ID: 999356464

View in Genome Browser
Species Human (GRCh38)
Location 5:150938263-150938285
Sequence GCAAATCATCAAACCAATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999356458_999356464 19 Left 999356458 5:150938221-150938243 CCATGAGTATAACAGCTTTTCTG No data
Right 999356464 5:150938263-150938285 GCAAATCATCAAACCAATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999356464 Original CRISPR GCAAATCATCAAACCAATGG TGG Intergenic
No off target data available for this crispr