ID: 999364023

View in Genome Browser
Species Human (GRCh38)
Location 5:151009676-151009698
Sequence CCTAACCTGGTCCCCAGGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999364023_999364032 -4 Left 999364023 5:151009676-151009698 CCTATCCTGGGGACCAGGTTAGG No data
Right 999364032 5:151009695-151009717 TAGGAAAGGGAAGTGGAGGGAGG No data
999364023_999364031 -7 Left 999364023 5:151009676-151009698 CCTATCCTGGGGACCAGGTTAGG No data
Right 999364031 5:151009692-151009714 GGTTAGGAAAGGGAAGTGGAGGG No data
999364023_999364035 28 Left 999364023 5:151009676-151009698 CCTATCCTGGGGACCAGGTTAGG No data
Right 999364035 5:151009727-151009749 CTCTAAAATGCTCTGCAAATGGG No data
999364023_999364034 27 Left 999364023 5:151009676-151009698 CCTATCCTGGGGACCAGGTTAGG No data
Right 999364034 5:151009726-151009748 TCTCTAAAATGCTCTGCAAATGG No data
999364023_999364030 -8 Left 999364023 5:151009676-151009698 CCTATCCTGGGGACCAGGTTAGG No data
Right 999364030 5:151009691-151009713 AGGTTAGGAAAGGGAAGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999364023 Original CRISPR CCTAACCTGGTCCCCAGGAT AGG (reversed) Intergenic
No off target data available for this crispr