ID: 999349608

View in Genome Browser
Species Human (GRCh38)
Location 5:150856787-150856809
Sequence ATGTATATGGATGAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 453
Summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 415}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999349608_999349612 -10 Left 999349608 5:150856787-150856809 CCCTCTTCCTCATCCATATACAT 0: 1
1: 0
2: 0
3: 37
4: 415
Right 999349612 5:150856800-150856822 CCATATACATACACCTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999349608 Original CRISPR ATGTATATGGATGAGGAAGA GGG (reversed) Intronic
903335416 1:22621246-22621268 ATGTTTATGGAGCAGGAAGAGGG - Intergenic
904371321 1:30049190-30049212 GTCCATATGTATGAGGAAGAAGG - Intergenic
904494907 1:30881061-30881083 ATATATATGCATGAGGATGTTGG - Intronic
906414142 1:45606519-45606541 GTGCATGTGGAAGAGGAAGAAGG + Exonic
907843432 1:58179261-58179283 ATCTATATTTATGAGGAATATGG + Intronic
908279159 1:62512427-62512449 ATTTATAAGGAAAAGGAAGATGG + Intronic
908353969 1:63313755-63313777 ATGTCTATGACTGAGGAACAAGG + Intergenic
908605182 1:65791165-65791187 AAGGTTATGGATGAGGTAGATGG + Intergenic
908727867 1:67196254-67196276 ATGTATATGGCTGAGCACGGTGG + Intronic
909288123 1:73847122-73847144 ATGTTGAGGGAAGAGGAAGAAGG - Intergenic
909460107 1:75902017-75902039 AATTATATGGATGAGGTAGATGG - Intronic
910160119 1:84263427-84263449 AGGTAAAAGGATAAGGAAGAAGG + Intergenic
910181651 1:84490887-84490909 ATCTAGATGGATGAGGGTGAAGG + Intronic
910269871 1:85382560-85382582 ATGAATATGGTTGATGAAGATGG + Intronic
911717829 1:101155085-101155107 TTATATGTGGATGAGGGAGAAGG + Intergenic
912235175 1:107843555-107843577 ATATATATATATGAGGAAGGTGG + Intronic
912578921 1:110703012-110703034 ATGTATTTGAATAATGAAGAGGG - Intergenic
914019856 1:143856656-143856678 ATGTGTATGAATGAGCAAGTAGG + Intergenic
916626706 1:166565859-166565881 ATGTGAATGTATGAGGTAGAAGG + Intergenic
916692348 1:167202424-167202446 AGGTGGATGGATGAGGAATAGGG - Intergenic
917525574 1:175785341-175785363 AGGTACATGGGTGAGGAAGCAGG - Intergenic
917908417 1:179613609-179613631 CTATCTATGAATGAGGAAGAAGG - Intronic
918565719 1:185929148-185929170 ATGAATATGGAAGAGGAAAAGGG - Intronic
918594251 1:186274537-186274559 AAGTATCTGTATCAGGAAGAGGG + Intergenic
919426914 1:197444327-197444349 AAGAAAATGGATGAGTAAGAAGG - Intronic
920382670 1:205544601-205544623 TTGAATTAGGATGAGGAAGAGGG - Intergenic
920400524 1:205673307-205673329 ATGAACATGGAGGGGGAAGAGGG + Intronic
920999374 1:211026958-211026980 ATTTATATGGCAGAAGAAGAGGG - Intronic
921417194 1:214902878-214902900 ATGTCTATGGATGTGTTAGATGG - Intergenic
921963746 1:221065255-221065277 ATGTCCATGGATGATGACGATGG + Intergenic
921976884 1:221212527-221212549 AAGTATAAGGAAGAAGAAGAAGG + Intergenic
922657288 1:227396780-227396802 ATATATTTAGATAAGGAAGATGG - Intergenic
923871448 1:237998557-237998579 TTAGATATGGAGGAGGAAGATGG - Intergenic
924841773 1:247718191-247718213 ATGTATCTGTATCAGGAAGAAGG - Intergenic
1063374985 10:5548884-5548906 ATGTGTGTGGATAAGGGAGAGGG - Intergenic
1063917244 10:10895913-10895935 AGGTATTTGGAAGGGGAAGAAGG + Intergenic
1064049741 10:12049692-12049714 ATGAGTGTGGATGGGGAAGATGG + Intergenic
1064652284 10:17521677-17521699 TTGGATATGAATGAGGGAGAAGG - Intergenic
1064788752 10:18931260-18931282 ATGTATATTTATTAGAAAGAAGG + Intergenic
1065488931 10:26262939-26262961 AGGTATATGTATGGGCAAGAAGG - Intronic
1065927737 10:30450643-30450665 ATGTCTCTGGAGAAGGAAGACGG - Intronic
1069254201 10:66311755-66311777 TTGTATATGGAAAAGGAATATGG + Intronic
1070209364 10:74299625-74299647 ATATATATGGATCAGAAAAAAGG + Intronic
1070313506 10:75290693-75290715 AAGTTTATGGATGTGGTAGATGG - Intergenic
1070380170 10:75874040-75874062 AAGTATAGGGATGAAGAAGAAGG - Intronic
1070985915 10:80689755-80689777 ATGTTTATGAATGGGCAAGAAGG + Intergenic
1071379715 10:85046155-85046177 AAGTAAATGGATGAGTAAAAGGG - Intergenic
1071840116 10:89461545-89461567 AAGTCTAGGGATGAGGAAAAGGG - Intronic
1072292091 10:93973407-93973429 TTGTCCATGTATGAGGAAGAGGG + Intergenic
1074434782 10:113424767-113424789 ATGCAAAGGGAAGAGGAAGAAGG + Intergenic
1075277255 10:121105307-121105329 ACCTATATGGAAGAGGCAGAGGG - Intergenic
1075693393 10:124416629-124416651 ATGTAGATGGATGGGCTAGATGG - Intronic
1075718598 10:124571830-124571852 ATGGCGATGGATGAGGAAGTTGG + Intronic
1075994754 10:126868278-126868300 ATGAACATGGGTGTGGAAGATGG - Intergenic
1076181472 10:128412339-128412361 ATGTAGATAGATGAGGATGGTGG + Intergenic
1078769469 11:14334929-14334951 ATGTTGATGGAGGAGAAAGAAGG - Intronic
1080516583 11:33027509-33027531 ATGTTTATGCTTGAGAAAGAAGG + Intronic
1080785908 11:35474852-35474874 ATGAATAGGGAAAAGGAAGAAGG + Intronic
1082093199 11:48106137-48106159 AGGTATATGGATGAAGGAGTAGG + Intronic
1082920688 11:58489894-58489916 ATCTAGCTGGATGAAGAAGATGG - Intergenic
1084264672 11:67998653-67998675 ATCTCTATGGATGAGCAAGCTGG + Intronic
1084968576 11:72757175-72757197 CTGGATTTGGCTGAGGAAGAGGG + Intronic
1086026961 11:82305472-82305494 ATGTATTTGTAAGAGGCAGACGG - Intergenic
1086566590 11:88233829-88233851 ATGGATAGGGAGGAGGAAAACGG - Intergenic
1086911833 11:92480961-92480983 ATTTATATGAATGAGTAAAAGGG - Intronic
1087676597 11:101169645-101169667 ATGAGAATGTATGAGGAAGAAGG + Intergenic
1087907663 11:103717874-103717896 ATATATATGGAAAAGGAAGATGG + Intergenic
1088429121 11:109738619-109738641 ATGAACATGAATGAGGAAAATGG - Intergenic
1088700290 11:112405525-112405547 ATTTCTGTGAATGAGGAAGAGGG + Intergenic
1089099399 11:115949009-115949031 AGTAATATGGATGAAGAAGAGGG + Intergenic
1089477612 11:118778080-118778102 ATATATATGGATGAGGGGAAGGG + Intronic
1089557918 11:119325321-119325343 AGGTATATGGCTGGGCAAGATGG + Intergenic
1089797399 11:120992802-120992824 ATGTAGATGCATGAGGTAAAAGG + Intergenic
1090150542 11:124379151-124379173 ATATATATGGATGAGTAACAGGG - Intergenic
1090271929 11:125392753-125392775 ATGTATGTGTGTGAGAAAGAAGG + Intronic
1091783170 12:3226553-3226575 ATATATATGGCTGAGGCAGAAGG + Intronic
1092100436 12:5879123-5879145 AGGTATAAGGATGGGGAAAAGGG + Intronic
1092445131 12:8548561-8548583 ATGTAGAAGGATGACAAAGATGG - Intergenic
1092976472 12:13749902-13749924 ATGTATTTGGATGGAGAGGAAGG + Intronic
1092986013 12:13847286-13847308 AAGCATATGGATGGGGAAGGTGG + Intronic
1093022356 12:14215799-14215821 AAGTTTATGGGTGAGGAAGCTGG - Intergenic
1093375613 12:18423705-18423727 TTGTATATGGATAAGAAATAAGG - Intronic
1093402184 12:18760246-18760268 ATGTAGATAGATGAGCAGGAAGG - Intergenic
1093904975 12:24679636-24679658 ATGTTTATGGGTGAAGAAGGAGG + Intergenic
1095926022 12:47579963-47579985 ATGTTCATGGACGAAGAAGAAGG + Intergenic
1097377091 12:58854772-58854794 ATGTACAGGGATGAAGAAAAGGG + Intergenic
1098753623 12:74328530-74328552 ATGTGTATGCATGAAGAAGAAGG - Intergenic
1098934504 12:76462867-76462889 ATGTTTATGGAAGAGCACGAAGG + Intronic
1098994461 12:77102862-77102884 ATTTATTTGGAAGAGGAAGAAGG - Intergenic
1099444983 12:82741790-82741812 ATGTATATGGGGGAGGAAGTGGG + Intronic
1100102762 12:91129486-91129508 AGGTATATGGATGAGGAGAGAGG - Intergenic
1100146928 12:91689809-91689831 ATGTATAGGGGAGAAGAAGATGG + Intergenic
1102194378 12:111014195-111014217 ATGAAGATGGAAGAAGAAGAGGG + Intergenic
1102382123 12:112475827-112475849 ATGTATATGTATGAGGATGGGGG + Intronic
1103803270 12:123553405-123553427 ATGTATAGGGATGCAGAAAAAGG - Intergenic
1104119871 12:125789022-125789044 ATGTATATGTATAAGAAAAAGGG + Intergenic
1104275659 12:127325035-127325057 ATGAAGATGGAGGAGGAGGAAGG - Intergenic
1105399421 13:20075523-20075545 ATGAAAATGTTTGAGGAAGAAGG + Intronic
1107200389 13:37708833-37708855 ATGTATACGGAGAAGGAAAAAGG - Intronic
1107286993 13:38804715-38804737 ATGTAGATGAATGAAGAATAAGG + Intronic
1107571104 13:41659020-41659042 ATGTCAATGGATGAACAAGAAGG + Intronic
1108096847 13:46911064-46911086 ATGGATATGGATGCTGGAGAAGG + Intergenic
1108275376 13:48804090-48804112 ATCTATCTGGTTGGGGAAGATGG - Intergenic
1108410229 13:50138426-50138448 AAGAAGATGGATGAGGAGGAGGG + Intronic
1109733684 13:66452449-66452471 ATAAATGGGGATGAGGAAGAGGG - Intronic
1110779865 13:79452541-79452563 AAGTATTTGTATCAGGAAGAGGG + Intergenic
1110785948 13:79526174-79526196 TTGGATAAGGATGAGGGAGAAGG + Intronic
1110801085 13:79695885-79695907 ATGTATATGTTTAGGGAAGAAGG + Intergenic
1111221742 13:85214029-85214051 ATGTATATGTTTGAAGAAAAAGG - Intergenic
1111519650 13:89384199-89384221 ATGTATTTGGATCATGGAGATGG - Intergenic
1112630589 13:101157685-101157707 ATGTAATGGGGTGAGGAAGAAGG - Intronic
1113509516 13:110841830-110841852 ATGAATATGGGGGAGGCAGAGGG - Intergenic
1114384477 14:22241226-22241248 ATGTACAGGGATGCAGAAGAAGG - Intergenic
1114428452 14:22640165-22640187 ATGTATAGGGAAGGGGGAGAGGG + Intergenic
1115145384 14:30220203-30220225 ATGTAAATTCATAAGGAAGATGG + Intergenic
1115772372 14:36678086-36678108 CTGGATATGGATGTTGAAGATGG + Exonic
1115814648 14:37150414-37150436 ATGTATATGAGTAAGAAAGAGGG - Intronic
1116006289 14:39295401-39295423 ATGTATGTGGGGGAGAAAGAGGG - Intronic
1116879796 14:50154095-50154117 AGGGAAATGGAAGAGGAAGAAGG + Intronic
1118325871 14:64779985-64780007 ATGCAGATGAATGAAGAAGATGG - Intronic
1119503521 14:75151599-75151621 ATGCATATGTAAGAGGAAGGGGG - Intronic
1120086327 14:80278312-80278334 TTGGATATAGATGGGGAAGAGGG + Intronic
1120445855 14:84594476-84594498 ATGTATTTGGAAGAGGAAACGGG - Intergenic
1120614824 14:86690306-86690328 CTGTCTATGAATCAGGAAGAAGG + Intergenic
1121671677 14:95714711-95714733 TTGTGTATGGAAGAGGGAGAGGG - Intergenic
1121972945 14:98375503-98375525 ATGTATATTGATGAGAAATAGGG - Intergenic
1126570526 15:50145925-50145947 ATGAAAATGAATGAGAAAGATGG + Intronic
1127503176 15:59573577-59573599 ATGAACAAGGAAGAGGAAGAGGG + Intergenic
1128599061 15:68980113-68980135 AGGAATATGGTTGATGAAGAAGG + Intronic
1130959815 15:88652360-88652382 ATGGAGATGGGTGAGGAGGAGGG - Intronic
1131741447 15:95397495-95397517 ATGCATTTGGATCAGGAAGTTGG + Intergenic
1131938385 15:97533436-97533458 ATGCATATGCAGGAGGGAGATGG + Intergenic
1132124802 15:99213632-99213654 ATATAACTGGAGGAGGAAGAAGG - Intronic
1132295592 15:100731998-100732020 ATGAACAAGGATGAGGAACATGG + Intergenic
1133493490 16:6294644-6294666 AAGTAACTGGATGATGAAGAGGG + Intronic
1133738247 16:8631914-8631936 CTGCATAGGGGTGAGGAAGAAGG - Intronic
1133922031 16:10162051-10162073 ATGTCTTTGGGTGGGGAAGAGGG + Intronic
1135114951 16:19716547-19716569 ATATATATGGATGAGGAGTTTGG + Intronic
1135231196 16:20709666-20709688 CTGTATAAGGATAAGGAAGTGGG - Intronic
1135662026 16:24305201-24305223 ATGAATGGGGATGAGGAATATGG + Intronic
1135845384 16:25913834-25913856 ATGTATGTGGATGTGGAGGGAGG + Intronic
1137622776 16:49887214-49887236 AAGTAGAAGGACGAGGAAGAGGG - Intergenic
1137635440 16:49982326-49982348 CTGTATATGGATGGAGATGATGG + Intergenic
1138326689 16:56178015-56178037 ATCTATATTCATGAGGAATACGG + Intergenic
1138369028 16:56509537-56509559 ATTTCTATAGATGAGGAAAATGG - Intronic
1139015122 16:62680497-62680519 CTTTATATGGAGCAGGAAGAGGG + Intergenic
1139415517 16:66805292-66805314 ATGTATATTGGTGGGGCAGAGGG + Intronic
1140397892 16:74644677-74644699 GCTTCTATGGATGAGGAAGAAGG - Exonic
1141105556 16:81230601-81230623 AAGTATTTGGATGGGGAAGGAGG - Intergenic
1143989606 17:10945424-10945446 AGATACATGGATGAGCAAGAGGG + Intergenic
1144237203 17:13273014-13273036 ATGAATATGGAGGATCAAGATGG - Intergenic
1144810012 17:17993035-17993057 AGGTAAAGGGATTAGGAAGAGGG - Intronic
1145287417 17:21516647-21516669 AAGTATCTGTATCAGGAAGAGGG + Intergenic
1145785052 17:27588198-27588220 ATGTTTCCAGATGAGGAAGAAGG - Intronic
1145908459 17:28529014-28529036 ATGTATATAAATGGGGAGGAGGG + Intronic
1146553836 17:33805915-33805937 GTGTATATGGATGTGCAAGATGG - Intronic
1149222347 17:54429545-54429567 ATGTATATTGAGAAGGCAGAAGG + Intergenic
1149612591 17:57968414-57968436 ATGTATATGGAGGAAGAAAAAGG - Intergenic
1149959203 17:61088928-61088950 GTGTACATGCCTGAGGAAGATGG + Intronic
1150129154 17:62657617-62657639 ATGCATATGGATGAGGCTGGGGG + Intronic
1151246845 17:72801713-72801735 ATGTATATCTATGAGTAACAAGG + Intronic
1151585672 17:75006927-75006949 ATGTATATGGAAGAGAGATATGG - Intergenic
1151923210 17:77173412-77173434 AGGTATCTGGCTGAGGCAGATGG + Intronic
1153423116 18:4930937-4930959 TTGGATATGGATGAAGAACAAGG + Intergenic
1153944602 18:10008151-10008173 ATGTGGGTGGATGAGGTAGATGG - Intergenic
1154305970 18:13231174-13231196 ATGTCTATGGGTGAGGCAAAAGG + Intronic
1155560681 18:27073119-27073141 ATGTAGCTGGATGAAGAAGCTGG + Intronic
1160965298 19:1744688-1744710 AGGGAAAAGGATGAGGAAGAAGG - Intergenic
1162195120 19:8978747-8978769 ATGGAGATGGATGAGTCAGAGGG + Exonic
1162327204 19:10006353-10006375 ATGTTTGTGGCTCAGGAAGAAGG + Intronic
1164535271 19:29081384-29081406 ATGTATGTGGGAGAGGCAGATGG + Intergenic
1164585734 19:29474488-29474510 GTGTACATGGAAGAGGAACATGG + Intergenic
1164684011 19:30155130-30155152 AGGTATATGGAGAAGGAGGAGGG + Intergenic
1167684036 19:50944346-50944368 AGGAATCTGGAAGAGGAAGATGG - Intronic
1168351382 19:55678108-55678130 ATATCCCTGGATGAGGAAGAAGG + Intronic
926085074 2:10015076-10015098 ATGTGTATGGACGAGTCAGATGG + Intergenic
926316775 2:11715802-11715824 ATGAAAATGGAGGAGGAGGATGG + Intronic
926525649 2:13976669-13976691 ATGTAGATAAATAAGGAAGAAGG + Intergenic
926832309 2:16977052-16977074 AAGTAGATGGATGAGGATAAGGG - Intergenic
927384093 2:22513100-22513122 AAGTATGAGGATGAGGAAGGAGG + Intergenic
927710812 2:25324746-25324768 ATGGATAAGGAGGAGGGAGAGGG + Intronic
928171798 2:29009212-29009234 ATGGAGATGGAGGTGGAAGAGGG + Intronic
928725412 2:34167514-34167536 ATGTATATGTGTGAGAAAGTAGG + Intergenic
929527906 2:42723149-42723171 AAGTATGTGGTTGAGGAATAAGG + Intronic
929706113 2:44213926-44213948 TTCTTTATGAATGAGGAAGAAGG - Intronic
930218184 2:48718937-48718959 ATGAACATGGCTGAGGTAGAAGG - Intronic
930221515 2:48751083-48751105 GAGTATGTGGATGGGGAAGATGG + Intronic
930253618 2:49064160-49064182 TTGAAAATGGATGAGGGAGAGGG + Intronic
930345073 2:50169739-50169761 AATTATATGGATGAGGTAGATGG + Intronic
930386105 2:50697113-50697135 ATGTATTTGGAAGGGGCAGATGG + Intronic
930885896 2:56326007-56326029 AAGTATAATGATAAGGAAGAGGG + Intronic
931426680 2:62178095-62178117 GTGTATGTGGAGGAGGCAGAGGG - Intergenic
931446545 2:62331738-62331760 AAGTATCTGTATTAGGAAGAAGG - Intergenic
932669926 2:73728505-73728527 GTGAATGTGGAGGAGGAAGACGG + Intergenic
933269684 2:80220183-80220205 ATGTCTATGGCAGAAGAAGAGGG - Intronic
933505830 2:83176129-83176151 TTGGATAAGGAGGAGGAAGAGGG - Intergenic
935258238 2:101331626-101331648 ATGGATAGGGATGGGAAAGAAGG + Intergenic
936046841 2:109195025-109195047 ATGAAAATGGAAGGGGAAGATGG + Intronic
936061950 2:109300650-109300672 ATGGAGAAGGAAGAGGAAGATGG - Intronic
936540692 2:113348428-113348450 ATGTACATGAATCAGGATGATGG - Intergenic
937093354 2:119221300-119221322 AGGTACATGGATGAGGAATGGGG + Intergenic
937654144 2:124355821-124355843 ATGGATATTGAAGAGGAAGGAGG + Intronic
938618305 2:133022317-133022339 AAGTATTTGTATCAGGAAGAAGG + Intronic
938741140 2:134233598-134233620 ATGTATTTAGATCAGGCAGAAGG + Intronic
938973160 2:136450463-136450485 ATGTCTATTGATTAAGAAGAGGG + Intergenic
939660073 2:144878504-144878526 ATGTATATGCGTGGTGAAGAAGG - Intergenic
939701299 2:145395286-145395308 GTGTATATTTATGAGGAATATGG - Intergenic
939977303 2:148733179-148733201 CTGTATATGGATGATGAAGCTGG + Intronic
941104487 2:161337117-161337139 CTGTATCTGTATGAGCAAGAGGG + Intronic
941233502 2:162940773-162940795 ATATTTATTGTTGAGGAAGATGG + Intergenic
941523464 2:166578098-166578120 TTGTATATGGGTGAGGCAGAGGG + Intergenic
943098388 2:183456616-183456638 ATTAATATGGATGAGGAATCAGG + Intergenic
943241215 2:185386523-185386545 GTGTTTATGGATGAGAGAGAGGG + Intergenic
943862512 2:192886625-192886647 ATGTATATGGAATCGTAAGAGGG - Intergenic
944336743 2:198543071-198543093 ATAGAAATGGATGATGAAGATGG - Intronic
945299911 2:208206493-208206515 AAGGAGATGGACGAGGAAGATGG + Intergenic
946057351 2:216913729-216913751 ATGTGTATGGCCCAGGAAGAAGG + Intergenic
946620770 2:221560194-221560216 AGGAAGATGGATGAGGAAGTAGG + Intronic
946905219 2:224409197-224409219 AAGTATCTGTATCAGGAAGAGGG - Intergenic
948080978 2:235204932-235204954 GTGAATTGGGATGAGGAAGAAGG - Intergenic
1169318708 20:4613467-4613489 ATGTATCTGGGTGGGGCAGAGGG + Intergenic
1169475690 20:5929326-5929348 AAGTATCTGTATCAGGAAGAAGG - Intergenic
1169598692 20:7230837-7230859 ATTTAAAGGGATGAGGAAAAGGG + Intergenic
1169627675 20:7590826-7590848 ATGTATGTGGATGGGGGACAGGG - Intergenic
1169848397 20:10022094-10022116 ATGAATATGGATGATGGAGGTGG - Intronic
1170008000 20:11689768-11689790 ACCTATTGGGATGAGGAAGAGGG - Intergenic
1171993643 20:31715777-31715799 AGGTATCTGTATTAGGAAGAGGG + Intronic
1172473282 20:35217101-35217123 ATGTATATGAGTGAGGAGGTTGG - Intergenic
1173007668 20:39152560-39152582 AAGTATATGAAAGAGGATGAGGG + Intergenic
1173977317 20:47196776-47196798 ATGTCTATGCAGGAGGCAGATGG + Intergenic
1174759082 20:53188682-53188704 ATGTATATGTGTGTGTAAGATGG - Intronic
1174866174 20:54137811-54137833 ATGAAAATGGAAGAGAAAGAAGG - Intergenic
1176705328 21:10112931-10112953 ATATATTTGGAGGAGAAAGAAGG + Intergenic
1177045801 21:16168270-16168292 ATCTAAATGGATGTGGAGGAAGG - Intergenic
1177662441 21:24103052-24103074 ATATATATGGATGAATAAAATGG - Intergenic
1179227445 21:39467494-39467516 AAGTATATTCATGAAGAAGAGGG + Intronic
1179622810 21:42629445-42629467 AAGTAGATGGATGAGATAGATGG + Intergenic
1181974491 22:26719313-26719335 AAATCTATGGAGGAGGAAGAGGG - Intergenic
1182694938 22:32192054-32192076 ATGGACATGGATAAGGAAGGAGG + Intronic
1182915185 22:34022881-34022903 ATGTTTATGGATGATGATGATGG - Intergenic
1183957306 22:41388645-41388667 ATGTAAAAGGAGGAGGAATAAGG - Intronic
1184639824 22:45864649-45864671 ATGAATGGGGATGAGGAAGCAGG - Intergenic
1185127592 22:49020125-49020147 ATGTGTGTGGGTGAGGAAGAAGG - Intergenic
949233692 3:1782617-1782639 ATGTTTATGAATGAGCAATATGG - Intergenic
949365562 3:3276758-3276780 ATGTGTTTGGAGGAGGGAGAGGG - Intergenic
949608976 3:5684212-5684234 AGGTCTCTGGATGAGGAATATGG + Intergenic
949992939 3:9593983-9594005 AAGTATCTGTATCAGGAAGAGGG - Intergenic
950528277 3:13537304-13537326 ATGCAGATGGATGACGAACATGG + Intergenic
950545700 3:13636788-13636810 ATGTGTGTGTATGAGGAAGAGGG - Intronic
951158658 3:19388081-19388103 ATGTATATGGATGATGGTAATGG + Intronic
951358124 3:21693575-21693597 ATCTTTATGGATGAGAAAAATGG - Intronic
951799444 3:26578893-26578915 ATGAATATAAATGGGGAAGAGGG - Intergenic
954720379 3:52556860-52556882 AACTCTATGGATGAGGAAGGTGG - Intronic
954756849 3:52845362-52845384 ATGTTTGTGGATGATGAAGCAGG + Intronic
955074910 3:55604518-55604540 ATGTCTGAGGATGAGAAAGAAGG + Intronic
955565705 3:60242804-60242826 ATGTGTTTGTATGAGGAAGAAGG - Intronic
955600584 3:60641341-60641363 AGGTACAAGGATGAGGCAGAGGG + Intronic
956160204 3:66343739-66343761 ATGATTATGGATTAGTAAGAAGG - Intronic
956304284 3:67806685-67806707 ATGTATACAGATGATGTAGAAGG - Intergenic
956975148 3:74570206-74570228 ATGTATATGGAGGGGGAGGAGGG + Intergenic
959025390 3:101234716-101234738 GTCTATAGGGGTGAGGAAGATGG + Intronic
959221355 3:103524760-103524782 ATAGATATGGAAGAGAAAGAAGG + Intergenic
959985800 3:112569841-112569863 AGGTATATGAAAGAGGCAGAGGG - Intronic
960494844 3:118361524-118361546 ATGGATAGGAATGAGGAAAAAGG + Intergenic
961095105 3:124147742-124147764 GTGTATCTGGAAGAGGGAGAGGG + Intronic
962664831 3:137643277-137643299 ATTTATCTGGATGAGCAGGAGGG - Intergenic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
962914671 3:139888981-139889003 ATGTAGATAAATGATGAAGAAGG - Intergenic
963232163 3:142919081-142919103 ATGTATACAGATTAGGAAGGAGG - Intergenic
964392942 3:156216273-156216295 ATTTATAGGGAGGAGGTAGATGG + Intronic
964926948 3:161970707-161970729 ATGGTTATGGATGTGGAACACGG + Intergenic
965422683 3:168481457-168481479 ATGGATTTGGATGAGCAAAATGG + Intergenic
965938897 3:174151070-174151092 ATTTATATAGAAGAGAAAGAGGG - Intronic
966011035 3:175077815-175077837 ATGTATACGGAAAAAGAAGAAGG + Intronic
966271172 3:178107780-178107802 ATGTATATGGACGTGTAGGAGGG - Intergenic
966315738 3:178643790-178643812 ATGTAGATTGAGGAAGAAGAAGG - Intronic
966912674 3:184568343-184568365 ATGTATCTGCAGGAGGCAGAGGG - Intronic
966934202 3:184695141-184695163 ATGGAGATGCTTGAGGAAGATGG - Intergenic
967327113 3:188252156-188252178 ATATATATGTTTGGGGAAGAAGG - Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967666082 3:192173823-192173845 ATGTACATTCATAAGGAAGAAGG - Intronic
967983375 3:195078535-195078557 TTGGATGGGGATGAGGAAGAGGG - Intronic
970517624 4:16849113-16849135 ATGAATATGGATGAAGCAAATGG - Intronic
971745672 4:30576656-30576678 AAGTATATCAATGAGGAAGGTGG - Intergenic
973002582 4:44969595-44969617 GTTTATATGGATAAGGGAGATGG - Intergenic
973666212 4:53162401-53162423 ATGTTTAAGGATGAAGAAAATGG + Intronic
973796868 4:54436301-54436323 ATATATATTAATGAGCAAGAGGG - Intergenic
974116089 4:57580688-57580710 TTGTATATGGATGGTGTAGAGGG + Intergenic
974122381 4:57655207-57655229 ATGTGTATGGATGAAGGAGAAGG - Intergenic
974468520 4:62289494-62289516 ATGTTTTTGGATGAAGAGGATGG + Intergenic
974520640 4:62976527-62976549 ATGTATAGGGATGCAGAAAAAGG - Intergenic
974667725 4:64986815-64986837 CTGAACTTGGATGAGGAAGAGGG - Intergenic
974794908 4:66736094-66736116 ATGTGTGTGGAAGAGGTAGAGGG + Intergenic
975209867 4:71688006-71688028 ATGAATATGGAGGGTGAAGAAGG - Intergenic
975537387 4:75465657-75465679 AAGTATAGGGAAGAGGATGAAGG - Intergenic
975822020 4:78280528-78280550 ATGTATATGAATTAGGGATAAGG + Intronic
975986934 4:80208710-80208732 ATGCATTTGGAGGAGGAAAAGGG - Intergenic
976301997 4:83524180-83524202 AAGTATCTGTATCAGGAAGAGGG + Intergenic
977048460 4:92095897-92095919 ATCTATATGCATGAGAAATAAGG - Intergenic
977437038 4:97011382-97011404 ATGTATGGGGATGGGGAAGTGGG - Intergenic
977498185 4:97803195-97803217 ATATATATGGAGGGGGAAGAGGG + Intronic
977867157 4:102043001-102043023 ATGTTTATAGATGAGGGAGTTGG - Intronic
978262973 4:106784328-106784350 ATGTATATTTATGAGGTACATGG - Intergenic
980377591 4:131969615-131969637 ATATATTTGGAGGAGAAAGAAGG + Intergenic
980919482 4:139068548-139068570 ATGTATCTGCATGTGGAAGTGGG - Intronic
981294780 4:143119117-143119139 ATGTATATGTTTGAGGAATGGGG - Intergenic
983080385 4:163377943-163377965 AAGTAGATGAATGAAGAAGAGGG - Intergenic
984861835 4:184247193-184247215 AAGTATGTGTATCAGGAAGACGG + Intergenic
985137033 4:186796310-186796332 AAGTACATGGATGAGAAAGAGGG - Intergenic
986102296 5:4625100-4625122 ATGGAGATGGATGATGATGATGG + Intergenic
987487715 5:18542058-18542080 AAGTATATGCATCAGGAATAAGG - Intergenic
987542950 5:19278247-19278269 ATTTATAATGACGAGGAAGAGGG + Intergenic
987961470 5:24814585-24814607 CTGAATTTGGATGAGGAAGAGGG + Intergenic
988423430 5:31034410-31034432 ATGTATATGGATGGTTAAAATGG + Intergenic
991642337 5:68767668-68767690 GTGTGTAAGGATTAGGAAGAGGG - Intergenic
992443459 5:76814455-76814477 GTGTGTGTGGATGGGGAAGAGGG + Intergenic
993041598 5:82820966-82820988 ATGTGTTTCTATGAGGAAGAAGG + Intergenic
993754663 5:91713725-91713747 AAGTAGAGGGATGAGGATGAAGG + Intergenic
993760639 5:91792562-91792584 ATGTTTATGTATGAGGAGAAGGG - Intergenic
994253321 5:97563081-97563103 AGGGATATGGAGAAGGAAGAAGG + Intergenic
994362692 5:98872093-98872115 ATGAATATGGATATGGAAGCTGG - Exonic
995364598 5:111343781-111343803 TTGTATAGGGATAAGGCAGAAGG + Intronic
995420097 5:111955000-111955022 ATGAAGATGCATGAGGAAGAAGG + Intronic
995465816 5:112448565-112448587 ATGTACAGGGATGCAGAAGAAGG - Intergenic
996195245 5:120597968-120597990 ATGAATATGGATTATGAATATGG + Intronic
996633513 5:125664848-125664870 ATTTATATGGATGAGGAATTTGG + Intergenic
996713444 5:126566725-126566747 ATGTATATGGATCATGGATATGG - Intronic
997130833 5:131274265-131274287 ATTTAATAGGATGAGGAAGACGG - Intronic
997435284 5:133869668-133869690 ATCTGAGTGGATGAGGAAGAGGG - Intergenic
997593513 5:135091042-135091064 ATGTATATAGAGGAGGAGGTAGG + Intronic
998194366 5:140054776-140054798 ATGCATGTGGAAGGGGAAGAAGG + Intergenic
998566092 5:143217167-143217189 ATGAATAAGGAAGAGGAAAAGGG + Intronic
999237344 5:150106792-150106814 AAGTATGTGGAACAGGAAGAAGG - Intronic
999349608 5:150856787-150856809 ATGTATATGGATGAGGAAGAGGG - Intronic
999700602 5:154224409-154224431 ATACAGATGGACGAGGAAGAAGG - Intronic
1002278502 5:178117929-178117951 CTGGAAATGGTTGAGGAAGATGG + Intronic
1003676799 6:8212143-8212165 ATGTATGTTGATGAGGCAGCTGG - Intergenic
1003989977 6:11476610-11476632 GTGGAGATGGATGAGGCAGATGG + Intergenic
1004372761 6:15066784-15066806 ATAAATAGGGAGGAGGAAGAAGG + Intergenic
1004925721 6:20413385-20413407 ATGTGAATGGATGTGGCAGAAGG - Intronic
1005605986 6:27477914-27477936 AAGTAGATAAATGAGGAAGAGGG - Intergenic
1006282122 6:33061418-33061440 ATGTAAATGGATGCAGAAAAAGG - Intergenic
1006886884 6:37389457-37389479 CTGTATTTGGAGGAGGAAGTAGG + Intronic
1007263536 6:40580577-40580599 TTGTATATGGATGAGGAAACTGG - Intronic
1008949283 6:57137759-57137781 TTGCCTAGGGATGAGGAAGATGG - Intronic
1009492408 6:64308391-64308413 ATGTATATTTATGAGAAAAAGGG + Intronic
1009659081 6:66586739-66586761 ATAAATATCAATGAGGAAGATGG + Intergenic
1009960572 6:70515840-70515862 ATGTGTAGGGGTGGGGAAGAGGG + Intronic
1010028545 6:71247261-71247283 ATATTTTTGGTTGAGGAAGAAGG - Intergenic
1010672999 6:78709063-78709085 CTGTCTATGAATGAGGAAGTGGG - Intergenic
1010996783 6:82542762-82542784 ATATAAATAAATGAGGAAGAAGG + Intergenic
1011755669 6:90496249-90496271 ATGTATCTCCATGAGTAAGAGGG + Intergenic
1011949598 6:92948566-92948588 ATGAATGTGGCTGGGGAAGATGG - Intergenic
1012096640 6:94970862-94970884 GTGTATGTGGAGAAGGAAGAGGG + Intergenic
1012503648 6:99919484-99919506 ATGTATTTAGATGAAGAAGGTGG + Intergenic
1012817992 6:104048761-104048783 ATGTTTAAGTATGAGGGAGAAGG - Intergenic
1013664434 6:112332584-112332606 ATGTTGGGGGATGAGGAAGATGG - Intergenic
1013960324 6:115891285-115891307 AGGCATATGGGTGAGTAAGAAGG - Intergenic
1014049139 6:116931354-116931376 ATACATTGGGATGAGGAAGAAGG - Exonic
1014829696 6:126088272-126088294 ATATACAGGGATGATGAAGACGG - Intergenic
1015540172 6:134305892-134305914 AGGTCTATGGAGGAGAAAGAGGG - Intronic
1015812700 6:137177326-137177348 AGGAACATGGATGTGGAAGAAGG - Intergenic
1016475184 6:144419438-144419460 AAGTATATGAATGATGAAAAAGG + Intronic
1016515683 6:144891068-144891090 AGGTATATGGATGACAAACAAGG + Intergenic
1019703204 7:2484451-2484473 ATGTTTATGGATGAGGAGTAAGG - Intergenic
1020053946 7:5103891-5103913 ATGTATAAGAATGGGGAAAATGG + Intergenic
1020827972 7:13055683-13055705 ATGATTATGGATCAGGAAGGTGG - Intergenic
1024613630 7:51088560-51088582 ATGCATATGGCTGAAGAAAATGG - Intronic
1025286012 7:57661772-57661794 ATGTATATGTATATGGAAAAGGG - Intergenic
1026250391 7:68664938-68664960 ATGTTGATCTATGAGGAAGAAGG + Intergenic
1027905692 7:84178382-84178404 ATGTGTATGGATGAGACACAGGG - Intronic
1027978576 7:85187476-85187498 AGGCATAGGGATGAGGAACAGGG + Intergenic
1028006649 7:85579417-85579439 ATGTATATGGCTGAGGGTCACGG + Intergenic
1028534782 7:91880541-91880563 TTGTCTTTGGAGGAGGAAGAGGG - Intronic
1028588407 7:92473114-92473136 ATGTACAGGGATGCAGAAGAAGG + Intronic
1028957535 7:96710592-96710614 ATGTATATGGATGAATATTATGG + Intergenic
1029043866 7:97606284-97606306 ATGTATATGTATGAGAGAGAGGG - Intergenic
1029337459 7:99914645-99914667 ATGTTTATGGGGTAGGAAGAAGG - Intronic
1029445221 7:100608137-100608159 ATTTATTTGGATAAGAAAGAAGG - Exonic
1031366640 7:120908316-120908338 ACGTATATGTATGAAGAATAAGG + Intergenic
1031962682 7:128004075-128004097 ATGTATTTGTGGGAGGAAGATGG + Intronic
1033460151 7:141539849-141539871 ATTTCTATGGAAGAGGAAAATGG + Intergenic
1035644016 8:1204719-1204741 ATGGAGATGGATGAGGCAGTAGG + Intergenic
1036105365 8:5832311-5832333 ATGAATATGAATGAACAAGAAGG + Intergenic
1037381908 8:18294180-18294202 ATATAAATGTATGAGGAAGTGGG - Intergenic
1037547973 8:19941702-19941724 ATGCATCTGGAGGAGAAAGAGGG - Intronic
1038390922 8:27200092-27200114 ATGGAAATGGATGAAGAGGAAGG - Intergenic
1038848392 8:31251170-31251192 ATGCATATGGGAGAGGAATAGGG + Intergenic
1038874303 8:31530914-31530936 ATGTAAATCTATTAGGAAGATGG - Intergenic
1038943377 8:32330476-32330498 AAGGATGTGGAGGAGGAAGATGG + Intronic
1040712233 8:50203071-50203093 ATATATAATGAAGAGGAAGAAGG - Intronic
1041079646 8:54204110-54204132 ATATATATATATGAGTAAGATGG - Intergenic
1041144898 8:54864180-54864202 ATGTCCATGGATGAGGAAGGTGG + Intergenic
1041326050 8:56665811-56665833 GTGTAGATGAATGATGAAGAGGG + Intergenic
1041716771 8:60939705-60939727 GTGCATGTGGAAGAGGAAGAAGG - Intergenic
1041831679 8:62161989-62162011 ATGTGCATGAATGTGGAAGAGGG - Intergenic
1041960262 8:63606841-63606863 ATGTGCATGTAAGAGGAAGAGGG + Intergenic
1042398185 8:68315173-68315195 ATGAATAAATATGAGGAAGAAGG - Intronic
1042454961 8:68990102-68990124 ATGACTTTGGTTGAGGAAGAGGG + Intergenic
1043271953 8:78345100-78345122 CTGTATATGAATTAGGAAGCAGG + Intergenic
1043325696 8:79048163-79048185 ATGTAAATAAATGAGGGAGAAGG + Intergenic
1045994705 8:108349517-108349539 ATGTATATGGTGCAGTAAGATGG + Intronic
1048067504 8:130985031-130985053 AAGTGTTTGGAGGAGGAAGAGGG + Intronic
1048320229 8:133393808-133393830 ATAAAGTTGGATGAGGAAGAGGG + Intergenic
1049023399 8:139972830-139972852 ATGCTTATAGATGAGGCAGACGG + Intronic
1049268063 8:141680101-141680123 ATGCATGTGGATGAGGATGATGG + Intergenic
1050275398 9:3992453-3992475 CTGTTTATGCATGAGGAGGAAGG - Intronic
1050582162 9:7070442-7070464 ATGTATATTCATGATGAATATGG - Intronic
1050955311 9:11650234-11650256 ATGTATTTGGAGGAGGCAGGTGG + Intergenic
1051648598 9:19296249-19296271 ATGTATAATGATTAGAAAGATGG + Intronic
1051993300 9:23180418-23180440 TTATATATTGATAAGGAAGATGG - Intergenic
1052406837 9:28072033-28072055 ATGTAGAAGGAGGATGAAGATGG - Intronic
1052643563 9:31201630-31201652 ATATATATAGATTAGGAAGGGGG + Intergenic
1054323465 9:63697301-63697323 ATATATTTGGAGGAGAAAGAAGG + Intergenic
1055101678 9:72472028-72472050 ATGGGGATGGATGAGGATGAGGG + Intergenic
1055164025 9:73168933-73168955 AATTATATGGAAGAGTAAGAAGG + Intronic
1055807677 9:80115184-80115206 ATCTATAGGGATGAGTTAGAAGG - Intergenic
1058271090 9:102972282-102972304 AGGTAGACTGATGAGGAAGATGG + Intergenic
1058491445 9:105504938-105504960 TTGTATATGGAGGAGGTAGTGGG - Intronic
1059738944 9:117130631-117130653 GTGTGTATGGAACAGGAAGAAGG + Intronic
1059786732 9:117594317-117594339 TTATGTATGGATGAGGAAGTTGG - Intergenic
1061377107 9:130233067-130233089 CTGTGTGTGGATGCGGAAGAAGG - Exonic
1202790361 9_KI270719v1_random:83028-83050 ATATATTTGGAGGAGAAAGAAGG + Intergenic
1186175588 X:6922885-6922907 ATGTAGCTGGAGGATGAAGAGGG - Intergenic
1187151419 X:16685210-16685232 CTGTCTATGGAGGAGGGAGAAGG - Intronic
1188604190 X:32007870-32007892 ATCTAAATGGATGATGAAAATGG + Intronic
1188787204 X:34362041-34362063 ATGGTAATAGATGAGGAAGATGG + Intergenic
1188933818 X:36148574-36148596 ATGTCTCTGGATCAGGAGGAAGG + Intergenic
1189059239 X:37735359-37735381 ATGTATATGTCTAAGGGAGATGG - Intronic
1189296409 X:39921388-39921410 TTGTGTATAGAGGAGGAAGAGGG - Intergenic
1190500115 X:51067214-51067236 ATGTATATGCATGGGAAAAAAGG + Intergenic
1190876450 X:54463681-54463703 ATATCTCTGGATCAGGAAGAAGG - Intronic
1191007406 X:55724330-55724352 TTTTTTATGGATGAGGAAAAAGG - Intronic
1191077468 X:56470229-56470251 ATGTATAGTGGTGAGGATGAGGG + Intergenic
1191937080 X:66437691-66437713 AGGTGTATGGGTTAGGAAGAGGG - Intergenic
1192563951 X:72147138-72147160 TTGTTCATTGATGAGGAAGAGGG - Intergenic
1193170637 X:78331880-78331902 ATGAGTATGGATGGGGAAGTGGG + Intergenic
1193484559 X:82070863-82070885 ATGTGTATGGATGAAAGAGAAGG - Intergenic
1194125175 X:90007983-90008005 CTGTGTATGGAAGAGGGAGATGG + Intergenic
1194802855 X:98293359-98293381 CTGTATATGGATCAGGAATATGG - Intergenic
1194966440 X:100293748-100293770 AAGTATTTGGATAGGGAAGAAGG + Exonic
1194988801 X:100522007-100522029 AAGAAGGTGGATGAGGAAGAAGG - Intergenic
1195361671 X:104088212-104088234 ATGTATATGGATGTGGGTGCAGG - Intergenic
1195450626 X:105008264-105008286 ATGCATGAGGATGATGAAGATGG + Intronic
1196278342 X:113795194-113795216 ATGTATCTGTATCAGAAAGAGGG + Intergenic
1196610793 X:117712506-117712528 AGGTATATGCATGTGGAAAAAGG + Intergenic
1197954636 X:131932507-131932529 ATGTACAGGGATGAAGAAAAAGG + Intergenic
1197966011 X:132062501-132062523 ATGTAAATGGATAAGAAAAAGGG - Intergenic
1198950595 X:142066885-142066907 AAGTATCTGTATCAGGAAGAGGG - Intergenic
1199118418 X:144020595-144020617 ATCTGGATGGATGAGGTAGAGGG + Intergenic
1199966551 X:152825105-152825127 CTGTAAAGGGATCAGGAAGATGG - Intergenic
1199966565 X:152825170-152825192 CTGTAAAGGGATCAGGAAGATGG - Intergenic
1200851486 Y:7888194-7888216 ATGTACAGGGATGAAGAAAAAGG + Intergenic