ID: 999361337

View in Genome Browser
Species Human (GRCh38)
Location 5:150989024-150989046
Sequence CTGTCTAACCGGATGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999361328_999361337 15 Left 999361328 5:150988986-150989008 CCAACTGTTGGTTAACCTGTGAA No data
Right 999361337 5:150989024-150989046 CTGTCTAACCGGATGGAGGAGGG No data
999361330_999361337 0 Left 999361330 5:150989001-150989023 CCTGTGAAACAAATGTTGGCCCA 0: 2
1: 1
2: 4
3: 10
4: 109
Right 999361337 5:150989024-150989046 CTGTCTAACCGGATGGAGGAGGG No data
999361327_999361337 18 Left 999361327 5:150988983-150989005 CCACCAACTGTTGGTTAACCTGT No data
Right 999361337 5:150989024-150989046 CTGTCTAACCGGATGGAGGAGGG No data
999361326_999361337 21 Left 999361326 5:150988980-150989002 CCTCCACCAACTGTTGGTTAACC No data
Right 999361337 5:150989024-150989046 CTGTCTAACCGGATGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999361337 Original CRISPR CTGTCTAACCGGATGGAGGA GGG Intergenic
No off target data available for this crispr