ID: 999367143

View in Genome Browser
Species Human (GRCh38)
Location 5:151030462-151030484
Sequence ACTCCTTCCCTGCTGCTGAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 298}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999367143_999367148 21 Left 999367143 5:151030462-151030484 CCACTCAGCAGCAGGGAAGGAGT 0: 1
1: 0
2: 4
3: 23
4: 298
Right 999367148 5:151030506-151030528 GAGTACAAATGAAAGCCTTCTGG 0: 1
1: 0
2: 0
3: 12
4: 137
999367143_999367150 25 Left 999367143 5:151030462-151030484 CCACTCAGCAGCAGGGAAGGAGT 0: 1
1: 0
2: 4
3: 23
4: 298
Right 999367150 5:151030510-151030532 ACAAATGAAAGCCTTCTGGGTGG 0: 1
1: 0
2: 1
3: 17
4: 206
999367143_999367149 22 Left 999367143 5:151030462-151030484 CCACTCAGCAGCAGGGAAGGAGT 0: 1
1: 0
2: 4
3: 23
4: 298
Right 999367149 5:151030507-151030529 AGTACAAATGAAAGCCTTCTGGG 0: 1
1: 0
2: 0
3: 13
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999367143 Original CRISPR ACTCCTTCCCTGCTGCTGAG TGG (reversed) Exonic
900530011 1:3148492-3148514 TCACCTTCCCTGCTTCTGAGGGG + Intronic
901248764 1:7756207-7756229 TCTCCCTCCCTGGTGCTGTGAGG + Intronic
902667862 1:17952239-17952261 ACTTCGTGCCTGCTGCTGATGGG - Intergenic
903035208 1:20488368-20488390 GCTCCTTCCTTGCTGCTGAGAGG + Intergenic
903696974 1:25214872-25214894 AGTCCTTTCCTGTTGCTCAGAGG - Intergenic
904048869 1:27626160-27626182 CCTCCTGCCCTGTTGCTCAGAGG - Intronic
904314680 1:29652508-29652530 AGTCCATCCCTCCTGCAGAGAGG - Intergenic
905296301 1:36956475-36956497 ACTCCTTCCACGCTGGTGTGTGG + Intronic
905974072 1:42162860-42162882 AGAGCTTCCCTGCTGCGGAGGGG + Exonic
906142942 1:43544515-43544537 TCTCCCTCCCTGCTGGGGAGAGG + Intronic
906864086 1:49397110-49397132 ACTGCTCCCCTCCTGCTGTGTGG + Intronic
908009363 1:59759765-59759787 ACTCAGTCCCTGCTTCTGTGTGG - Intronic
908439794 1:64142272-64142294 ACAGCTTCCCTGCTGGTCAGGGG - Intronic
908726818 1:67185234-67185256 TCTCCTTCTCTGCAGCTGTGTGG - Intronic
910254087 1:85229917-85229939 ACTGCTTCCCTCCTGCTGTGTGG - Intergenic
910962570 1:92778362-92778384 ATTTCTTCCAAGCTGCTGAGTGG + Intronic
911335194 1:96573548-96573570 AGTCCTGCCCTGCTCCTGACTGG + Intergenic
912391686 1:109307250-109307272 TCTCCCTCCCTGGTGCTGTGGGG - Intergenic
912433680 1:109643629-109643651 AGTCATCCCATGCTGCTGAGGGG + Intergenic
912506742 1:110161767-110161789 CCTCCTCCCCGGCTGCTGTGGGG + Intronic
912692908 1:111818217-111818239 CCTCCTTCCCTCCTGCCCAGAGG - Intronic
914935206 1:151973076-151973098 ACTCCCTCCCTCTTGCTGACTGG + Intergenic
915460191 1:156065901-156065923 ACTCCTTCAGTGGTGCTGATCGG + Exonic
916381273 1:164214590-164214612 TCTCGTGCCCTGCTGGTGAGAGG + Intergenic
918019589 1:180673549-180673571 ACTGCTTACCTCCTGCTGTGTGG - Intronic
918088130 1:181262776-181262798 ACTCCTTCCCTGCTTGTGGAGGG - Intergenic
918298310 1:183178933-183178955 ATTGCTTACCTGCTGCAGAGGGG + Intergenic
919837273 1:201583487-201583509 ACTCCTTCCCTGCTGGAGATAGG + Intergenic
920404828 1:205701361-205701383 ACTCCTAGGCTGCAGCTGAGGGG + Intergenic
921925907 1:220710137-220710159 CCTCCTTGCCTCCTACTGAGGGG + Intergenic
922899143 1:229122907-229122929 ATTCCTGCCTTGCTGCTGAGTGG + Intergenic
923674011 1:236064898-236064920 TCTCCTGCCCTGGAGCTGAGTGG - Exonic
1063297993 10:4825961-4825983 AAACCTTCCCTGCTCCTGCGTGG + Intronic
1064769528 10:18710228-18710250 CCTCCTTCTCTGCGGCTGCGCGG + Intergenic
1065083874 10:22154778-22154800 CCTCATTGCCTACTGCTGAGTGG + Intergenic
1065937933 10:30537588-30537610 ACCCCTTGCCTGGTGATGAGAGG - Intergenic
1067280036 10:44864373-44864395 ACTCCTTCCCTAATGTGGAGTGG + Intergenic
1067666647 10:48284997-48285019 TCTCCTTGCCCGATGCTGAGCGG + Intergenic
1069182072 10:65374147-65374169 ACTCGTTTCCTTCTTCTGAGAGG + Intergenic
1070955789 10:80462496-80462518 CAGCCTTTCCTGCTGCTGAGGGG - Intronic
1071096727 10:81984085-81984107 ACTCTTTCCCTGCTTTTTAGTGG - Intronic
1072627328 10:97121180-97121202 AGGCCTTCCATGCTGTTGAGAGG - Intronic
1072915261 10:99533743-99533765 ACTGCTGCCCTGATGCTGAGAGG + Intronic
1073134608 10:101213573-101213595 CCTCTTTCCCTCCTGCTGTGGGG - Intergenic
1076003911 10:126932912-126932934 ACTCCTCCCCTCCTGCTCTGGGG + Intronic
1076420076 10:130325147-130325169 ACTCCTCCTCTCCTGCAGAGAGG + Intergenic
1077264606 11:1642489-1642511 ACCCCTCCCCAGCTGCGGAGCGG - Intergenic
1077457159 11:2688041-2688063 ACTCCATGGCTGCAGCTGAGTGG - Intronic
1077934288 11:6767581-6767603 AGTCCTCCTCTGATGCTGAGAGG + Intergenic
1078174078 11:8955716-8955738 ACTGCTCACCTCCTGCTGAGTGG + Intronic
1078618292 11:12884774-12884796 ACTCCTTCCAAGCAGCTGAGTGG + Intronic
1079463819 11:20709069-20709091 ACTGCTCACCTGCTGCTGTGTGG + Intronic
1081585450 11:44380818-44380840 GCTGCTTTCCTGCTGCAGAGTGG + Intergenic
1082790891 11:57346142-57346164 AGTCATTCCATGCTGCTGATGGG - Intronic
1082792643 11:57357536-57357558 ACTCGCTCTCTGCTCCTGAGAGG - Intronic
1083772758 11:64877765-64877787 ACTGCGGCCCTGCTGCTGAGGGG + Intronic
1084562165 11:69911218-69911240 ACTCCTTCCCTTCCCCTGAGAGG + Intergenic
1084696114 11:70756519-70756541 GCTCCTTCCCTCCAGCTGTGTGG + Intronic
1085533263 11:77203859-77203881 AGTCCATCCCAGCTGCTGTGAGG + Intronic
1085822870 11:79811764-79811786 ACTTCTTCCCAGTTGCTGTGAGG + Intergenic
1087321465 11:96664765-96664787 ACTCTTACCCTACTGCTAAGAGG - Intergenic
1088724318 11:112620873-112620895 ACTCTCTCCCCGGTGCTGAGCGG - Intergenic
1090374171 11:126277329-126277351 ACCCTCTACCTGCTGCTGAGGGG - Intronic
1090972080 11:131652784-131652806 ATTCCTGCCCTGCTGCAGCGTGG - Intronic
1095766848 12:45905192-45905214 TCTCCTCCCATGATGCTGAGAGG + Exonic
1096530105 12:52236964-52236986 ACTCCTTCTTTGCCCCTGAGGGG + Intronic
1096536731 12:52279647-52279669 CCTCCTCCCCTCCTGCTGTGAGG + Intronic
1099519450 12:83642366-83642388 GCTGCTTCCCTGCTGCTGGGTGG + Intergenic
1100183337 12:92108862-92108884 AGTCTTTCCCTCCTGCAGAGAGG - Intronic
1101615129 12:106328899-106328921 ACTCCTTCCCGGGATCTGAGTGG - Intronic
1101819030 12:108168924-108168946 ACTGCTTACCTCCTGCTGTGTGG - Intronic
1102047086 12:109836039-109836061 AATCCTGCCCTGCCGCTGATGGG + Intergenic
1102051315 12:109864113-109864135 ATTCCTCCCCTACTGTTGAGCGG - Intronic
1102484371 12:113246177-113246199 ACTCCTTCCCGTCCTCTGAGTGG + Intronic
1103884135 12:124188289-124188311 GCTCCTTCCCTTCTCCTGGGAGG - Intronic
1104088867 12:125497820-125497842 ACTCCTGGCCACCTGCTGAGCGG - Intronic
1104359686 12:128121081-128121103 ACGTGTTCCCTGCTGCTGGGAGG + Intergenic
1104440210 12:128788031-128788053 TCTACTTCTCTGATGCTGAGAGG + Intergenic
1104473846 12:129054024-129054046 AGTCCTTCACGGATGCTGAGGGG - Intergenic
1105210500 13:18254276-18254298 GCTGCTTCCCTGCGGCTGATGGG + Intergenic
1105771948 13:23620405-23620427 ACACCCTACCTGCTACTGAGAGG - Intronic
1106474288 13:30084099-30084121 ACTGCTTGCCTCCTGCTGTGTGG - Intergenic
1108434100 13:50384900-50384922 TCTCCACCCCTGCTGCAGAGAGG + Intronic
1109134147 13:58625772-58625794 CCTTCTGCCCTGCTGCTGACAGG + Intergenic
1110560521 13:76906781-76906803 ACTCCTTCCCAGTTGGGGAGGGG - Intergenic
1112602779 13:100873123-100873145 GCTCCTCCCAGGCTGCTGAGTGG + Intergenic
1113190466 13:107739709-107739731 ACTGCTCACCTGCTGCTGTGTGG - Intronic
1113651631 13:112037356-112037378 TCCCCTTCCCTGCTGCTGAGGGG + Intergenic
1115135600 14:30103967-30103989 ACTACTACCCTGCTGATGATCGG - Intronic
1117252759 14:53952867-53952889 ACCCCTTCCCTGGGGATGAGCGG - Intronic
1122809473 14:104280924-104280946 ACACCATCCCTGGTGCTGAGTGG - Intergenic
1124165501 15:27322321-27322343 ACTCTTTCCCTGTAGCAGAGGGG - Intronic
1124653581 15:31489807-31489829 ATTCCAGCCCTGCTGTTGAGGGG - Intronic
1130192222 15:81748406-81748428 CACCCTTCCCTGCTGCTGACAGG + Intergenic
1130326940 15:82888948-82888970 ACTCCTTCCCTGGGGAGGAGTGG + Intronic
1132770707 16:1561276-1561298 AGTCATTCTCTGCTTCTGAGAGG - Intronic
1133033477 16:3022416-3022438 ACTCCCTCCCTCCAGCTCAGGGG - Intergenic
1133721117 16:8495279-8495301 TCTCCATCTCTGGTGCTGAGGGG - Intergenic
1134647379 16:15880690-15880712 ACTCCTCACCTCCTGCTGTGTGG - Intronic
1135042851 16:19131159-19131181 ACGCCTTCCCATCTGCTGAAAGG - Intronic
1135464766 16:22675809-22675831 TCCCCTTTCCTGCTGCTCAGTGG - Intergenic
1135755849 16:25097405-25097427 ACTCCTTCCCTTTTGCTCAGAGG + Intergenic
1138339309 16:56278379-56278401 ACTCCTTTCCTGCTCCTCACAGG - Intronic
1138344781 16:56313593-56313615 ACTCCTTCCCTGTTCGTGTGGGG - Intronic
1139968061 16:70756513-70756535 GCGCCTACCCTGCTGGTGAGGGG + Intronic
1140479571 16:75255250-75255272 CCACCCTCCCTGCTGCTGGGAGG - Intronic
1140834085 16:78777500-78777522 ACACCGTGCCTGCTGCTAAGAGG + Intronic
1142099098 16:88262142-88262164 ATTCCTTCACTAATGCTGAGTGG - Intergenic
1142138337 16:88461547-88461569 CCTCCTTCCCGGCTGTTGTGTGG + Intronic
1142279451 16:89140160-89140182 GCACCTTCCCTCCTGCTGGGCGG + Intronic
1142311633 16:89317538-89317560 GCTCCTTCCCAGGTGGTGAGTGG - Intronic
1142361516 16:89629813-89629835 GCGCCTGCCCTGTTGCTGAGGGG - Intronic
1203140365 16_KI270728v1_random:1761029-1761051 ATTGCTTTCCTGCTGCAGAGAGG - Intergenic
1142509496 17:385305-385327 CCTCCTGCCCGGCTGCTCAGAGG - Intronic
1144305970 17:13969838-13969860 ACTCCTTGCCTCCAGGTGAGGGG + Intergenic
1144732592 17:17537255-17537277 AATCCTGCCCTGCTCCTGTGAGG + Intronic
1144826521 17:18108456-18108478 AAGCCTTCCCCGCTGCTCAGAGG - Intergenic
1145043058 17:19591123-19591145 ACTCCTTCGCTGCTCCCTAGTGG - Intergenic
1145398652 17:22514554-22514576 ACTCCAGCCCAGCTGCTCAGGGG - Intergenic
1146301589 17:31693789-31693811 GCTCCTTCCCCACTGGTGAGGGG + Intergenic
1147587792 17:41662689-41662711 CTTCCTTCCCTGCTGCTGTTAGG + Intergenic
1148052779 17:44777290-44777312 ACACCTGCCCTGGAGCTGAGAGG - Intronic
1148161835 17:45454545-45454567 ACGCCTTCCCTCCTGCTGCCAGG + Intronic
1151926393 17:77200742-77200764 CCTCCTTCCCTGGAGTTGAGTGG + Intronic
1152228261 17:79102562-79102584 CCTCCTTCCCTGCTCCCCAGGGG - Intronic
1152682615 17:81676935-81676957 CCTCCTTGCCTGCTCCTGACAGG - Intergenic
1152877171 17:82793510-82793532 TTTCCTGCCCTGCTGCTGAGGGG + Intronic
1154976355 18:21461175-21461197 TCCCCTTCCCTGCTGATCAGTGG + Intronic
1155995627 18:32328753-32328775 AGTCCTTCCCTGCCCCTAAGTGG - Intronic
1156008356 18:32470118-32470140 CCTCCTTGTCTGCTGCTGGGGGG + Intronic
1157505038 18:48220062-48220084 ACCCATTCTCTGCTGCTGAGGGG + Intronic
1157871382 18:51232958-51232980 CCTGATTCCCTGCTCCTGAGAGG - Intergenic
1159897179 18:74008451-74008473 ACTCCTTCAGTGGTGTTGAGGGG - Intergenic
1160147704 18:76378552-76378574 ACGGCTTCCTTCCTGCTGAGAGG - Intronic
1160816868 19:1040139-1040161 GCTCCCTGCCTGCTGCTGGGCGG + Exonic
1162023270 19:7878733-7878755 ACCCCTTCCCTGCTCTAGAGTGG + Intergenic
1163559211 19:18009104-18009126 ACGCCAGCCCTGCTGGTGAGTGG + Exonic
1164896339 19:31880615-31880637 ACTGCTTCCCTGCCTCTGGGAGG - Intergenic
1165358129 19:35316605-35316627 CTTCCCTCCCGGCTGCTGAGAGG - Intergenic
1168233573 19:55048075-55048097 TGTCCTTCCCTGCTGCTGTTGGG - Intronic
925353502 2:3219928-3219950 ACTCCTCACCTCCTGCTGTGCGG - Intronic
926075522 2:9939754-9939776 ACTCCTGGCCTCCTGCTGCGAGG - Intergenic
926824461 2:16890193-16890215 ACTGCTCCCCTCCTGCTGTGAGG - Intergenic
927155297 2:20217806-20217828 CCTTCATTCCTGCTGCTGAGCGG + Intronic
927218010 2:20680680-20680702 ACTCCTTCCCTGGTCCTGTCAGG + Intergenic
929799698 2:45089013-45089035 TTTCCTTCCCTGCTGCTCTGGGG - Intergenic
931954081 2:67397958-67397980 ACTCCACCACTGCTGCTGACTGG - Intronic
931959162 2:67462674-67462696 ATTCTTTTCCTGCTTCTGAGAGG - Intergenic
932023414 2:68111408-68111430 ACACCTACCCTGCTGGTGATGGG + Intergenic
932276053 2:70453209-70453231 TCTCCTTACCTGTTTCTGAGTGG + Exonic
933698756 2:85239289-85239311 CCTGCTTCTCTGCTGCTGTGAGG + Intronic
935216990 2:100982399-100982421 CCTCTGTCCCTGCTGCTGTGTGG + Intronic
935303586 2:101715801-101715823 ACTGCTTACCTCCTGCTGTGGGG - Intronic
936885917 2:117309888-117309910 CCTCCTTCCCTGCTGGAGACTGG + Intergenic
937481211 2:122261481-122261503 ACTCCATCTCTGCTGCTGACTGG + Intergenic
938795623 2:134716647-134716669 ACCTCTTTCCTGCTGGTGAGAGG - Intronic
940880858 2:158945397-158945419 ACAGCATTCCTGCTGCTGAGTGG + Intergenic
941201448 2:162516347-162516369 AATGGGTCCCTGCTGCTGAGTGG + Intronic
942118122 2:172749065-172749087 CCTCCTTCCCTGCTGCTTTTAGG + Intronic
943676730 2:190722927-190722949 ACTCTTTCCCTCCTGCTGCCTGG + Intergenic
943943602 2:194029788-194029810 ACCCCTTCCCTGGGGGTGAGGGG + Intergenic
944066477 2:195624541-195624563 ACCCCCTCCCTCCTTCTGAGTGG - Intronic
944114503 2:196171887-196171909 ACTCCTTCCCACCTTCAGAGAGG + Intronic
944206703 2:197164590-197164612 CCCCCTCCCCTGCTGCTGCGGGG + Intronic
944398105 2:199292726-199292748 ACTGCTTTCCAGATGCTGAGTGG - Intronic
945995327 2:216431626-216431648 ACTCCCTTCTTACTGCTGAGGGG + Intronic
946148933 2:217751194-217751216 AGTCCTTCCCTGAAGCCGAGAGG + Intronic
946296167 2:218785333-218785355 ACTGCTTACCTCCTGCTGGGAGG + Intronic
946334878 2:219029900-219029922 GCTCCTTCCCTGCTCCTAGGAGG - Intronic
946342175 2:219077251-219077273 ACTCTTTCTCAGGTGCTGAGAGG + Exonic
947472874 2:230414425-230414447 TCTCCTTCCCTGCTGCCAGGAGG + Intergenic
947873491 2:233452982-233453004 ACTCCTCCCCTGGGGCTGCGTGG + Intronic
948471905 2:238187728-238187750 ACTCCTTACCAGCAACTGAGCGG - Intronic
948673837 2:239585346-239585368 ATTCCTTGCCTGCTTCTGTGGGG - Exonic
1168852511 20:986260-986282 AGTCCCTCCCTGCTGCTCACTGG + Intronic
1169073190 20:2746240-2746262 ACACCTTCAGTGCTCCTGAGAGG - Intronic
1170044717 20:12072885-12072907 TCTCCTTCCCTGCTCCCCAGTGG + Intergenic
1170138840 20:13104930-13104952 AGTCCTTCCCTACTTCTCAGAGG + Intronic
1172506587 20:35467252-35467274 ACTCCTTCCCTGGTTCCTAGTGG + Intronic
1174780156 20:53382248-53382270 ATTCCTTCCCTGCTGGTGCTGGG + Intronic
1175539730 20:59740983-59741005 ACCCCTTCCCTGGGTCTGAGGGG + Intronic
1175975859 20:62710101-62710123 TCTTCTTCCCTCCTGTTGAGGGG + Intronic
1175999322 20:62825031-62825053 GCTCCTCCCCAGCTGCTGTGCGG - Intronic
1176107035 20:63394277-63394299 ACTTCCTCCCTGCTGCTGGCCGG - Intergenic
1176546573 21:8204869-8204891 CCTCCCTCCCTGCTTCCGAGAGG + Intergenic
1176554467 21:8249060-8249082 CCTCCCTCCCTGCTTCCGAGAGG + Intergenic
1176565524 21:8387916-8387938 CCTCCCTCCCTGCTTCCGAGAGG + Intergenic
1176573389 21:8432084-8432106 CCTCCCTCCCTGCTTCCGAGAGG + Intergenic
1177926923 21:27228495-27228517 ACTGCCTCCCTGTTGCTGAATGG + Intergenic
1179483689 21:41694907-41694929 TCTCCATCCTTGCTGCTCAGAGG + Intergenic
1179939132 21:44627006-44627028 TCCCCTTCCTTGTTGCTGAGAGG - Intronic
1180207900 21:46273558-46273580 ACTCTTTCACAGCTGCTGCGTGG + Exonic
1181021651 22:20106705-20106727 ACTCCTTCTCTGCTGCCTGGTGG + Intronic
1181626082 22:24123143-24123165 CCTCCATCCCTGCTACTGGGTGG - Intronic
1181922019 22:26328017-26328039 ACCCCTTCCTTGCTATTGAGTGG + Intronic
1182115949 22:27756452-27756474 TCTCCTTCCCTGGGGCTCAGTGG - Intronic
1183178152 22:36239247-36239269 GCTCCCTCCCTCCTGCTGGGCGG - Intronic
1184216420 22:43070415-43070437 ACCCCTTCCCTGCTTCTCTGGGG - Intronic
1184647279 22:45903225-45903247 ACTCGGTTCCTGCTGCTGAGGGG + Intergenic
1184653062 22:45928025-45928047 TCTCCTCCCCTGCTGCCTAGAGG + Intronic
1203251438 22_KI270733v1_random:121135-121157 CCTCCCTCCCTGCTTCCGAGAGG + Intergenic
1203259488 22_KI270733v1_random:166217-166239 CCTCCCTCCCTGCTTCCGAGAGG + Intergenic
949548045 3:5089488-5089510 ACTCCTTTCCTGCGGCTGGGAGG + Intergenic
950171087 3:10839526-10839548 ACTCCTTCCCTGCTTCTCCAAGG + Intronic
950430665 3:12949180-12949202 TCTCCTGCCCAGCTGCTCAGGGG + Intronic
950431684 3:12954507-12954529 TTTCCTTCCCTCCTGCTGAGGGG - Intronic
952944858 3:38472533-38472555 ACTCCTTCTCACCTGGTGAGTGG + Intronic
953432674 3:42852615-42852637 ACTCCTGCCCTGCTGAGGAATGG + Intronic
960705020 3:120473465-120473487 TCCCCTGCCCTACTGCTGAGGGG - Intergenic
960764638 3:121112073-121112095 ACTTTTTCCCTGCTGGTGCGAGG - Intronic
961538326 3:127583620-127583642 GCTCCTTCCCTACTGTTGGGAGG + Intronic
961672840 3:128547495-128547517 TCTCCTTCCCTGTTGCTGCAGGG - Intergenic
961787014 3:129353422-129353444 TTTCCTTCCCTTCTGCTGGGAGG + Intergenic
962704153 3:138027186-138027208 CCTCCATCTCTGCAGCTGAGAGG + Intronic
966846551 3:184135150-184135172 ACTCCTACCCTGCGCCTCAGGGG + Intronic
966878036 3:184334814-184334836 ACCCTTGCCCTGCTGCTCAGCGG - Exonic
967976147 3:195035736-195035758 CCCCCATCCCTGCTGCTGAAGGG - Intergenic
968252910 3:197238119-197238141 ACTGCTTCCTTACTGCTTAGTGG - Intronic
968922729 4:3531018-3531040 ACCTGTTCCCTGCTGCTGGGAGG + Intronic
968981345 4:3851411-3851433 AATGCTTCCCAGCTGCTGGGAGG + Intergenic
974098722 4:57393903-57393925 AGTCCTTCCCTGCTGCTGCTGGG + Intergenic
974761001 4:66273292-66273314 ATTCTTTACCTGCAGCTGAGAGG - Intergenic
975582613 4:75920533-75920555 ACACCCGCCCAGCTGCTGAGAGG + Intronic
976481052 4:85545595-85545617 ACTGCTTCCAAGCTGCTGAAGGG + Intronic
978292064 4:107153136-107153158 ACTCCTGGACTTCTGCTGAGCGG - Intronic
981027617 4:140092727-140092749 CCTCATTCCCTGCTGCTCTGTGG + Intronic
981241475 4:142481413-142481435 ACTCTATCCATGCTTCTGAGAGG + Intronic
982703788 4:158685796-158685818 TCCCCTTCCCTTCTGCTGAAAGG - Intronic
985509652 5:305614-305636 CATCCTTCCCTGCTGGTGTGTGG + Intronic
985521451 5:375754-375776 ACCCCTCCCCAGCTTCTGAGAGG - Intronic
985599809 5:821429-821451 ACTGCTTCTTTGCTGCTGAAGGG + Intronic
987224075 5:15821470-15821492 ATTCCACCCCTGCTGCTGAATGG + Intronic
990237348 5:53782374-53782396 ACTCCTTGGCTGCTGGTGACTGG - Intergenic
992907108 5:81357423-81357445 AGTCTTTCCTTGCTGCTGAGAGG + Intronic
995226805 5:109709757-109709779 CCTCCTTCCCCACTCCTGAGCGG + Intronic
995273494 5:110250535-110250557 ATCCTTTCTCTGCTGCTGAGTGG - Intergenic
995531106 5:113092737-113092759 ACTCCTTTGCTGCTGTTGGGCGG + Intronic
996088348 5:119326528-119326550 AATGCTTCCCTGCTGCTCAGGGG - Intronic
996827115 5:127697071-127697093 ACTCTTTTCCTGCTGCTCGGTGG + Intergenic
997203140 5:132024838-132024860 GCTGTTTCCCTGCAGCTGAGTGG - Intergenic
998038422 5:138935732-138935754 TCTCCTTTCCTGGGGCTGAGAGG + Intergenic
998150047 5:139751700-139751722 TCTCCTTCCCTGATGATGGGCGG - Intergenic
998391574 5:141790211-141790233 CCTCCTGCCCTGATGATGAGGGG - Intergenic
998483852 5:142485089-142485111 ATTCCTTCCCCTCTGCTGATAGG + Intergenic
999367143 5:151030462-151030484 ACTCCTTCCCTGCTGCTGAGTGG - Exonic
999432521 5:151536511-151536533 ATTCCTGCCCTGCTGCTGCAGGG - Intronic
1000019923 5:157310086-157310108 ACTCCTGCTGTCCTGCTGAGAGG - Intronic
1001051441 5:168417707-168417729 ACTCCTCTGCAGCTGCTGAGCGG + Intronic
1001880351 5:175238541-175238563 TCTACTTCCCTGCAGTTGAGTGG + Intergenic
1008047284 6:46864189-46864211 TATCCTTCCCTGCTGCTGAGGGG + Intronic
1010027452 6:71236268-71236290 TCTCCTTCCCTGATTCTCAGGGG + Intergenic
1010434519 6:75813946-75813968 ACTCCTTCCCTCCGTTTGAGAGG - Intronic
1013342223 6:109225913-109225935 TCATCTTCCCTGATGCTGAGAGG - Intergenic
1014102816 6:117530487-117530509 ACTCCTCACCTCCTGCTGTGTGG + Intronic
1015556617 6:134468886-134468908 GCTCCTTGCCTGCAGCTGTGAGG - Intergenic
1016588191 6:145713610-145713632 ACTCATACACTGCTGGTGAGTGG + Intronic
1016730287 6:147421119-147421141 ACACCTTCCCTGCTTCTGCCTGG + Intergenic
1016776317 6:147908591-147908613 TCTCTTTCCCTGCTGCAAAGTGG - Intergenic
1016801918 6:148177686-148177708 ACTTCATCCCTTCTGCAGAGTGG - Intergenic
1016805924 6:148212014-148212036 ACTCTTTTCCTGAAGCTGAGAGG - Intergenic
1017886874 6:158606980-158607002 TCTCCTTTCCTGCTCCTGTGAGG + Intronic
1018270345 6:162070835-162070857 ACTGCTTATCTCCTGCTGAGTGG + Intronic
1019151704 6:170010849-170010871 ACCCCATCCCTGGTGCTGGGAGG - Intergenic
1019165234 6:170094119-170094141 AGTCCATGCCTGCTGCAGAGAGG - Intergenic
1019484835 7:1284743-1284765 ACTCCATCGCTGCTCCTCAGGGG + Intergenic
1019732622 7:2636239-2636261 ACTCATTTCCTTCTGATGAGTGG - Intronic
1019748276 7:2712741-2712763 ACGCTGTCCCTGCTGCTGGGTGG - Exonic
1020192563 7:6011277-6011299 TCTTCTACCCTGCTGGTGAGCGG - Intronic
1020940333 7:14525487-14525509 ATTCTTTCCTTGCTGCTTAGTGG - Intronic
1021197472 7:17689118-17689140 ACTCCCTTCCTGATCCTGAGAGG - Intergenic
1021921337 7:25488465-25488487 TCTCCCTCCATGCTGCTCAGAGG + Intergenic
1024007200 7:45233772-45233794 ACTCCTTCACAGCTCCTCAGAGG + Intergenic
1024517791 7:50274568-50274590 ACTCCTGCCTTGCTGCTGAGGGG - Intergenic
1025031529 7:55560990-55561012 CCTGCTTCCATGCTGCTTAGGGG + Intronic
1026127013 7:67587903-67587925 TTTCCTTCCTTCCTGCTGAGAGG + Intergenic
1030661668 7:112225245-112225267 ACTCCTGCCATGCTGATTAGTGG + Intronic
1032541692 7:132708238-132708260 GCTCCTTCCCTGGTGCTGTTAGG + Intronic
1032724414 7:134577374-134577396 ACACCTCCTCTGCTGCTGGGAGG - Intronic
1032766297 7:134997271-134997293 ACTGCTCACCTGCTGCTGTGTGG + Intronic
1033029459 7:137811201-137811223 ACTCCTTACCTACTGCTGTCAGG + Intronic
1033130442 7:138741228-138741250 ACTCCCTCCCTTCTGCAGTGAGG + Intronic
1033292527 7:140099569-140099591 ACTACTTACCTCCTGCTGTGTGG - Intronic
1033742435 7:144285131-144285153 ACTCCTTCCCTGGTTCTCACAGG - Intergenic
1033751467 7:144364483-144364505 ACTCCTTCCCTGGTTCTCACAGG + Exonic
1033958809 7:146886935-146886957 ACGTCTGCCCTGCTGCTCAGTGG + Intronic
1034453232 7:151149128-151149150 ACACCTTCCCCTCTGCTGTGAGG + Exonic
1036432146 8:8701789-8701811 GCAGCTTCCCTGCTGCTCAGCGG - Intergenic
1036803600 8:11811467-11811489 ATTCCCTCACTTCTGCTGAGGGG - Intronic
1037923558 8:22826969-22826991 TCTCTTTCACTGATGCTGAGAGG + Intronic
1038340061 8:26678723-26678745 ACTGCTTACCTCCTGCTGTGTGG + Intergenic
1038666391 8:29541371-29541393 CCTCCTTCCCTGCTGTGGGGCGG - Intergenic
1039298804 8:36187019-36187041 ACACCTTCACAGCTGCTGAGTGG - Intergenic
1040796092 8:51291414-51291436 ACTCCTTTCCAGCTGCTCACCGG - Intergenic
1041536666 8:58933908-58933930 ACTCCAGCCCTGCTGGTAAGAGG + Intronic
1041791470 8:61700338-61700360 CCTCCTGCCCTGCTGCAAAGGGG + Intronic
1042748005 8:72128181-72128203 AATAGTTCCCTGCTGCAGAGAGG - Intergenic
1043119327 8:76302877-76302899 ACTCCTCACCTCCTGCTGTGAGG + Intergenic
1045140906 8:99281250-99281272 ACTCCTCACCTCCTGCTGTGTGG + Intronic
1045305331 8:100952433-100952455 ACGCCTTCCCGCCGGCTGAGAGG - Intronic
1047070896 8:121342366-121342388 ACTACTTCCAGGTTGCTGAGGGG + Intergenic
1047170745 8:122490213-122490235 TCTGTTTCCCAGCTGCTGAGGGG - Intergenic
1048833645 8:138498251-138498273 TCTCCTTGCCTGCTGCTGCTAGG - Intergenic
1049480810 8:142821601-142821623 AGCGCTTCCCTTCTGCTGAGTGG - Intergenic
1049581207 8:143411877-143411899 ACTCCCTCCCTGCTCCTGCGGGG - Intergenic
1049815633 8:144598042-144598064 TCTCCTTCCCTGCTGGCGGGTGG - Intronic
1050712081 9:8476370-8476392 ACTGCTTACCTCCTGCTGTGTGG + Intronic
1050871164 9:10571907-10571929 ACTACTCACCTCCTGCTGAGAGG + Intronic
1050910660 9:11065292-11065314 AATCTTTCTCTGCTGCAGAGAGG - Intergenic
1052819823 9:33129707-33129729 TCTCCTTCCCTGCTGCTCCCAGG - Intronic
1056673855 9:88656227-88656249 ACTCCATCCTTGCTGCTCTGTGG - Intergenic
1057206692 9:93177813-93177835 CCTGCTTCCCTGCTGCTGCTAGG - Intergenic
1059458616 9:114415422-114415444 TCTCCTTCCATTCTTCTGAGTGG + Intronic
1061776848 9:132971343-132971365 ACTCCTTCCATGCTTCTCTGAGG + Intronic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1062209604 9:135356568-135356590 ACTCCTTCCCAGCAGCGGGGTGG + Intergenic
1062482221 9:136757839-136757861 CCTCCTTCCCTGAGCCTGAGGGG + Intronic
1203467840 Un_GL000220v1:104286-104308 CCTCCCTCCCTGCTTCCGAGAGG + Intergenic
1203475661 Un_GL000220v1:148258-148280 CCTCCCTCCCTGCTTCCGAGAGG + Intergenic
1185555213 X:1015882-1015904 ATTGCTTTCCTGCTGCAGAGAGG + Intergenic
1187648254 X:21373867-21373889 TCGCCCTCCCCGCTGCTGAGTGG - Intergenic
1188244093 X:27820471-27820493 ACTCCTTCTCTGCTGACCAGAGG - Intronic
1190889223 X:54554427-54554449 ACTTTTTCACTCCTGCTGAGAGG - Intronic
1195066489 X:101242614-101242636 AATCATTCCCTGCAGCTTAGAGG - Intronic
1197815161 X:130490610-130490632 AATGGTTCCCTGCTACTGAGAGG + Intergenic
1198223243 X:134622224-134622246 AATCCTGCCTTGGTGCTGAGCGG + Intronic
1201343454 Y:12957907-12957929 ACTTCCTCCCTGAGGCTGAGCGG + Intergenic