 5:34121314-34121336 CTTTATAAGCAGCATGAAAATGG - Intronic
988955967 5:36319760-36319782 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
988955967 5:36319760-36319782 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
989086048 5:37677386-37677408 CATTCAAAGCAGTATGGAGAGGG - Intronic
989086048 5:37677386-37677408 CATTCAAAGCAGTATGGAGAGGG - Intronic
989215179 5:38897767-38897789 CAGCAAAAGCAGTACTAAGAAGG - Intronic
989215179 5:38897767-38897789 CAGCAAAAGCAGTACTAAGAAGG - Intronic
989284665 5:39685667-39685689 CATTAAAAGCAGTGTGCAGAGGG - Intergenic
989284665 5:39685667-39685689 CATTAAAAGCAGTGTGCAGAGGG - Intergenic
989428111 5:41319601-41319623 CAGCAAAAGCAGTACTAAGAAGG + Intronic
989428111 5:41319601-41319623 CAGCAAAAGCAGTACTAAGAAGG + Intronic
989562277 5:42865787-42865809 CATTTAAAGCAGTATGTAGAGGG + Intronic
989562277 5:42865787-42865809 CATTTAAAGCAGTATGTAGAGGG + Intronic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
989946249 5:50233081-50233103 CATTCAAAGCAGTGTGAAGAGGG + Intergenic
989946249 5:50233081-50233103 CATTCAAAGCAGTGTGAAGAGGG + Intergenic
990077723 5:51872279-51872301 CTGTATTAGCAGCATGAAAATGG + Intergenic
990077723 5:51872279-51872301 CTGTATTAGCAGCATGAAAATGG + Intergenic
990109289 5:52304364-52304386 CTGCAATACCAGTATGTAGATGG - Intergenic
990109289 5:52304364-52304386 CTGCAATACCAGTATGTAGATGG - Intergenic
990113801 5:52363578-52363600 CTCTTAAAGCAGTATGGAAATGG - Intergenic
990113801 5:52363578-52363600 CTCTTAAAGCAGTATGGAAATGG - Intergenic
990125609 5:52513575-52513597 CAGTAAAAGCAGTACCAAAAGGG + Intergenic
990125609 5:52513575-52513597 CAGTAAAAGCAGTACCAAAAGGG + Intergenic
990126957 5:52531078-52531100 CCATAAAAGCAGCATGAAAATGG - Intergenic
990126957 5:52531078-52531100 CCATAAAAGCAGCATGAAAATGG - Intergenic
990198276 5:53343077-53343099 CTTTATAAGCAGCATGAAAATGG + Intergenic
990198276 5:53343077-53343099 CTTTATAAGCAGCATGAAAATGG + Intergenic
990264752 5:54062702-54062724 CTTTATCAGCAGTATGAAAATGG + Intronic
990264752 5:54062702-54062724 CTTTATCAGCAGTATGAAAATGG + Intronic
990657127 5:57969766-57969788 CATTAAAAGCAGTGTGTAGAAGG - Intergenic
990657127 5:57969766-57969788 CATTAAAAGCAGTGTGTAGAAGG - Intergenic
990841212 5:60081542-60081564 CAGTTAAAGCAGTATTAAGAGGG - Intronic
990841212 5:60081542-60081564 CAGTTAAAGCAGTATTAAGAGGG - Intronic
991072957 5:62506251-62506273 CTGAAAAAGTAGTGTGAACATGG - Exonic
991072957 5:62506251-62506273 CTGAAAAAGTAGTGTGAACATGG - Exonic
991267371 5:64737421-64737443 CTGCAAAAGCAGTACTAAAAGGG + Intronic
991267371 5:64737421-64737443 CTGCAAAAGCAGTACTAAAAGGG + Intronic
991394913 5:66194779-66194801 CAGCAAAAGCAGTACTAAGAAGG - Intergenic
991394913 5:66194779-66194801 CAGCAAAAGCAGTACTAAGAAGG - Intergenic
991421514 5:66447423-66447445 CATTCAAAGCAGTATGTAGAGGG - Intergenic
991421514 5:66447423-66447445 CATTCAAAGCAGTATGTAGAGGG - Intergenic
991508169 5:67347021-67347043 CAGCAAAAGTAGTTTGAAGAGGG + Intergenic
991508169 5:67347021-67347043 CAGCAAAAGTAGTTTGAAGAGGG + Intergenic
991544760 5:67769721-67769743 CTTTATCAGCAGTATGAAAACGG - Intergenic
991544760 5:67769721-67769743 CTTTATCAGCAGTATGAAAACGG - Intergenic
991571812 5:68062667-68062689 CATTTAAAGCAGTATGTAGAGGG + Intergenic
991571812 5:68062667-68062689 CATTTAAAGCAGTATGTAGAGGG + Intergenic
991576120 5:68105215-68105237 CATTTAAAGCAGTATGTAGACGG + Intergenic
991576120 5:68105215-68105237 CATTTAAAGCAGTATGTAGACGG + Intergenic
991681496 5:69144512-69144534 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
991681496 5:69144512-69144534 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
992016495 5:72580284-72580306 CAGTCAAAGCAGTGTGTAGAGGG + Intergenic
992016495 5:72580284-72580306 CAGTCAAAGCAGTGTGTAGAGGG + Intergenic
992122692 5:73610928-73610950 CTGTATCAGCAGCATGAAAACGG - Intergenic
992122692 5:73610928-73610950 CTGTATCAGCAGCATGAAAACGG - Intergenic
992185962 5:74244916-74244938 CTTTAAAAGCTGGACGAAGAAGG - Intergenic
992185962 5:74244916-74244938 CTTTAAAAGCTGGACGAAGAAGG - Intergenic
992692240 5:79252116-79252138 CAGCAAAAGCAGTACCAAGAGGG - Intronic
992692240 5:79252116-79252138 CAGCAAAAGCAGTACCAAGAGGG - Intronic
992700680 5:79338879-79338901 CATTTAAAGCAGTATGTAGAGGG - Intergenic
992700680 5:79338879-79338901 CATTTAAAGCAGTATGTAGAGGG - Intergenic
993068248 5:83127596-83127618 CTTTATCAGCAGTATGAAAACGG + Intronic
993068248 5:83127596-83127618 CTTTATCAGCAGTATGAAAACGG + Intronic
993364170 5:87016566-87016588 CTGTAAAAAGAGAAAGAAGAAGG + Intergenic
993364170 5:87016566-87016588 CTGTAAAAAGAGAAAGAAGAAGG + Intergenic
993402327 5:87469027-87469049 CTGTAAAAGAAGTCTGGTGAAGG - Intergenic
993402327 5:87469027-87469049 CTGTAAAAGAAGTCTGGTGAAGG - Intergenic
993442263 5:87972296-87972318 CTTTAACAGCAGCATGAAAATGG - Intergenic
993442263 5:87972296-87972318 CTTTAACAGCAGCATGAAAATGG - Intergenic
993528020 5:88990572-88990594 CATTTAAAGCAGTATGTAGAGGG - Intergenic
993528020 5:88990572-88990594 CATTTAAAGCAGTATGTAGAGGG - Intergenic
993798486 5:92300120-92300142 CATTGAAAGCAGTATGTAGAGGG - Intergenic
993798486 5:92300120-92300142 CATTGAAAGCAGTATGTAGAGGG - Intergenic
994226501 5:97257596-97257618 CAGTGAAAGCAGTATTAACATGG + Intergenic
994226501 5:97257596-97257618 CAGTGAAAGCAGTATTAACATGG + Intergenic
994266307 5:97720941-97720963 CATTAAAAGCAGTGTGAAGAGGG - Intergenic
994266307 5:97720941-97720963 CATTAAAAGCAGTGTGAAGAGGG - Intergenic
994280820 5:97900305-97900327 CATTAAAAGCAGTGTGTAGAGGG - Intergenic
994280820 5:97900305-97900327 CATTAAAAGCAGTGTGTAGAGGG - Intergenic
994288109 5:97994295-97994317 CATTAAAAGCAGTGTGTAGAGGG + Intergenic
994288109 5:97994295-97994317 CATTAAAAGCAGTGTGTAGAGGG + Intergenic
994290676 5:98025585-98025607 CATTAAAAGCAGTGTGTAGAGGG + Intergenic
994290676 5:98025585-98025607 CATTAAAAGCAGTGTGTAGAGGG + Intergenic
994577551 5:101598173-101598195 CTGCAAAAGCAGTCTTAAGATGG + Intergenic
994577551 5:101598173-101598195 CTGCAAAAGCAGTCTTAAGATGG + Intergenic
994656071 5:102594253-102594275 CTTTAACAGCAGTATGAAAATGG - Intergenic
994656071 5:102594253-102594275 CTTTAACAGCAGTATGAAAATGG - Intergenic
994835892 5:104851751-104851773 CAGTTAAAGCAGTGTGTAGAGGG - Intergenic
994835892 5:104851751-104851773 CAGTTAAAGCAGTGTGTAGAGGG - Intergenic
994973551 5:106774132-106774154 CATTCAAAGCAGTATGTAGAGGG - Intergenic
994973551 5:106774132-106774154 CATTCAAAGCAGTATGTAGAGGG - Intergenic
995171737 5:109122219-109122241 CAGCAAAAGCAGTACTAAGAGGG - Intronic
995171737 5:109122219-109122241 CAGCAAAAGCAGTACTAAGAGGG - Intronic
995271961 5:110230586-110230608 CAGCAAAAGCAGTATTAAGAAGG + Intergenic
995271961 5:110230586-110230608 CAGCAAAAGCAGTATTAAGAAGG + Intergenic
995585975 5:113648788-113648810 CATTTAAAGCAGTATGTAGAGGG + Intergenic
995585975 5:113648788-113648810 CATTTAAAGCAGTATGTAGAGGG + Intergenic
995593780 5:113727388-113727410 CAGTTAAAGCAGTGTTAAGAGGG - Intergenic
995593780 5:113727388-113727410 CAGTTAAAGCAGTGTTAAGAGGG - Intergenic
996085106 5:119297257-119297279 CTTTCAAAGCAGTGTGTAGAGGG - Intronic
996085106 5:119297257-119297279 CTTTCAAAGCAGTGTGTAGAGGG - Intronic
996162566 5:120183449-120183471 CAGTAAAAGCAGTATTCAGGGGG + Intergenic
996162566 5:120183449-120183471 CAGTAAAAGCAGTATTCAGGGGG + Intergenic
996166005 5:120224866-120224888 CAGTGAAAGCAGTACTAAGATGG - Intergenic
996166005 5:120224866-120224888 CAGTGAAAGCAGTACTAAGATGG - Intergenic
996359858 5:122633943-122633965 CATTTAAAGCAGTATGCAGAGGG - Intergenic
996359858 5:122633943-122633965 CATTTAAAGCAGTATGCAGAGGG - Intergenic
996459814 5:123728700-123728722 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
996459814 5:123728700-123728722 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
996968571 5:129335029-129335051 CTGCAAAAGCAGTACTATGAGGG + Intergenic
996968571 5:129335029-129335051 CTGCAAAAGCAGTACTATGAGGG + Intergenic
997115272 5:131119989-131120011 CATTCAAAGCAGTGTGAAGAGGG - Intergenic
997115272 5:131119989-131120011 CATTCAAAGCAGTGTGAAGAGGG - Intergenic
997274456 5:132573216-132573238 CTTTAACAGCAGTGTGAAAATGG - Intronic
997274456 5:132573216-132573238 CTTTAACAGCAGTGTGAAAATGG - Intronic
997289375 5:132715756-132715778 CTGAAAAAGAAGCTTGAAGAAGG - Exonic
997289375 5:132715756-132715778 CTGAAAAAGAAGCTTGAAGAAGG - Exonic
997671365 5:135676610-135676632 CTGCAAAAGCAGTGTTGAGAAGG - Intergenic
997671365 5:135676610-135676632 CTGCAAAAGCAGTGTTGAGAAGG - Intergenic
997861408 5:137420948-137420970 CATTCAAAGCAGTATGTAGAGGG - Intronic
997861408 5:137420948-137420970 CATTCAAAGCAGTATGTAGAGGG - Intronic
997901258 5:137767327-137767349 CAGTGAAAGCAGTACTAAGAGGG + Intergenic
997901258 5:137767327-137767349 CAGTGAAAGCAGTACTAAGAGGG + Intergenic
998873073 5:146572170-146572192 CAGTTAAAGCAGTGTTAAGAGGG - Intergenic
998873073 5:146572170-146572192 CAGTTAAAGCAGTGTTAAGAGGG - Intergenic
999028594 5:148263815-148263837 CTTTATCAGCAGTATGAAAATGG - Intergenic
999028594 5:148263815-148263837 CTTTATCAGCAGTATGAAAATGG - Intergenic
999072214 5:148756747-148756769 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
999072214 5:148756747-148756769 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
999349348 5:150853096-150853118 CTGTAAAAGCAGTATGAAGAGGG - Intronic
999349348 5:150853096-150853118 CTGTAAAAGCAGTATGAAGAGGG - Intronic
999437656 5:151576107-151576129 CTATTAAAGCAGAATGAAAAGGG + Intergenic
999437656 5:151576107-151576129 CTATTAAAGCAGAATGAAAAGGG + Intergenic
999603590 5:153293799-153293821 CTTTCAAAGCAGTGTGTAGAGGG - Intergenic
999603590 5:153293799-153293821 CTTTCAAAGCAGTGTGTAGAGGG - Intergenic
999666095 5:153915237-153915259 CAGTTAAAGCAGTGTTAAGAGGG - Intergenic
999666095 5:153915237-153915259 CAGTTAAAGCAGTGTTAAGAGGG - Intergenic
999849311 5:155521259-155521281 CAGTGAAAGCAGTACTAAGATGG - Intergenic
999849311 5:155521259-155521281 CAGTGAAAGCAGTACTAAGATGG - Intergenic
999919671 5:156304563-156304585 CTTTATCAGCAGTATGAAAATGG + Intronic
999919671 5:156304563-156304585 CTTTATCAGCAGTATGAAAATGG + Intronic
999938905 5:156518842-156518864 CAGTTAAAGCAGTGTTAAGAGGG + Intronic
999938905 5:156518842-156518864 CAGTTAAAGCAGTGTTAAGAGGG + Intronic
1000158967 5:158581673-158581695 GAGCAAAAGCAGTATTAAGAGGG - Intergenic
1000158967 5:158581673-158581695 GAGCAAAAGCAGTATTAAGAGGG - Intergenic
1000707172 5:164526327-164526349 CTGTGATAGCAGAGTGAAGAGGG - Intergenic
1000707172 5:164526327-164526349 CTGTGATAGCAGAGTGAAGAGGG - Intergenic
1001130034 5:169056160-169056182 AGGTAAAAGCATTATGCAGAAGG + Intronic
1001130034 5:169056160-169056182 AGGTAAAAGCATTATGCAGAAGG + Intronic
1001734113 5:173984802-173984824 CTGTATGAGCAGTATGAGAATGG - Intronic
1001734113 5:173984802-173984824 CTGTATGAGCAGTATGAGAATGG - Intronic
1002336075 5:178479210-178479232 CTGTAAAATGGGTATGAATAAGG - Intronic
1002336075 5:178479210-178479232 CTGTAAAATGGGTATGAATAAGG - Intronic
1002551683 5:179998232-179998254 CAGCAAAAGCAGTTTGAAGAAGG - Intronic
1002551683 5:179998232-179998254 CAGCAAAAGCAGTTTGAAGAAGG - Intronic
1002646054 5:180655780-180655802 CCGCAAAAGCAGTACTAAGAGGG - Intergenic
1002646054 5:180655780-180655802 CCGCAAAAGCAGTACTAAGAGGG - Intergenic
1002757289 6:173702-173724 CTTTATCAGCAGTATGAAAATGG + Intergenic
1002757289 6:173702-173724 CTTTATCAGCAGTATGAAAATGG + Intergenic
1003434137 6:6069871-6069893 CATTTAAAGCAGTATGTAGAGGG - Intergenic
1003434137 6:6069871-6069893 CATTTAAAGCAGTATGTAGAGGG - Intergenic
1003586725 6:7396831-7396853 CTGTAAAAGAATTATGATCAAGG - Intronic
1003586725 6:7396831-7396853 CTGTAAAAGAATTATGATCAAGG - Intronic
1003659479 6:8046341-8046363 CTTTATAAGCAGCATGAAAATGG + Intronic
1003659479 6:8046341-8046363 CTTTATAAGCAGCATGAAAATGG + Intronic
1003686804 6:8312452-8312474 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
1003686804 6:8312452-8312474 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
1003775481 6:9356946-9356968 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1003775481 6:9356946-9356968 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1004273466 6:14214851-14214873 CTATCCAAGCAGAATGAAGAGGG + Intergenic
1004273466 6:14214851-14214873 CTATCCAAGCAGAATGAAGAGGG + Intergenic
1004764245 6:18707553-18707575 CAGCAAAAGCAGTGTGAATAGGG - Intergenic
1004764245 6:18707553-18707575 CAGCAAAAGCAGTGTGAATAGGG - Intergenic
1004772864 6:18805306-18805328 CAGTAAAAGCAGTGTTTAGAGGG - Intergenic
1004772864 6:18805306-18805328 CAGTAAAAGCAGTGTTTAGAGGG - Intergenic
1005094169 6:22094606-22094628 CTTTATCAGCAGTATGAAAACGG - Intergenic
1005094169 6:22094606-22094628 CTTTATCAGCAGTATGAAAACGG - Intergenic
1005100659 6:22169522-22169544 CATTAAAAGCAGTGTGTAGAGGG - Intergenic
1005100659 6:22169522-22169544 CATTAAAAGCAGTGTGTAGAGGG - Intergenic
1005113469 6:22312173-22312195 CTTTATAAGCAGTGTGAAAATGG - Intergenic
1005113469 6:22312173-22312195 CTTTATAAGCAGTGTGAAAATGG - Intergenic
1005122196 6:22402023-22402045 CTTTAATAGCAGTGTGAAAATGG + Intergenic
1005122196 6:22402023-22402045 CTTTAATAGCAGTGTGAAAATGG + Intergenic
1005689677 6:28290941-28290963 CTGCAAAAGCAGTACTAAGAAGG + Intronic
1005689677 6:28290941-28290963 CTGCAAAAGCAGTACTAAGAAGG + Intronic
1005743088 6:28810898-28810920 CTGTAACAGGACTAAGAAGACGG - Intergenic
1005743088 6:28810898-28810920 CTGTAACAGGACTAAGAAGACGG - Intergenic
1006462328 6:34168694-34168716 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1006462328 6:34168694-34168716 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1006630455 6:35426839-35426861 CTGGCAAACCAGTGTGAAGATGG - Exonic
1006630455 6:35426839-35426861 CTGGCAAACCAGTGTGAAGATGG - Exonic
1006989402 6:38200259-38200281 CTGCAAAAGCAGTACTCAGAGGG + Intronic
1006989402 6:38200259-38200281 CTGCAAAAGCAGTACTCAGAGGG + Intronic
1007879728 6:45151019-45151041 CTTTGAAAGCAGTATAAAGATGG - Intronic
1007879728 6:45151019-45151041 CTTTGAAAGCAGTATAAAGATGG - Intronic
1008018091 6:46543804-46543826 CAGAAAAAGCAGTATTAAAAGGG + Intergenic
1008018091 6:46543804-46543826 CAGAAAAAGCAGTATTAAAAGGG + Intergenic
1008154019 6:47990700-47990722 CTTTATCAGCAGTATGAAAATGG + Intronic
1008154019 6:47990700-47990722 CTTTATCAGCAGTATGAAAATGG + Intronic
1008236806 6:49060625-49060647 CATTCAAAGCAGTATGTAGAGGG + Intergenic
1008236806 6:49060625-49060647 CATTCAAAGCAGTATGTAGAGGG + Intergenic
1008242128 6:49126740-49126762 CTTTATCAGCAGTATGAAAATGG + Intergenic
1008242128 6:49126740-49126762 CTTTATCAGCAGTATGAAAATGG + Intergenic
1008281529 6:49601508-49601530 CATTTAAAGCAGTATGTAGAGGG + Intergenic
1008281529 6:49601508-49601530 CATTTAAAGCAGTATGTAGAGGG + Intergenic
1008329335 6:50226457-50226479 CTTTCAAAGCAGTGTGTAGAGGG - Intergenic
1008329335 6:50226457-50226479 CTTTCAAAGCAGTGTGTAGAGGG - Intergenic
1008406547 6:51124415-51124437 CAGTCAAAGCAGTGTGTAGAGGG + Intergenic
1008406547 6:51124415-51124437 CAGTCAAAGCAGTGTGTAGAGGG + Intergenic
1008411079 6:51180418-51180440 CTTTAACAGCAGCATGAAAATGG + Intergenic
1008411079 6:51180418-51180440 CTTTAACAGCAGCATGAAAATGG + Intergenic
1008631407 6:53365936-53365958 CTGTAAGAGCAGTCAGAAGGAGG - Intergenic
1008631407 6:53365936-53365958 CTGTAAGAGCAGTCAGAAGGAGG - Intergenic
1008882125 6:56391290-56391312 CAGCAAAAGCAGTACCAAGAGGG + Intronic
1008882125 6:56391290-56391312 CAGCAAAAGCAGTACCAAGAGGG + Intronic
1009042881 6:58201793-58201815 CTTTATCAGCAGTATGAAAATGG - Intergenic
1009042881 6:58201793-58201815 CTTTATCAGCAGTATGAAAATGG - Intergenic
1009214882 6:60909815-60909837 CAGTAAAAACAGTACAAAGAGGG - Intergenic
1009214882 6:60909815-60909837 CAGTAAAAACAGTACAAAGAGGG - Intergenic
1009218717 6:60956027-60956049 CTTTATCAGCAGTATGAAAATGG - Intergenic
1009218717 6:60956027-60956049 CTTTATCAGCAGTATGAAAATGG - Intergenic
1009245727 6:61234957-61234979 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1009245727 6:61234957-61234979 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1009263204 6:61522227-61522249 CTTTCAAAGCAGTGTGTAGAGGG + Intergenic
1009263204 6:61522227-61522249 CTTTCAAAGCAGTGTGTAGAGGG + Intergenic
1009289205 6:61863440-61863462 CAGCAAAAGCAGTGTTAAGAAGG - Intronic
1009289205 6:61863440-61863462 CAGCAAAAGCAGTGTTAAGAAGG - Intronic
1009299896 6:62003993-62004015 CATTTAAAGCAGTATGTAGAGGG + Intronic
1009299896 6:62003993-62004015 CATTTAAAGCAGTATGTAGAGGG + Intronic
1009341163 6:62556562-62556584 CTTTCAAAGCAGTGTGTAGAGGG + Intergenic
1009341163 6:62556562-62556584 CTTTCAAAGCAGTGTGTAGAGGG + Intergenic
1009445065 6:63732979-63733001 CAGGAAAGGCATTATGAAGAAGG + Intronic
1009445065 6:63732979-63733001 CAGGAAAGGCATTATGAAGAAGG + Intronic
1009457680 6:63876123-63876145 CATTTAAAGCAGTATGTAGAGGG - Intronic
1009457680 6:63876123-63876145 CATTTAAAGCAGTATGTAGAGGG - Intronic
1009472238 6:64041981-64042003 CTAAAAAAGAACTATGAAGAGGG - Intronic
1009472238 6:64041981-64042003 CTAAAAAAGAACTATGAAGAGGG - Intronic
1009732871 6:67633351-67633373 CTGTAAAAGAAGTATGACTGGGG - Intergenic
1009732871 6:67633351-67633373 CTGTAAAAGAAGTATGACTGGGG - Intergenic
1009748385 6:67850015-67850037 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1009748385 6:67850015-67850037 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1009951305 6:70400041-70400063 CTTTATCAGCAGTATGAAAATGG - Intergenic
1009951305 6:70400041-70400063 CTTTATCAGCAGTATGAAAATGG - Intergenic
1009997543 6:70913312-70913334 CAGCTAAAGCAGTATTAAGAGGG - Intronic
1009997543 6:70913312-70913334 CAGCTAAAGCAGTATTAAGAGGG - Intronic
1010038853 6:71358500-71358522 CATTTAAAGCAGTATGTAGAGGG - Intergenic
1010038853 6:71358500-71358522 CATTTAAAGCAGTATGTAGAGGG - Intergenic
1010276691 6:73976174-73976196 CAGCTAAAGCAGTATGAAGAGGG - Intergenic
1010276691 6:73976174-73976196 CAGCTAAAGCAGTATGAAGAGGG - Intergenic
1010296490 6:74203577-74203599 CAGTAAAAGCAATACAAAGAGGG - Intergenic
1010296490 6:74203577-74203599 CAGTAAAAGCAATACAAAGAGGG - Intergenic
1010299224 6:74240376-74240398 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1010299224 6:74240376-74240398 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1010474374 6:76267935-76267957 CTGTATCAGCAGCATGAAAATGG + Intergenic
1010474374 6:76267935-76267957 CTGTATCAGCAGCATGAAAATGG + Intergenic
1010521829 6:76847625-76847647 CATTTAAAGCAGTATGTAGAGGG - Intergenic
1010521829 6:76847625-76847647 CATTTAAAGCAGTATGTAGAGGG - Intergenic
1010529177 6:76945479-76945501 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1010529177 6:76945479-76945501 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1010538609 6:77063170-77063192 TTGCAAAAGCAGTACTAAGAGGG - Intergenic
1010538609 6:77063170-77063192 TTGCAAAAGCAGTACTAAGAGGG - Intergenic
1010737531 6:79459993-79460015 CTTTCAAAGCAGTGTGTAGAGGG - Intergenic
1010737531 6:79459993-79460015 CTTTCAAAGCAGTGTGTAGAGGG - Intergenic
1010747511 6:79580632-79580654 CAGTCAAAGCAGTGTGTAGAGGG + Intergenic
1010747511 6:79580632-79580654 CAGTCAAAGCAGTGTGTAGAGGG + Intergenic
1010787910 6:80026627-80026649 CTGAAAAAATAATATGAAGATGG - Intronic
1010787910 6:80026627-80026649 CTGAAAAAATAATATGAAGATGG - Intronic
1011159919 6:84378085-84378107 CAGCAAAAGCAGTATTAAGAGGG - Intergenic
1011159919 6:84378085-84378107 CAGCAAAAGCAGTATTAAGAGGG - Intergenic
1011232297 6:85176294-85176316 CAGCAAAAGCAGTATTAAGAGGG - Intergenic
1011232297 6:85176294-85176316 CAGCAAAAGCAGTATTAAGAGGG - Intergenic
1011689559 6:89854070-89854092 CTGTAAAATCAGTATAAATTTGG + Intronic
1011689559 6:89854070-89854092 CTGTAAAATCAGTATAAATTTGG + Intronic
1011815042 6:91179562-91179584 CTGTAAAAACAGTACAAAGGAGG - Intergenic
1011815042 6:91179562-91179584 CTGTAAAAACAGTACAAAGGAGG - Intergenic
1011834955 6:91420613-91420635 CTTTATCAGCAGTGTGAAGATGG + Intergenic
1011834955 6:91420613-91420635 CTTTATCAGCAGTGTGAAGATGG + Intergenic
1011883492 6:92060439-92060461 CTTTATCAGCAGTATGAAAATGG + Intergenic
1011883492 6:92060439-92060461 CTTTATCAGCAGTATGAAAATGG + Intergenic
1011901677 6:92305929-92305951 CAGCAAAAGCAGTACTAAGATGG + Intergenic
1011901677 6:92305929-92305951 CAGCAAAAGCAGTACTAAGATGG + Intergenic
1012231980 6:96770764-96770786 CAGCAAAAGCAGTGTTAAGAGGG + Intergenic
1012231980 6:96770764-96770786 CAGCAAAAGCAGTGTTAAGAGGG + Intergenic
1012288125 6:97418496-97418518 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1012288125 6:97418496-97418518 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1012296762 6:97533773-97533795 GTTTAAAAGCAGTTTGGAGATGG - Intergenic
1012296762 6:97533773-97533795 GTTTAAAAGCAGTTTGGAGATGG - Intergenic
1012362003 6:98393700-98393722 CATTCAAAGCAGTATGTAGAGGG + Intergenic
1012362003 6:98393700-98393722 CATTCAAAGCAGTATGTAGAGGG + Intergenic
1012508133 6:99972713-99972735 CATTCAAAGCAGTATGTAGAGGG - Intronic
1012508133 6:99972713-99972735 CATTCAAAGCAGTATGTAGAGGG - Intronic
1012566863 6:100667144-100667166 GTGTAGTATCAGTATGAAGAAGG - Intronic
1012566863 6:100667144-100667166 GTGTAGTATCAGTATGAAGAAGG - Intronic
1012571908 6:100740083-100740105 CAGTGAAAGCAGTATTAAGAGGG - Intronic
1012571908 6:100740083-100740105 CAGTGAAAGCAGTATTAAGAGGG - Intronic
1012653527 6:101787449-101787471 CAGGAAAAGCAGTGTTAAGAGGG - Intronic
1012653527 6:101787449-101787471 CAGGAAAAGCAGTGTTAAGAGGG - Intronic
1013930002 6:115519081-115519103 CAGTTAAGGCAGTAGGAAGAGGG + Intergenic
1013930002 6:115519081-115519103 CAGTTAAGGCAGTAGGAAGAGGG + Intergenic
1014040944 6:116824092-116824114 CAGCAAAAGCAGTACTAAGAAGG + Intronic
1014040944 6:116824092-116824114 CAGCAAAAGCAGTACTAAGAAGG + Intronic
1014147529 6:118015222-118015244 CTTTATCAGCAGCATGAAGATGG + Intronic
1014147529 6:118015222-118015244 CTTTATCAGCAGCATGAAGATGG + Intronic
1014235037 6:118944370-118944392 CTGTGAAAGTAGTACTAAGAGGG + Intergenic
1014235037 6:118944370-118944392 CTGTGAAAGTAGTACTAAGAGGG + Intergenic
1014423205 6:121270102-121270124 CATTCAAAGCAGTATGCAGAGGG + Intronic
1014423205 6:121270102-121270124 CATTCAAAGCAGTATGCAGAGGG + Intronic
1014429500 6:121350831-121350853 CTACATAAGCAGAATGAAGAGGG + Intergenic
1014429500 6:121350831-121350853 CTACATAAGCAGAATGAAGAGGG + Intergenic
1014430673 6:121366666-121366688 CAGTGAAAGCAGTATTAAAAGGG + Intergenic
1014430673 6:121366666-121366688 CAGTGAAAGCAGTATTAAAAGGG + Intergenic
1014488791 6:122036158-122036180 CTTTATCAGCAGCATGAAGATGG + Intergenic
1014488791 6:122036158-122036180 CTTTATCAGCAGCATGAAGATGG + Intergenic
1014715645 6:124861863-124861885 CTGTATCAGCAGCATGAAAATGG - Intergenic
1014715645 6:124861863-124861885 CTGTATCAGCAGCATGAAAATGG - Intergenic
1014748375 6:125226972-125226994 CTGTAAAAGGAGTATGTTTAGGG - Intronic
1014748375 6:125226972-125226994 CTGTAAAAGGAGTATGTTTAGGG - Intronic
1015133296 6:129838425-129838447 CATTTAAAGCAGTATGTAGAGGG + Intronic
1015133296 6:129838425-129838447 CATTTAAAGCAGTATGTAGAGGG + Intronic
1015711168 6:136142106-136142128 CAGTCAAAGCAGTGTGTAGAGGG - Intronic
1015711168 6:136142106-136142128 CAGTCAAAGCAGTGTGTAGAGGG - Intronic
1015856696 6:137632587-137632609 CTTTATCAGCAGTATGAAAATGG - Intergenic
1015856696 6:137632587-137632609 CTTTATCAGCAGTATGAAAATGG - Intergenic
1016161635 6:140888300-140888322 CAGTAAAAGCAGTGTTTAGAGGG - Intergenic
1016161635 6:140888300-140888322 CAGTAAAAGCAGTGTTTAGAGGG - Intergenic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016473672 6:144402662-144402684 GTGTAGGACCAGTATGAAGAGGG + Intronic
1016473672 6:144402662-144402684 GTGTAGGACCAGTATGAAGAGGG + Intronic
1016509715 6:144827928-144827950 CTGTACAAGCAGGATTTAGATGG + Intronic
1016509715 6:144827928-144827950 CTGTACAAGCAGGATTTAGATGG + Intronic
1016728707 6:147405279-147405301 CAGCAAAAGCAGTATGGAGAGGG - Intergenic
1016728707 6:147405279-147405301 CAGCAAAAGCAGTATGGAGAGGG - Intergenic
1016924635 6:149331062-149331084 CTGAAAAAGGAGAATGAAGTTGG - Intronic
1016924635 6:149331062-149331084 CTGAAAAAGGAGAATGAAGTTGG - Intronic
1017242988 6:152191894-152191916 CAGTGAAAGCAGTACTAAGATGG - Intronic
1017242988 6:152191894-152191916 CAGTGAAAGCAGTACTAAGATGG - Intronic
1017422209 6:154284184-154284206 GTGAAAAAGGATTATGAAGAAGG - Intronic
1017422209 6:154284184-154284206 GTGAAAAAGGATTATGAAGAAGG - Intronic
1017613981 6:156224700-156224722 CTGCAAAAGCAGTACTAAGAGGG + Intergenic
1017613981 6:156224700-156224722 CTGCAAAAGCAGTACTAAGAGGG + Intergenic
1018366161 6:163122260-163122282 GCGTTAAAGCAGAATGAAGATGG - Intronic
1018366161 6:163122260-163122282 GCGTTAAAGCAGAATGAAGATGG - Intronic
1018374499 6:163198392-163198414 ATGCATAAGCAGTATGGAGATGG - Intronic
1018374499 6:163198392-163198414 ATGCATAAGCAGTATGGAGATGG - Intronic
1018482581 6:164206484-164206506 CTTTATCAGCAGTATGAAAAAGG + Intergenic
1018482581 6:164206484-164206506 CTTTATCAGCAGTATGAAAAAGG + Intergenic
1018573635 6:165235834-165235856 CTGTATCAGCAGTGTGAAAATGG + Intergenic
1018573635 6:165235834-165235856 CTGTATCAGCAGTGTGAAAATGG + Intergenic
1019115366 6:169756846-169756868 CTTTAACAGCAGCATGAAAACGG - Intronic
1019115366 6:169756846-169756868 CTTTAACAGCAGCATGAAAACGG - Intronic
1019341172 7:509830-509852 CTGCTAAAGCAGCCTGAAGAAGG + Intronic
1019341172 7:509830-509852 CTGCTAAAGCAGCCTGAAGAAGG + Intronic
1020427850 7:8090245-8090267 CTGTAGGAGCCTTATGAAGATGG + Intronic
1020427850 7:8090245-8090267 CTGTAGGAGCCTTATGAAGATGG + Intronic
1020518996 7:9162867-9162889 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1020518996 7:9162867-9162889 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1020609757 7:10380239-10380261 CTGCAAAAGCTGTACCAAGAGGG + Intergenic
1020609757 7:10380239-10380261 CTGCAAAAGCTGTACCAAGAGGG + Intergenic
1020755158 7:12192080-12192102 CTTTATCAGCAGTATGAAAATGG - Intergenic
1020755158 7:12192080-12192102 CTTTATCAGCAGTATGAAAATGG - Intergenic
1020810257 7:12842524-12842546 CATTTAAAGCAGTATGTAGAGGG + Intergenic
1020810257 7:12842524-12842546 CATTTAAAGCAGTATGTAGAGGG + Intergenic
1020940833 7:14535025-14535047 CAGCAAAAGCAGTATGAAGAGGG + Intronic
1020940833 7:14535025-14535047 CAGCAAAAGCAGTATGAAGAGGG + Intronic
1021036686 7:15808894-15808916 CTGTATCAGCAGTGTGAAAATGG - Intergenic
1021036686 7:15808894-15808916 CTGTATCAGCAGTGTGAAAATGG - Intergenic
1021319747 7:19195088-19195110 CATTAAAAGCAGTGTGTAGAGGG - Intergenic
1021319747 7:19195088-19195110 CATTAAAAGCAGTGTGTAGAGGG - Intergenic
1021771995 7:24013284-24013306 CAGGAAAAGCAGTACTAAGAGGG + Intergenic
1021771995 7:24013284-24013306 CAGGAAAAGCAGTACTAAGAGGG + Intergenic
1022110131 7:27225169-27225191 GTGTAAAAGAACTTTGAAGACGG - Intergenic
1022110131 7:27225169-27225191 GTGTAAAAGAACTTTGAAGACGG - Intergenic
1022223310 7:28336843-28336865 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1022223310 7:28336843-28336865 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1022366678 7:29727549-29727571 CAGCGAAAGCAGTATTAAGAGGG - Intergenic
1022366678 7:29727549-29727571 CAGCGAAAGCAGTATTAAGAGGG - Intergenic
1022686115 7:32598284-32598306 CAGCTAAAGCAGTATTAAGAGGG + Intergenic
1022686115 7:32598284-32598306 CAGCTAAAGCAGTATTAAGAGGG + Intergenic
1022740845 7:33119815-33119837 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1022740845 7:33119815-33119837 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1023084420 7:36556135-36556157 CATTAAAAGCAGTGTGTAGAGGG - Intronic
1023084420 7:36556135-36556157 CATTAAAAGCAGTGTGTAGAGGG - Intronic
1023308213 7:38853576-38853598 CTTTAAAAGGATTATGAATAAGG - Intronic
1023308213 7:38853576-38853598 CTTTAAAAGGATTATGAATAAGG - Intronic
1023332612 7:39134498-39134520 ATGTAAAGACAGAATGAAGAAGG - Intronic
1023332612 7:39134498-39134520 ATGTAAAGACAGAATGAAGAAGG - Intronic
1023468506 7:40486617-40486639 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1023468506 7:40486617-40486639 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1023671654 7:42583722-42583744 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1023671654 7:42583722-42583744 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1024316196 7:48019288-48019310 CAGCAAAAGCAGTACTAAGAGGG + Intronic
1024316196 7:48019288-48019310 CAGCAAAAGCAGTACTAAGAGGG + Intronic
1024357979 7:48436667-48436689 CAGTAAAAGCAGCACTAAGAAGG - Intronic
1024357979 7:48436667-48436689 CAGTAAAAGCAGCACTAAGAAGG - Intronic
1024379067 7:48673648-48673670 CATTTAAAGCAGTGTGAAGAGGG + Intergenic
1024379067 7:48673648-48673670 CATTTAAAGCAGTGTGAAGAGGG + Intergenic
1024438427 7:49387160-49387182 CTGTATCAGCAGTGTGAAAATGG - Intergenic
1024438427 7:49387160-49387182 CTGTATCAGCAGTGTGAAAATGG - Intergenic
1024494395 7:50027461-50027483 CAGTTAAAGCAGTATTCAGAAGG + Intronic
1024494395 7:50027461-50027483 CAGTTAAAGCAGTATTCAGAAGG + Intronic
1024597377 7:50950567-50950589 CAATAGAAGCAGTATTAAGAGGG + Intergenic
1024597377 7:50950567-50950589 CAATAGAAGCAGTATTAAGAGGG + Intergenic
1024694022 7:51836616-51836638 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1024694022 7:51836616-51836638 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1025524217 7:61784344-61784366 CATTTAAAGCAGTGTGAAGAGGG - Intergenic
1025524217 7:61784344-61784366 CATTTAAAGCAGTGTGAAGAGGG - Intergenic
1026302452 7:69109698-69109720 CTTTAATAGCAGTGTGAAAATGG - Intergenic
1026302452 7:69109698-69109720 CTTTAATAGCAGTGTGAAAATGG - Intergenic
1026487802 7:70836363-70836385 CTGGATAAGCTGTTTGAAGAGGG - Intergenic
1026487802 7:70836363-70836385 CTGGATAAGCTGTTTGAAGAGGG - Intergenic
1027330481 7:77087661-77087683 ATGTCAAAGCAGTGTGTAGAGGG - Intergenic
1027330481 7:77087661-77087683 ATGTCAAAGCAGTGTGTAGAGGG - Intergenic
1027647234 7:80817793-80817815 CTGTAAAAGATGTATAAAGTGGG - Intronic
1027647234 7:80817793-80817815 CTGTAAAAGATGTATAAAGTGGG - Intronic
1027687650 7:81296836-81296858 CTTTATCAGCAGCATGAAGATGG + Intergenic
1027687650 7:81296836-81296858 CTTTATCAGCAGCATGAAGATGG + Intergenic
1027921974 7:84405888-84405910 CATTCAAAGCAGTATGTAGAGGG + Intronic
1027921974 7:84405888-84405910 CATTCAAAGCAGTATGTAGAGGG + Intronic
1027964699 7:84990595-84990617 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1027964699 7:84990595-84990617 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1027996421 7:85430806-85430828 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1027996421 7:85430806-85430828 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1028119222 7:87038779-87038801 CAACAAAAGCAGTATTAAGAGGG + Intronic
1028119222 7:87038779-87038801 CAACAAAAGCAGTATTAAGAGGG + Intronic
1028266250 7:88729930-88729952 CAGTAAAAGCAGTAGTAAGAGGG - Intergenic
1028266250 7:88729930-88729952 CAGTAAAAGCAGTAGTAAGAGGG - Intergenic
1028304804 7:89249626-89249648 CAGCAAAAGCAGTATTAAGAGGG + Intronic
1028304804 7:89249626-89249648 CAGCAAAAGCAGTATTAAGAGGG + Intronic
1028508172 7:91592634-91592656 CATTCAAAGCAGTATGTAGAGGG + Intergenic
1028508172 7:91592634-91592656 CATTCAAAGCAGTATGTAGAGGG + Intergenic
1028544166 7:91979166-91979188 CTGTATCAGCAGCATGAAAATGG - Intronic
1028544166 7:91979166-91979188 CTGTATCAGCAGCATGAAAATGG - Intronic
1028560616 7:92171037-92171059 CAGCAAAAGCAGTATTAAGAGGG + Intronic
1028560616 7:92171037-92171059 CAGCAAAAGCAGTATTAAGAGGG + Intronic
1028667994 7:93369376-93369398 CTTTAACAGCAGCATGAAAATGG - Intergenic
1028667994 7:93369376-93369398 CTTTAACAGCAGCATGAAAATGG - Intergenic
1028677899 7:93489254-93489276 CAGTTAAAGCAGTGTTAAGAGGG + Intronic
1028677899 7:93489254-93489276 CAGTTAAAGCAGTGTTAAGAGGG + Intronic
1028790051 7:94843701-94843723 CTTTATCAGCAGCATGAAGATGG + Intergenic
1028790051 7:94843701-94843723 CTTTATCAGCAGCATGAAGATGG + Intergenic
1028901560 7:96106566-96106588 TAGTAAAAGCAGTACTAAGAGGG - Intronic
1028901560 7:96106566-96106588 TAGTAAAAGCAGTACTAAGAGGG - Intronic
1029313443 7:99689007-99689029 CATTCAAAGCAGTATGTAGAGGG + Intronic
1029313443 7:99689007-99689029 CATTCAAAGCAGTATGTAGAGGG + Intronic
1029613152 7:101638392-101638414 CTGTATCAGCAGTGTGAAAACGG + Intergenic
1029613152 7:101638392-101638414 CTGTATCAGCAGTGTGAAAACGG + Intergenic
1029785279 7:102783673-102783695 ATGTGAAAGCAGTGTGTAGAGGG + Intronic
1029785279 7:102783673-102783695 ATGTGAAAGCAGTGTGTAGAGGG + Intronic
1029825602 7:103189994-103190016 CAGCGAAAGCAGTATTAAGAGGG + Intergenic
1029825602 7:103189994-103190016 CAGCGAAAGCAGTATTAAGAGGG + Intergenic
1029849949 7:103451507-103451529 CAGTAAAAGCAGTATTTAGAGGG - Intergenic
1029849949 7:103451507-103451529 CAGTAAAAGCAGTATTTAGAGGG - Intergenic
1029879040 7:103787188-103787210 CAGTAAAAGCAGTGTTTAGAGGG + Intronic
1029879040 7:103787188-103787210 CAGTAAAAGCAGTGTTTAGAGGG + Intronic
1030108606 7:106007867-106007889 CTTTATTAGCAGTATGAAAATGG - Intronic
1030108606 7:106007867-106007889 CTTTATTAGCAGTATGAAAATGG - Intronic
1030108700 7:106008479-106008501 CAGTAAAGGGACTATGAAGAAGG - Intronic
1030108700 7:106008479-106008501 CAGTAAAGGGACTATGAAGAAGG - Intronic
1030599343 7:111575269-111575291 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1030599343 7:111575269-111575291 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1030747974 7:113191371-113191393 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1030747974 7:113191371-113191393 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1031096801 7:117429724-117429746 CTGAAAAAGAAGAATAAAGAAGG + Intergenic
1031096801 7:117429724-117429746 CTGAAAAAGAAGAATAAAGAAGG + Intergenic
1031098781 7:117452310-117452332 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1031098781 7:117452310-117452332 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1031254014 7:119424828-119424850 CAGTAAAAGCAGTGCTAAGAGGG + Intergenic
1031254014 7:119424828-119424850 CAGTAAAAGCAGTGCTAAGAGGG + Intergenic
1031280381 7:119792665-119792687 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1031280381 7:119792665-119792687 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1031628151 7:124014307-124014329 CTTTATAAGCAGTGTGAAAATGG + Intergenic
1031628151 7:124014307-124014329 CTTTATAAGCAGTGTGAAAATGG + Intergenic
1031804860 7:126295330-126295352 CAGCAAAAGCAGTGTTAAGAGGG + Intergenic
1031804860 7:126295330-126295352 CAGCAAAAGCAGTGTTAAGAGGG + Intergenic
1032454201 7:132059456-132059478 CTTTATCAGCAGTGTGAAGATGG + Intergenic
1032454201 7:132059456-132059478 CTTTATCAGCAGTGTGAAGATGG + Intergenic
1032865591 7:135920987-135921009 CTTTATCAGCAGTATGAAAATGG - Intergenic
1032865591 7:135920987-135921009 CTTTATCAGCAGTATGAAAATGG - Intergenic
1032986176 7:137339827-137339849 ATGTAAAAGCAGGAAGAAAAGGG + Intronic
1032986176 7:137339827-137339849 ATGTAAAAGCAGGAAGAAAAGGG + Intronic
1033049031 7:137987568-137987590 CTGTAATAGCAGGATGCTGATGG + Intronic
1033049031 7:137987568-137987590 CTGTAATAGCAGGATGCTGATGG + Intronic
1033760108 7:144428410-144428432 CTTTATCAGCAGCATGAAGACGG - Intergenic
1033760108 7:144428410-144428432 CTTTATCAGCAGCATGAAGACGG - Intergenic
1033976914 7:147113965-147113987 CAGTTAAAGCAGTGTTAAGAGGG - Intronic
1033976914 7:147113965-147113987 CAGTTAAAGCAGTGTTAAGAGGG - Intronic
1034110404 7:148531955-148531977 CTTTTAAAGCAGTGTGTAGAAGG + Intergenic
1034110404 7:148531955-148531977 CTTTTAAAGCAGTGTGTAGAAGG + Intergenic
1035139373 7:156742136-156742158 CAGCAAAAGCAGTACTAAGAGGG + Intronic
1035139373 7:156742136-156742158 CAGCAAAAGCAGTACTAAGAGGG + Intronic
1036565834 8:9937347-9937369 CTTTATAAGCAGTGTGAAAATGG - Intergenic
1036565834 8:9937347-9937369 CTTTATAAGCAGTGTGAAAATGG - Intergenic
1036666741 8:10749480-10749502 CAGTAAAAACAGTATTAAGAGGG - Intronic
1036666741 8:10749480-10749502 CAGTAAAAACAGTATTAAGAGGG - Intronic
1037088441 8:14882064-14882086 CAGCAAAAGCAGTGTTAAGAGGG + Intronic
1037088441 8:14882064-14882086 CAGCAAAAGCAGTGTTAAGAGGG + Intronic
1037230278 8:16650227-16650249 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
1037230278 8:16650227-16650249 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
1037672481 8:21027213-21027235 CTTCAACAGCAGTAAGAAGAAGG + Intergenic
1037672481 8:21027213-21027235 CTTCAACAGCAGTAAGAAGAAGG + Intergenic
1037717847 8:21414830-21414852 ATGTAAAAGCAGCATCAAGAAGG - Intergenic
1037717847 8:21414830-21414852 ATGTAAAAGCAGCATCAAGAAGG - Intergenic
1038046832 8:23772621-23772643 CTACAAAAGCAGTAGGGAGAAGG + Intergenic
1038046832 8:23772621-23772643 CTACAAAAGCAGTAGGGAGAAGG + Intergenic
1038896923 8:31794278-31794300 TTGTCAGAGCAGTATGAAGAAGG - Intronic
1038896923 8:31794278-31794300 TTGTCAGAGCAGTATGAAGAAGG - Intronic
1038946548 8:32367477-32367499 ATGTAAAAGCACTAAAAAGAGGG - Intronic
1038946548 8:32367477-32367499 ATGTAAAAGCACTAAAAAGAGGG - Intronic
1039073440 8:33667034-33667056 CTTTATCAGCAGCATGAAGATGG - Intergenic
1039073440 8:33667034-33667056 CTTTATCAGCAGCATGAAGATGG - Intergenic
1039170646 8:34741025-34741047 CATTTAAAGCAGTATGTAGAAGG + Intergenic
1039170646 8:34741025-34741047 CATTTAAAGCAGTATGTAGAAGG + Intergenic
1039197079 8:35044485-35044507 TTGTAATAACAGTATTAAGAGGG - Intergenic
1039197079 8:35044485-35044507 TTGTAATAACAGTATTAAGAGGG - Intergenic
1039647176 8:39300143-39300165 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1039647176 8:39300143-39300165 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1040431925 8:47351349-47351371 TTTTAAAAGCAGTGTGAAGAAGG + Intronic
1040431925 8:47351349-47351371 TTTTAAAAGCAGTGTGAAGAAGG + Intronic
1041129745 8:54685306-54685328 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
1041129745 8:54685306-54685328 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
1041458416 8:58084953-58084975 CTGTAAAAACAGTGTCCAGAGGG - Intronic
1041458416 8:58084953-58084975 CTGTAAAAACAGTGTCCAGAGGG - Intronic
1041508171 8:58624413-58624435 CAGCAAAAGCAGTATAAACAGGG - Intronic
1041508171 8:58624413-58624435 CAGCAAAAGCAGTATAAACAGGG - Intronic
1042016560 8:64319873-64319895 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1042016560 8:64319873-64319895 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1042018967 8:64349384-64349406 CTGTAAATCCTGAATGAAGAAGG + Intergenic
1042018967 8:64349384-64349406 CTGTAAATCCTGAATGAAGAAGG + Intergenic
1042019144 8:64351598-64351620 GTGTAAAAGAAGTAAGAACAAGG + Intergenic
1042019144 8:64351598-64351620 GTGTAAAAGAAGTAAGAACAAGG + Intergenic
1042233451 8:66583330-66583352 CAGCAAAAGCAGTATCAAAAGGG + Intronic
1042233451 8:66583330-66583352 CAGCAAAAGCAGTATCAAAAGGG + Intronic
1042266079 8:66910378-66910400 CTGTGAAAGCAGTGGGGAGAGGG + Intronic
1042266079 8:66910378-66910400 CTGTGAAAGCAGTGGGGAGAGGG + Intronic
1042469724 8:69171881-69171903 CAGTAAAAGCAGTGTGAAGAGGG - Intergenic
1042469724 8:69171881-69171903 CAGTAAAAGCAGTGTGAAGAGGG - Intergenic
1042634354 8:70856963-70856985 CAGTCAAAGCAGTGTGTAGAGGG + Intergenic
1042634354 8:70856963-70856985 CAGTCAAAGCAGTGTGTAGAGGG + Intergenic
1042766140 8:72323950-72323972 CACTTAAAGCAGTATGTAGAGGG + Intergenic
1042766140 8:72323950-72323972 CACTTAAAGCAGTATGTAGAGGG + Intergenic
1043137472 8:76546527-76546549 CTGTAAAAGGAGCAGGAACAGGG - Intergenic
1043137472 8:76546527-76546549 CTGTAAAAGGAGCAGGAACAGGG - Intergenic
1043339762 8:79223475-79223497 CACTTAAAGCAGTATGTAGAGGG - Intergenic
1043339762 8:79223475-79223497 CACTTAAAGCAGTATGTAGAGGG - Intergenic
1043368804 8:79566678-79566700 GAGTAAAAGAAGTCTGAAGATGG + Intergenic
1043368804 8:79566678-79566700 GAGTAAAAGAAGTCTGAAGATGG + Intergenic
1043627258 8:82276948-82276970 CAGCAAAAGCAGTACCAAGAGGG + Intergenic
1043627258 8:82276948-82276970 CAGCAAAAGCAGTACCAAGAGGG + Intergenic
1043627341 8:82278283-82278305 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1043627341 8:82278283-82278305 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1043694910 8:83205628-83205650 CTTTATTAGCAGTATGAAAATGG + Intergenic
1043694910 8:83205628-83205650 CTTTATTAGCAGTATGAAAATGG + Intergenic
1043828185 8:84954574-84954596 CATTTAAAGCAGTGTGAAGACGG - Intergenic
1043828185 8:84954574-84954596 CATTTAAAGCAGTGTGAAGACGG - Intergenic
1044054896 8:87556408-87556430 CATTCAAAGCAGTGTGAAGAGGG - Intronic
1044054896 8:87556408-87556430 CATTCAAAGCAGTGTGAAGAGGG - Intronic
1044192732 8:89338725-89338747 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1044192732 8:89338725-89338747 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1044375542 8:91465773-91465795 CTGTAAATGGAATATGAATAGGG + Intergenic
1044375542 8:91465773-91465795 CTGTAAATGGAATATGAATAGGG + Intergenic
1044470360 8:92559975-92559997 CATTTAAAGCAGTATGTAGAGGG - Intergenic
1044470360 8:92559975-92559997 CATTTAAAGCAGTATGTAGAGGG - Intergenic
1045402085 8:101829132-101829154 CTGTAAAATCATCATGAAGAAGG - Intronic
1045402085 8:101829132-101829154 CTGTAAAATCATCATGAAGAAGG - Intronic
1045660429 8:104431742-104431764 CTGTCAAACCAGCATGAAGGCGG - Intronic
1045660429 8:104431742-104431764 CTGTCAAACCAGCATGAAGGCGG - Intronic
1045933247 8:107651348-107651370 CATTTAAAGCAGTATGTAGAGGG - Intergenic
1045933247 8:107651348-107651370 CATTTAAAGCAGTATGTAGAGGG - Intergenic
1046108947 8:109697989-109698011 CTTTAAAAGTTGTATGAAAAAGG - Intergenic
1046108947 8:109697989-109698011 CTTTAAAAGTTGTATGAAAAAGG - Intergenic
1046119246 8:109824625-109824647 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1046119246 8:109824625-109824647 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1046167620 8:110458189-110458211 AAGAAAAAGCAGCATGAAGAAGG + Intergenic
1046167620 8:110458189-110458211 AAGAAAAAGCAGCATGAAGAAGG + Intergenic
1046447980 8:114348063-114348085 CTGCAAAAACATTATTAAGAAGG + Intergenic
1046447980 8:114348063-114348085 CTGCAAAAACATTATTAAGAAGG + Intergenic
1046468231 8:114634443-114634465 CAGTCAAAGCAGTGTGTAGAGGG - Intergenic
1046468231 8:114634443-114634465 CAGTCAAAGCAGTGTGTAGAGGG - Intergenic
1046519804 8:115309568-115309590 CTTTATAAGCAGCATGAAAACGG - Intergenic
1046519804 8:115309568-115309590 CTTTATAAGCAGCATGAAAACGG - Intergenic
1046525091 8:115373333-115373355 CAGTCAAAGCAGTGTGTAGAGGG + Intergenic
1046525091 8:115373333-115373355 CAGTCAAAGCAGTGTGTAGAGGG + Intergenic
1046828741 8:118720869-118720891 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1046828741 8:118720869-118720891 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1046957156 8:120073516-120073538 CTGAAGATGCAGTGTGAAGAGGG - Intronic
1046957156 8:120073516-120073538 CTGAAGATGCAGTGTGAAGAGGG - Intronic
1047910407 8:129522032-129522054 TAGCAAAAGCAGTATTAAGAGGG + Intergenic
1047910407 8:129522032-129522054 TAGCAAAAGCAGTATTAAGAGGG + Intergenic
1047936227 8:129782204-129782226 CAGCAAAAGCAGTACAAAGAGGG + Intronic
1047936227 8:129782204-129782226 CAGCAAAAGCAGTACAAAGAGGG + Intronic
1048046254 8:130775927-130775949 CTTTATCAGCAGTATGAAAATGG + Intergenic
1048046254 8:130775927-130775949 CTTTATCAGCAGTATGAAAATGG + Intergenic
1048429457 8:134356191-134356213 CTTTATCAGCAGTGTGAAGATGG - Intergenic
1048429457 8:134356191-134356213 CTTTATCAGCAGTGTGAAGATGG - Intergenic
1048506661 8:135027765-135027787 CTGTACAAGAAGAATGAAGTGGG - Intergenic
1048506661 8:135027765-135027787 CTGTACAAGAAGAATGAAGTGGG - Intergenic
1048646988 8:136432478-136432500 GTGCAAAAGCAGTACTAAGAGGG + Intergenic
1048646988 8:136432478-136432500 GTGCAAAAGCAGTACTAAGAGGG + Intergenic
1049490054 8:142893138-142893160 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1049490054 8:142893138-142893160 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1049490417 8:142896782-142896804 CAGTAAAAGCAGTTCTAAGAGGG - Intronic
1049490417 8:142896782-142896804 CAGTAAAAGCAGTTCTAAGAGGG - Intronic
1050079381 9:1899952-1899974 CAGCAAAAGCAGTGTTAAGAGGG + Intergenic
1050079381 9:1899952-1899974 CAGCAAAAGCAGTGTTAAGAGGG + Intergenic
1050119756 9:2296101-2296123 CTTGAAAAGCAGGAAGAAGACGG + Intergenic
1050119756 9:2296101-2296123 CTTGAAAAGCAGGAAGAAGACGG + Intergenic
1050121319 9:2311160-2311182 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1050121319 9:2311160-2311182 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1050248466 9:3717029-3717051 CAGTGAAAGCAGTACTAAGAGGG + Intergenic
1050248466 9:3717029-3717051 CAGTGAAAGCAGTACTAAGAGGG + Intergenic
1050468705 9:5962130-5962152 CTATCAAAGCAGTGTGTAGAGGG - Intronic
1050468705 9:5962130-5962152 CTATCAAAGCAGTGTGTAGAGGG - Intronic
1050864014 9:10474974-10474996 CAGTTAAATCAGTATGTAGAGGG + Intronic
1050864014 9:10474974-10474996 CAGTTAAATCAGTATGTAGAGGG + Intronic
1050914268 9:11111579-11111601 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1050914268 9:11111579-11111601 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1051326811 9:15980848-15980870 CTTTATCAGCAGTATGAAAACGG - Intronic
1051326811 9:15980848-15980870 CTTTATCAGCAGTATGAAAACGG - Intronic
1051573946 9:18593552-18593574 CAGTATAAGCAGTACTAAGAGGG - Intronic
1051573946 9:18593552-18593574 CAGTATAAGCAGTACTAAGAGGG - Intronic
1051992347 9:23166862-23166884 GTGCAAAATCAGTATTAAGAGGG + Intergenic
1051992347 9:23166862-23166884 GTGCAAAATCAGTATTAAGAGGG + Intergenic
1051997885 9:23240816-23240838 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1051997885 9:23240816-23240838 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1052406837 9:28072033-28072055 ATGTAGAAGGAGGATGAAGATGG - Intronic
1052406837 9:28072033-28072055 ATGTAGAAGGAGGATGAAGATGG - Intronic
1052410403 9:28115064-28115086 CATTCAAAGCAGTATGTAGAGGG - Intronic
1052410403 9:28115064-28115086 CATTCAAAGCAGTATGTAGAGGG - Intronic
1052525010 9:29605963-29605985 TAGCAAAAGCAGTACGAAGAGGG - Intergenic
1052525010 9:29605963-29605985 TAGCAAAAGCAGTACGAAGAGGG - Intergenic
1052591003