ID: 999353055

View in Genome Browser
Species Human (GRCh38)
Location 5:150895615-150895637
Sequence TTCGCTGGTGTCCCGGAAGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 84}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999353048_999353055 22 Left 999353048 5:150895570-150895592 CCTTTCCACATTCAGCACATATG 0: 2
1: 1
2: 4
3: 42
4: 351
Right 999353055 5:150895615-150895637 TTCGCTGGTGTCCCGGAAGGTGG 0: 1
1: 0
2: 1
3: 4
4: 84
999353049_999353055 17 Left 999353049 5:150895575-150895597 CCACATTCAGCACATATGTAAGG 0: 2
1: 0
2: 9
3: 143
4: 956
Right 999353055 5:150895615-150895637 TTCGCTGGTGTCCCGGAAGGTGG 0: 1
1: 0
2: 1
3: 4
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999353055 Original CRISPR TTCGCTGGTGTCCCGGAAGG TGG Exonic
905460311 1:38118543-38118565 GGCCCTGGTGTCCCTGAAGGAGG + Intergenic
906500785 1:46340729-46340751 TTCGCTCGTGTCCCGCCGGGTGG + Exonic
911533188 1:99070620-99070642 TTCACTAATGTCCCAGAAGGAGG + Intergenic
911866670 1:103034336-103034358 TTCGGTGGTGTCCCGCACTGAGG + Intronic
913112027 1:115665493-115665515 TTGGCTGGGCTCCAGGAAGGTGG + Intronic
918317686 1:183335634-183335656 TTCCCTGGTGTCCCAGGATGGGG + Intronic
923123344 1:231014378-231014400 TTCTCTTGAGCCCCGGAAGGTGG - Intergenic
1067562169 10:47311767-47311789 CTGGCTGGTGTCCCGGAAGGTGG - Intronic
1068055406 10:52006651-52006673 TTCACTGATGTCCCTGAAAGAGG + Intronic
1071898070 10:90086517-90086539 TTCTCTGGTGGGCCGGAATGGGG + Intergenic
1078105977 11:8358202-8358224 TTCCCTGGTGTCCCAGGAGAGGG - Intergenic
1081712265 11:45224929-45224951 TCCTCAGGTCTCCCGGAAGGTGG - Exonic
1083809521 11:65095986-65096008 GTTGCTGCTGTCCCAGAAGGGGG - Intronic
1090365696 11:126203540-126203562 TGCCCTGGGGTCCGGGAAGGAGG - Exonic
1092117610 12:6020580-6020602 TTTGCCAGTGTCCCGGAAAGTGG + Intronic
1092973621 12:13723020-13723042 TTCACTCGTGTCCAGGAAGCAGG + Intronic
1093355161 12:18158081-18158103 TTAGCTGGAGTCCCAGAAGTTGG - Intronic
1112497263 13:99915123-99915145 TACCCTGGTTTCCTGGAAGGAGG - Intergenic
1114558412 14:23575617-23575639 TGCGCTGGGGACCAGGAAGGCGG - Intronic
1116039101 14:39664028-39664050 GGCGCTGGTGTCCCGGCTGGAGG + Intergenic
1122152049 14:99730726-99730748 TACGCTCGCGTCCCGGCAGGAGG + Intergenic
1122549144 14:102540414-102540436 CTGGCAGGTGTCCCGGCAGGAGG + Intergenic
1123838954 15:24226461-24226483 GACACTGGTATCCCGGAAGGGGG - Intergenic
1126208485 15:46073332-46073354 TTAGCTGAAGTCCCAGAAGGTGG + Intergenic
1129015501 15:72464412-72464434 TTCGCTGTTGTCCAGGCTGGAGG - Intergenic
1136288647 16:29258720-29258742 TGCGCTGCTGGCCTGGAAGGTGG - Intergenic
1136547387 16:30963422-30963444 TTCGTTGTTGTCCTGGAGGGAGG - Exonic
1139009771 16:62617437-62617459 TCCCCTGGTGTCCTGGAAGCTGG + Intergenic
1140442828 16:74999892-74999914 GTCGCCGGTGCCCCGGGAGGCGG - Exonic
1142094362 16:88231626-88231648 TGCGCTGCTGGCCTGGAAGGTGG - Intergenic
1142432962 16:90040485-90040507 GACGCTGGTGTCCCGCAAGCTGG + Exonic
1143477588 17:7211604-7211626 TTTGCGGGGGTCCGGGAAGGGGG + Intronic
1147741768 17:42674210-42674232 TTGGCTGGGGTCCCGGGGGGCGG - Intronic
1148750280 17:49941578-49941600 TTCTCAGGTGTCCCGGGAGAGGG - Intergenic
1151541761 17:74768211-74768233 CTCGCTGGTGTCACTGGAGGCGG - Exonic
1155095142 18:22548283-22548305 TCAGCGGGTGTCCCAGAAGGAGG + Intergenic
1162411750 19:10510390-10510412 TTCCAAGGTTTCCCGGAAGGTGG + Intergenic
1162560721 19:11416824-11416846 TTCGCTACTGACCCGGGAGGTGG + Exonic
1163019048 19:14473038-14473060 GTCTCAGGTGTCCCGGAAAGAGG + Intronic
1167611719 19:50511029-50511051 TTCCTTGGTGTCCGGGGAGGGGG - Intronic
927509543 2:23635841-23635863 TTCACTGGTGTCCCAGATGATGG + Intronic
939782305 2:146464252-146464274 TTCATTGGTGTCCCTGAAAGAGG - Intergenic
945921114 2:215755464-215755486 TTCGCTGATGTCACCGGAGGTGG + Intergenic
946824066 2:223658075-223658097 TTCCCTGGTGGCCAGGAAGGTGG - Intergenic
947737453 2:232463919-232463941 TTCTCTGGTGTCCCAGAAGAAGG - Intergenic
948892053 2:240912224-240912246 CTAGCTGGTGTCCAGGGAGGTGG - Intergenic
1169197646 20:3692156-3692178 GGCCCTGGAGTCCCGGAAGGAGG + Exonic
1174335086 20:49854111-49854133 TTGGCTGGTGTTGTGGAAGGGGG + Intronic
1175863220 20:62161143-62161165 TTCCCTGCTGTCCCAGGAGGAGG + Intronic
1179442908 21:41407980-41408002 TTTGCTGGTTTCCTGGAAGAGGG - Exonic
1180569043 22:16698993-16699015 TTTGCCAGTGTCCCGGAAAGTGG + Intergenic
1184717105 22:46288567-46288589 CTCGCTGGCGTCCCGCAGGGTGG - Exonic
1184810257 22:46826576-46826598 TGTCCTGGTGTCCTGGAAGGTGG + Intronic
949799210 3:7884554-7884576 TTGGCTGGCCTCCAGGAAGGAGG - Intergenic
949951687 3:9234449-9234471 TTCTTTTGTGTCCCTGAAGGTGG + Intronic
960265377 3:115615367-115615389 TTCCATGGTGTGCTGGAAGGAGG + Intergenic
960997205 3:123348111-123348133 TTAGCTGGTGTCCCGGGGAGGGG - Intronic
963260179 3:143184492-143184514 TACCCTGGTGTCCTGGAAGATGG + Intergenic
963974554 3:151466508-151466530 TTAGCTGGAGTTCCAGAAGGTGG - Intergenic
967797419 3:193612707-193612729 TTAGCTGGAGTCCCTGAAGATGG + Intronic
971732747 4:30406855-30406877 TAGGCTGCTGTCCCTGAAGGTGG + Intergenic
980685183 4:136218790-136218812 TTCACTGGTGTCCCTGAAAGAGG - Intergenic
985674219 5:1221929-1221951 TACACTGGTGTCAGGGAAGGAGG + Exonic
996315137 5:122152881-122152903 TTCTCTGGTGTACCAGGAGGCGG - Exonic
998312168 5:141144447-141144469 GTCACTGGAGTCCCAGAAGGAGG + Intronic
999353055 5:150895615-150895637 TTCGCTGGTGTCCCGGAAGGTGG + Exonic
1001745668 5:174090553-174090575 TTGGCTGGTGTCTGGGAAGCTGG - Intronic
1002808973 6:607019-607041 ATCGCTGGTGGCCTTGAAGGAGG + Intronic
1003629965 6:7777875-7777897 TACAGTGGTGTCCCGGACGGGGG - Intronic
1004490311 6:16109214-16109236 TTGGCTGGTGTCCAGGAATTTGG + Intergenic
1004999855 6:21229866-21229888 TTAGCTGGTGTCCAGGGAAGCGG - Intronic
1007799398 6:44379250-44379272 TTCCCTGGTGTTTTGGAAGGAGG + Intergenic
1013288444 6:108699778-108699800 TTCACTGGTGGGCGGGAAGGAGG - Intergenic
1018696948 6:166397792-166397814 TTCCCTGTGGTCCCAGAAGGTGG - Intergenic
1018857886 6:167688509-167688531 TTCCCTGGTGCCCTGCAAGGAGG - Intergenic
1019044203 6:169130745-169130767 TTCTATGGTGTTCCGGCAGGGGG - Intergenic
1019658952 7:2213125-2213147 TGCGCTGGTGAGCCGGAAGCAGG + Intronic
1022501108 7:30882909-30882931 TTGGGTGGTGTCTGGGAAGGAGG - Exonic
1023996785 7:45163446-45163468 GCTGCTGGTGTCCAGGAAGGAGG + Intronic
1044635769 8:94322386-94322408 TTAGCTGGAATCCCAGAAGGTGG - Intergenic
1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG + Exonic
1047379103 8:124339794-124339816 TTAGCCAGTGTCCCAGAAGGTGG - Intronic
1049835195 8:144730769-144730791 TTCGGGGGTGTCCAAGAAGGAGG - Intronic
1056762618 9:89425896-89425918 TGCCCTGGTGTCCCTGGAGGAGG - Intronic
1058843655 9:108934441-108934463 AGCGCTGGGGTCCCGGAGGGCGG + Exonic
1061813947 9:133182068-133182090 TTAGCTGGAGTCCCAGAATGTGG + Intergenic
1186518213 X:10182769-10182791 TTCCCTGGGGACCCAGAAGGAGG - Intronic
1187142227 X:16605036-16605058 TTGGCTGGTGTCCGGGAACATGG + Intronic
1193394847 X:80971231-80971253 TTACCTGGAGTCCCAGAAGGTGG + Intergenic
1200083664 X:153592254-153592276 GTCGCCGGTGTCCCGGGAGGAGG - Intronic