ID: 999353238

View in Genome Browser
Species Human (GRCh38)
Location 5:150898109-150898131
Sequence ATGTCTCCCTTTATGATCCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 113}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999353232_999353238 25 Left 999353232 5:150898061-150898083 CCTTGTCTCCCATCTGCCTGATA 0: 1
1: 0
2: 1
3: 26
4: 303
Right 999353238 5:150898109-150898131 ATGTCTCCCTTTATGATCCATGG 0: 1
1: 0
2: 2
3: 7
4: 113
999353233_999353238 17 Left 999353233 5:150898069-150898091 CCCATCTGCCTGATATTCATCTG 0: 1
1: 0
2: 0
3: 10
4: 177
Right 999353238 5:150898109-150898131 ATGTCTCCCTTTATGATCCATGG 0: 1
1: 0
2: 2
3: 7
4: 113
999353234_999353238 16 Left 999353234 5:150898070-150898092 CCATCTGCCTGATATTCATCTGG 0: 1
1: 0
2: 0
3: 20
4: 221
Right 999353238 5:150898109-150898131 ATGTCTCCCTTTATGATCCATGG 0: 1
1: 0
2: 2
3: 7
4: 113
999353236_999353238 9 Left 999353236 5:150898077-150898099 CCTGATATTCATCTGGATAGATC 0: 1
1: 0
2: 0
3: 6
4: 91
Right 999353238 5:150898109-150898131 ATGTCTCCCTTTATGATCCATGG 0: 1
1: 0
2: 2
3: 7
4: 113
999353231_999353238 26 Left 999353231 5:150898060-150898082 CCCTTGTCTCCCATCTGCCTGAT 0: 1
1: 0
2: 1
3: 37
4: 291
Right 999353238 5:150898109-150898131 ATGTCTCCCTTTATGATCCATGG 0: 1
1: 0
2: 2
3: 7
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999353238 Original CRISPR ATGTCTCCCTTTATGATCCA TGG Exonic
904008143 1:27374443-27374465 GTGTCTCCCTGTAGGACCCAGGG - Exonic
908434442 1:64091575-64091597 ATGTGTCCCATTCTGAGCCATGG + Intronic
910494227 1:87808552-87808574 AAGTTTCCCTTCATGATCCAGGG - Intergenic
912739598 1:112181843-112181865 AGAGCTCCCTGTATGATCCATGG - Intergenic
919042279 1:192405332-192405354 CTGTGACCCTTTAAGATCCAAGG - Intergenic
920814199 1:209315552-209315574 ATCTCTGCCTGTATGATCTATGG - Intergenic
924332441 1:242953566-242953588 GTATCTCCCTCCATGATCCACGG + Intergenic
1066288842 10:33995626-33995648 ATATCTTGCTCTATGATCCAAGG - Intergenic
1067774688 10:49154439-49154461 ATGTCAGCGTTTATGACCCAAGG + Intergenic
1068029402 10:51688422-51688444 TTGTCTCCCTTTAACCTCCACGG - Intronic
1068572397 10:58644567-58644589 CTGGCTCCCTTTAGGCTCCATGG + Intronic
1072198119 10:93134549-93134571 ATGTCTCACTTTCTGTTCTAGGG + Intergenic
1074756617 10:116628345-116628367 CAGTCTCCCTTTATTACCCAGGG - Intronic
1075505285 10:123015915-123015937 ATGTCTTCCTTTCTGATCATCGG - Intronic
1078843441 11:15100536-15100558 AAGTCTGGCTTTATCATCCAAGG - Intergenic
1081919751 11:46762659-46762681 ATGTTTCCCTTTATCATGGAAGG - Exonic
1084877120 11:72141281-72141303 ATGCCTCCCATTATGATGCACGG - Intergenic
1087685506 11:101258413-101258435 CTGTCTCCCTTTCTGAACAATGG - Intergenic
1088082808 11:105940002-105940024 ATTCCTCCCCTTATGATCCCAGG + Intronic
1090252211 11:125259650-125259672 ATGTCTTCCTTTGGGATCCTGGG + Intronic
1090371224 11:126254495-126254517 ATGTTCCCCTTTAAGATCTATGG - Intronic
1090841639 11:130494312-130494334 ATGTGTCCATTTCTGATACAAGG + Intergenic
1091180767 11:133602345-133602367 AGGTCTCCCTTTGTCACCCAGGG - Intergenic
1102221518 12:111198026-111198048 ATATCTCACTTTAGGGTCCAGGG - Intronic
1106126905 13:26908127-26908149 AAGCCCCCCTCTATGATCCACGG + Intergenic
1106243348 13:27927178-27927200 AAGTTCCCCTTTCTGATCCAAGG - Intergenic
1107260687 13:38487300-38487322 GTGTCTGGATTTATGATCCATGG - Intergenic
1110614597 13:77527353-77527375 ATCTCTCCCCTAATAATCCATGG - Intergenic
1110620769 13:77592897-77592919 ATTGTTCCTTTTATGATCCAGGG + Intronic
1111905897 13:94255819-94255841 TTGATTCCCTCTATGATCCAGGG - Intronic
1112316030 13:98362721-98362743 GTCTCTCCCTGTATGATCCAAGG + Intronic
1113547056 13:111161271-111161293 ATTTCTCCTTTTTTGATTCAGGG + Intronic
1115129212 14:30033579-30033601 ATGTCTCCATCTAAGATACAAGG - Intronic
1115562790 14:34598415-34598437 CTGTCTCCCTCTGTCATCCAAGG + Intronic
1117554960 14:56874697-56874719 ATGTATCCCTTTCTCATGCATGG + Intergenic
1118775491 14:68971490-68971512 ATGGCTCCCTTTAAGAGTCAAGG + Intronic
1119614284 14:76088624-76088646 ATGGCTGCCTTTATGCTACAAGG + Intergenic
1121727310 14:96162136-96162158 ATGCCGCCCTCTGTGATCCATGG - Intergenic
1125348213 15:38740980-38741002 AGGTCTCCTTTTATTTTCCATGG - Intergenic
1130627470 15:85530377-85530399 GTGACTCCCTTTCTGATTCAAGG + Intronic
1132782129 16:1633097-1633119 ATGTCTCACATTCTGACCCAGGG + Intronic
1133781173 16:8940555-8940577 ACCTCTCCCTTTCTGATGCAGGG - Intronic
1135267345 16:21038897-21038919 ATGTCTTTGTTTATAATCCAAGG - Intronic
1137048992 16:35692399-35692421 GTCTCTCCCATTATGATTCATGG + Intergenic
1137240541 16:46652054-46652076 CTGTCACCCGCTATGATCCACGG + Intergenic
1137510746 16:49097830-49097852 TTCTCTCCCTGTATAATCCAGGG - Intergenic
1137749106 16:50845507-50845529 ATCTCTCCCTTGAAGATTCAAGG + Intergenic
1137953312 16:52804304-52804326 ATGATTCACTTTATGATCCTTGG + Intergenic
1139583195 16:67885186-67885208 ATGTCTCCCTTTATCATAAGAGG - Intronic
1140805634 16:78529800-78529822 CTGGCTCCCTTTATAATCCTAGG - Intronic
1140960950 16:79912186-79912208 ATTTCACCCTTTATGCTTCAAGG - Intergenic
1149285220 17:55156208-55156230 ACATCTCCCTTTATGAACCATGG + Intronic
1153024349 18:659262-659284 ATGCCTCCCTTTTTGTTCCTGGG + Intronic
1157942908 18:51948739-51948761 ATGTATGCCCTTATGATCTATGG + Intergenic
1163153086 19:15426107-15426129 ATACCTCCCTGTATGATCCTGGG + Intronic
1164376887 19:27695119-27695141 ATGTCTCCCATTAGAATGCATGG + Intergenic
925613104 2:5719885-5719907 ATGTCTCCTTTTATTATATAAGG - Intergenic
928152420 2:28843995-28844017 ATGCCTCCCTATATGATCCAGGG - Intronic
930004295 2:46883571-46883593 GGGTCTCCCTTTGTCATCCAGGG + Intergenic
934652538 2:96100645-96100667 CTGTCTCCCTTTGTGTTCCTGGG - Intergenic
938817724 2:134921206-134921228 ATTTCTACCATTATTATCCAGGG - Intronic
942658001 2:178234713-178234735 ATTTTTCCTTTTATGATCTAGGG + Intronic
948007999 2:234626578-234626600 ATGACTGCCTCTTTGATCCATGG + Intergenic
1173785192 20:45787981-45788003 CTGTCTCCCTTTTTGCTACAGGG - Exonic
1174226806 20:49007192-49007214 ATCTCTTCCTTTATGCTCCATGG - Intronic
949439877 3:4069086-4069108 ATGGCTCCATTTATCATGCACGG - Intronic
950639671 3:14340601-14340623 ATTTCCCCATTTGTGATCCAAGG - Intergenic
953201607 3:40782812-40782834 ATGTGCCCCTTCATGATCCCTGG - Intergenic
953511304 3:43542611-43542633 ATGTCTCCATTTTATATCCAAGG + Intronic
954283612 3:49602169-49602191 ATGTTCCTCTTTCTGATCCAAGG - Intronic
961689060 3:128655156-128655178 AAGTCTCACTTTGTCATCCAGGG - Intronic
963892509 3:150651640-150651662 ATGTCTACCTAAATGATACATGG + Intergenic
966359268 3:179117016-179117038 ATGGATCCATTTATGATACATGG - Intergenic
966389838 3:179440618-179440640 ATGGATCCATTTATGATACATGG - Intronic
967526308 3:190497858-190497880 ATGTCTTCCTTTAAGAACTAGGG - Intergenic
973256220 4:48116370-48116392 ATACTTACCTTTATGATCCAGGG - Intronic
974338221 4:60579230-60579252 ATGTCCTCATTTCTGATCCAGGG - Intergenic
975181935 4:71355938-71355960 ATGGCTCCCTTTCTGGTACATGG - Intronic
977249430 4:94673317-94673339 ATGTCTCCTTTTCTGAACGAAGG - Intergenic
983877791 4:172897054-172897076 ATGTTTGCCTTTCTGAACCAAGG - Intronic
984644654 4:182206440-182206462 ATGTCTCCCTCTCTGAGCCTTGG + Intronic
994705857 5:103205660-103205682 ATTTCTCCTTTTATTATCAATGG + Intronic
999353238 5:150898109-150898131 ATGTCTCCCTTTATGATCCATGG + Exonic
999356768 5:150942238-150942260 ATGTGTCTCTTTATGATCCATGG + Intergenic
1005247723 6:23907926-23907948 ATGTCCTCCTTTATGATTGAGGG - Intergenic
1008652791 6:53580334-53580356 ATGTCTACTTTTATCCTCCATGG + Intronic
1009692113 6:67048568-67048590 ATCTCCCCATATATGATCCAGGG + Intergenic
1013010664 6:106117089-106117111 AGGTCTACCTTTGTGTTCCAAGG + Intergenic
1017236569 6:152122634-152122656 ATTCCTCCCTTTCTGAGCCAGGG - Exonic
1019040810 6:169102991-169103013 AAATCTCCCTTCATGTTCCAGGG - Intergenic
1022040964 7:26580744-26580766 CTGTCTCCCTCTATGGACCAAGG - Intergenic
1024725092 7:52184895-52184917 GTGATTTCCTTTATGATCCATGG + Intergenic
1027987256 7:85309095-85309117 TTGTCTCCATTTTTGCTCCATGG + Intergenic
1028348407 7:89813064-89813086 ATCTCCCCCTTTATTATCAATGG + Intergenic
1030379683 7:108798144-108798166 AGATCTCCCTTTGAGATCCATGG - Intergenic
1033410608 7:141114427-141114449 ATCTCTCCCTTTCTGCCCCAGGG + Intronic
1038052000 8:23822698-23822720 ATGTCTCCCTTTCTGCTTTAAGG + Intergenic
1040995404 8:53396035-53396057 ATGTGGCCCTTCATGGTCCAGGG + Intergenic
1044049924 8:87487922-87487944 TTATCTCCTTTTATGATACAAGG - Intronic
1044226319 8:89722946-89722968 AAGTCTCCCTTTATAATAAATGG - Intergenic
1044914291 8:97095811-97095833 ATGTCTCCCTTTAGTATCTAAGG + Intronic
1048706871 8:137163587-137163609 AACTCTTCCTTAATGATCCAGGG - Intergenic
1050171961 9:2829223-2829245 ATGTGTGCATTTATGTTCCAAGG + Intronic
1050796107 9:9544702-9544724 ATCTATCTTTTTATGATCCAAGG - Intronic
1051504791 9:17815105-17815127 ATGCCTCACTTTATAAACCATGG + Intergenic
1052935952 9:34093335-34093357 ATGTCTCCTTCTTGGATCCACGG - Exonic
1054757693 9:68975801-68975823 ATCTCTGCCTTTATCTTCCATGG + Intronic
1055496912 9:76864434-76864456 ATGTATTTCTTTAGGATCCAGGG - Intronic
1056073019 9:83008246-83008268 ATGTGTACTTTTATCATCCAGGG - Intronic
1057448371 9:95135147-95135169 ATCTCTCCCTGCATGCTCCAAGG + Intronic
1058475241 9:105326459-105326481 ATGTCTCCCTCCATGGTACATGG + Intronic
1059301994 9:113321328-113321350 ACCTCTACCTTAATGATCCATGG + Intronic
1059951936 9:119474705-119474727 TTGACTTCTTTTATGATCCATGG - Intergenic
1060068656 9:120527190-120527212 ATGGTTGCCTTTGTGATCCAAGG - Intronic
1060271760 9:122148070-122148092 AGGTCTCACTTTCTGATTCAGGG - Intronic
1062374874 9:136257562-136257584 TTGTCCCCCTTTGTGATCCCCGG - Intergenic
1203585869 Un_KI270747v1:3034-3056 ATGTGTCTCTTTAAGACCCAGGG + Intergenic
1191070109 X:56392135-56392157 ATGTCTCGCTTTATGAATCTGGG + Intergenic
1194867109 X:99082904-99082926 ATGTCTCACATTATAGTCCAAGG - Intergenic
1195491867 X:105479834-105479856 ATGACTGCCTTTATGTTCCCAGG + Intronic
1198011342 X:132558307-132558329 AGGTCTCCCTCTGTCATCCAGGG - Intergenic
1198481791 X:137047945-137047967 ATGGCTCATTTTATGATCCATGG + Intergenic
1199112180 X:143947844-143947866 AATTATCCCTTAATGATCCATGG - Intergenic