ID: 999367630

View in Genome Browser
Species Human (GRCh38)
Location 5:151033442-151033464
Sequence CTGGCTCTGGGCTGCTACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 780
Summary {0: 1, 1: 1, 2: 8, 3: 143, 4: 627}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999367630_999367644 23 Left 999367630 5:151033442-151033464 CCTGGGTAGCAGCCCAGAGCCAG 0: 1
1: 1
2: 8
3: 143
4: 627
Right 999367644 5:151033488-151033510 ACGGTGCTGTTTAGTTCAGAAGG 0: 1
1: 0
2: 0
3: 4
4: 63
999367630_999367638 4 Left 999367630 5:151033442-151033464 CCTGGGTAGCAGCCCAGAGCCAG 0: 1
1: 1
2: 8
3: 143
4: 627
Right 999367638 5:151033469-151033491 TGGACACCCACCTGCCACCACGG 0: 1
1: 0
2: 0
3: 18
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999367630 Original CRISPR CTGGCTCTGGGCTGCTACCC AGG (reversed) Intronic
900178762 1:1302330-1302352 CTGGCCCTGGGCGGCCACCCTGG + Intronic
900213349 1:1468086-1468108 CTGCCTCTGGGAAGCTGCCCTGG + Intronic
900362352 1:2295196-2295218 CTGGCGCAGGGCTGCCACACTGG - Intronic
900487683 1:2931183-2931205 CTGGCTTTGGGCTCCTGCACGGG + Intergenic
900968854 1:5978187-5978209 CAGTCTCTGGGCTGCCACCCAGG + Intronic
901679006 1:10902408-10902430 GTGGGGCTGGGCGGCTACCCCGG + Intergenic
902687096 1:18085276-18085298 CTGGCTCTGGGTTTCTCTCCAGG + Intergenic
902749065 1:18494040-18494062 TTGCCTCTGAGCTGCTACTCTGG - Intergenic
902966515 1:20008477-20008499 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
903029392 1:20452025-20452047 ATGGCACTGGGCTGCTTCCAGGG - Intergenic
904407844 1:30305084-30305106 CTGCCTCTGAGCTGCTATTCTGG + Intergenic
904714391 1:32456331-32456353 CTGCCTCTGAGCTGCTATTCTGG + Intergenic
904718351 1:32486465-32486487 CTGCCTCTGAGCTACTACTCTGG - Exonic
905039035 1:34937992-34938014 CTGCCTCTGAGCTGCTACTCTGG + Intergenic
905175191 1:36130921-36130943 CTGGCTCTGGGGGGCTTCCTGGG + Intergenic
906693659 1:47809794-47809816 CTGGCTCTGGGCTGGGAGCAGGG + Intronic
907349210 1:53811948-53811970 CTGTCTCTGGGCTGATACTGGGG - Intronic
907373088 1:54015603-54015625 CTGGCTCTGGGCTGGGCCCTGGG - Intronic
908861978 1:68499420-68499442 CAGGCTCTGGGCTGGTACTGGGG - Intergenic
910479050 1:87638641-87638663 TTGCCTCTGAGCTGCTACTCTGG + Intergenic
910931519 1:92447046-92447068 CTGGGTCTGGGCTGCTAGATGGG - Intergenic
911317935 1:96376983-96377005 CAGGCTCTGGGCTGGTACTGGGG - Intergenic
912181026 1:107219695-107219717 CCAGCTCTGGGCTGGTACCAGGG + Intronic
912451777 1:109771859-109771881 CTGGCTCTGGCCTGAGACCTAGG - Intronic
912508563 1:110173090-110173112 CTGGCTGTGTGCTGATACACAGG + Intronic
912971399 1:114287004-114287026 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
912972614 1:114298137-114298159 CTTGCGCTGGGCTGCTGCCGTGG + Intergenic
913089399 1:115466303-115466325 CTGGCTGTGGGCTGCCACAGGGG - Intergenic
913143192 1:115962256-115962278 CTGGCTCCGGGCTGGTACTGGGG - Intergenic
913151430 1:116047572-116047594 CTGGCTCTGGGCTGGAACTGGGG - Intronic
913972982 1:143430189-143430211 CTGGCTTTGGGCTGGTACTAGGG + Intergenic
914067366 1:144255796-144255818 CTGGCTTTGGGCTGGTACTAGGG + Intergenic
914111787 1:144710558-144710580 CTGGCTTTGGGCTGGTACTAGGG - Intergenic
915347434 1:155204892-155204914 CTCACTCAGGGCTCCTACCCGGG + Exonic
916005799 1:160658897-160658919 CTGCCTCTGACCTGCTACTCTGG - Intergenic
916648148 1:166809279-166809301 TTGCCTCTGAGCTGCTACTCTGG + Intergenic
917494776 1:175530352-175530374 TTGGCTCTGGGCTGCCCCCAGGG + Intronic
918071665 1:181137684-181137706 CTGGCTCTGGGCTCCTTCTGTGG + Intergenic
918381334 1:183958724-183958746 ATTGTTCTGGGCTGCAACCCAGG + Intronic
918584614 1:186171417-186171439 CTGCCTTTGAGCTGATACCCAGG - Exonic
918794311 1:188873304-188873326 CTGCCTCTGGGTTGCTACTCTGG + Intergenic
919084561 1:192906527-192906549 GTGGCTCTGGGTTGTTACACTGG - Intergenic
919277962 1:195445348-195445370 CAGGCTCTGGGCTGGTACTAGGG - Intergenic
919365813 1:196659534-196659556 CTGCCTCTGAGCTGCTACTGTGG - Intronic
919397575 1:197069816-197069838 CAGGCTCTGGGCTGGTACTGGGG - Intergenic
919821104 1:201472552-201472574 CCAGCTCTGGGCTGCTACCATGG - Intergenic
920063416 1:203245804-203245826 CTGCCTCTGAGCTGCTATTCTGG - Intronic
920606755 1:207396389-207396411 CTGCCTCTGAGCTGCTATTCTGG - Intergenic
920648890 1:207822325-207822347 CTGACTCTGGGCTACTCCCTGGG - Intergenic
920800009 1:209177444-209177466 CAGGCTCTGGGCTGGTACCAGGG - Intergenic
921409733 1:214823162-214823184 CCGGCTCTGGGCTGGTACTGGGG + Intergenic
921753834 1:218829213-218829235 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
921762820 1:218936918-218936940 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
922595527 1:226810068-226810090 CTGCCCCTGGGATGCAACCCAGG + Intergenic
922796268 1:228341259-228341281 CAGGCTCTGGGCTGCTGGGCGGG + Intronic
923459518 1:234196322-234196344 CTGCCTCCAAGCTGCTACCCTGG + Intronic
923874759 1:238035104-238035126 CTGGCTCCGGGCTGGTACTGGGG - Intergenic
924373091 1:243375755-243375777 CTAGGTCAGGGCTGCTTCCCTGG - Intronic
924894279 1:248318447-248318469 CAGGCTCTGGGCTGGTACTAGGG - Intergenic
1063746636 10:8891102-8891124 CTGCCCCTGAGCTGCTACTCTGG - Intergenic
1063934087 10:11059049-11059071 ATGGCTCACGGCTGCAACCCTGG - Intronic
1064048575 10:12041943-12041965 CTGGCTCTGCTCTGCCAACCTGG + Intronic
1064540738 10:16402860-16402882 CGGCCTCTGAGCTGCTACTCTGG - Intergenic
1064908077 10:20369815-20369837 CAGGCTCTGGGCTGTTACTGGGG + Intergenic
1065618256 10:27551139-27551161 CTGCCCCTGGGCTGCTGCTCTGG + Intergenic
1065868357 10:29933913-29933935 CTGGTGCTGGGATGCTACCTAGG - Intergenic
1066145460 10:32553716-32553738 CTGGCTCTGGGCTGCTATTGGGG + Intronic
1066677899 10:37907847-37907869 CTGGCACTGGTCCGCTACCTGGG - Intergenic
1067068446 10:43116402-43116424 CTGGCTGTGGGGTCCTGCCCAGG + Intronic
1067232566 10:44422428-44422450 CTGGCTCTGGGAAGACACCCTGG - Intergenic
1067265793 10:44743896-44743918 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
1067294077 10:44964510-44964532 CTGGGGCTGGCCTGCCACCCAGG - Intronic
1068378618 10:56217007-56217029 GTGCCTCTGGGCTGCTATTCTGG + Intergenic
1068480836 10:57586119-57586141 CTGGCTCTGGGCTGGTACTGGGG - Intergenic
1068691502 10:59920403-59920425 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
1068931452 10:62594495-62594517 CTGGCTCTCGGCTGATGCTCTGG + Intronic
1069150454 10:64953539-64953561 CTGGCTCTGGGCTGGTATTGGGG + Intergenic
1069559050 10:69416830-69416852 CAGGCTTTGGGCTGCAAGCCGGG + Exonic
1070184884 10:74051962-74051984 CTGCCTCTGAGCTGCTACTCTGG - Intronic
1070196303 10:74160374-74160396 CTGCTTCTGAGCTGCTACTCTGG + Intronic
1070607834 10:77911725-77911747 CTGACTCAGAGCTGCTGCCCTGG - Intronic
1070832838 10:79430821-79430843 CTTACTCTGGGCTGGTAGCCTGG - Intronic
1071532450 10:86400556-86400578 CTGGCTCTGGGCTCCGCCGCTGG + Intergenic
1072769197 10:98123624-98123646 CAGGCTCTGGGCTGGTACCAGGG + Intergenic
1073127232 10:101158960-101158982 CTGCCTCTGAGCTGCCACTCTGG + Intergenic
1073891792 10:108111055-108111077 CTGCCTCTGAGTTGCTACTCTGG - Intergenic
1073893390 10:108125230-108125252 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
1073900407 10:108214720-108214742 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
1075626393 10:123967092-123967114 CTGTCTCTGGGCTGACAACCTGG + Intergenic
1075777910 10:124999913-124999935 CTGGCTCCGTGCTGCTGCCGGGG + Intronic
1075897846 10:126013503-126013525 GTTGCTCTGGGCTGCAGCCCTGG + Exonic
1076374501 10:129973923-129973945 CGGGCCCTGGGCCCCTACCCAGG + Intergenic
1076666237 10:132094558-132094580 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
1077134816 11:993240-993262 CTGGCACCTGGCTGCCACCCCGG + Intronic
1077164771 11:1130081-1130103 GTGGCTTTGTGCTCCTACCCTGG + Intergenic
1077296572 11:1829246-1829268 CCGGCCCTGGGCTGACACCCAGG + Intronic
1077366361 11:2162879-2162901 CTGGCTCTGCCCTCCTACCTGGG - Intergenic
1078447661 11:11416742-11416764 CTGCCTGTGACCTGCTACCCTGG - Intronic
1078840954 11:15075067-15075089 CCGGGTCTGGGCTGCTCTCCAGG - Exonic
1079177073 11:18152324-18152346 CTGCCCCTGAGCTGCTACTCTGG - Intronic
1079652067 11:22942386-22942408 CTCCCTCTGGGCTGCTTTCCAGG + Intergenic
1080645828 11:34186799-34186821 CTGGCTCTGGGAGGCCAGCCTGG - Intronic
1081018478 11:37912485-37912507 CTGTCTCTGAGTTGCTACTCTGG - Intergenic
1081091064 11:38867025-38867047 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
1081326695 11:41754099-41754121 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
1081593675 11:44444553-44444575 CAGCCTCTTGGCTGCGACCCCGG - Intergenic
1081842716 11:46214944-46214966 CTGCCTCTGAGCTGCTACTCTGG + Intergenic
1082903960 11:58285771-58285793 CAGGCTCTGGGCTGGTACTGTGG - Intergenic
1082916926 11:58447004-58447026 CTGGCTCTGGGCTGCTACTGGGG - Intergenic
1083361972 11:62115439-62115461 CTGCCTCTGAGCTGCTACTCTGG + Intergenic
1083372104 11:62190318-62190340 CTGGCCCTTTGCTGCTACCGGGG + Exonic
1083378068 11:62242341-62242363 CTGGCCCTCTGCTGCTACCAGGG + Exonic
1083384694 11:62298955-62298977 CTGGCCCTTTGCTGCTACCAGGG - Exonic
1083528482 11:63395518-63395540 CAGGCTCTGGGCTGGTACTGGGG + Intronic
1083628068 11:64082146-64082168 CTGGCTCTGGCCTCCCTCCCGGG - Intronic
1083817803 11:65146759-65146781 CTACCTCTGAGCTGCTACTCGGG - Intergenic
1083993310 11:66259535-66259557 CTGGTTCTTGGCTTCTCCCCAGG - Intronic
1084378727 11:68796989-68797011 GCGGCTCTGGGCTGCTGCCAGGG - Intronic
1084785466 11:71439370-71439392 CCGGCCCTGGGCTGGTACCTGGG + Intronic
1084888687 11:72225762-72225784 CTGGCTCTGGGCTTGAGCCCTGG + Intronic
1085277272 11:75308097-75308119 CGGGCTCAGGGCTGGCACCCAGG - Intronic
1085721377 11:78915061-78915083 CGAGCTATGGGGTGCTACCCTGG - Intronic
1086279632 11:85171289-85171311 CTGGCTCTGTGCTGCTCCGTGGG - Intronic
1086937772 11:92763590-92763612 GTGGCTGTGGGCTGCTAGACTGG - Intronic
1087154358 11:94886219-94886241 CTGGCTGTGGGCTGATTCCTTGG - Intergenic
1087289013 11:96299590-96299612 CTGGCTGTGGGCTGCTCCCAGGG - Intronic
1088206476 11:107397857-107397879 CTGGCTATGGGCTGGTACGGGGG - Intronic
1088241380 11:107776663-107776685 CTGACACAGGCCTGCTACCCAGG - Intergenic
1088360507 11:108984216-108984238 CTGTCTCTGAGCCACTACCCTGG + Intergenic
1088673440 11:112167229-112167251 CTGGCTCTGGGAGGCTACGGTGG + Intronic
1088730433 11:112677007-112677029 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
1089614085 11:119685448-119685470 CTGGCCCTGCTCTGCTGCCCCGG + Intronic
1090559460 11:127915137-127915159 CAGCCTCTGGGCTGGTACCGGGG + Intergenic
1091054354 11:132404430-132404452 TTGGCTCTGTTCTGCTTCCCTGG + Intergenic
1091178152 11:133579896-133579918 CTGGCTAAGGGCTGCCTCCCTGG - Intergenic
1091380865 12:57764-57786 CAGGCTCTGGGCTGTTACTGGGG - Intergenic
1092700036 12:11218256-11218278 CAGGCTCCGGGCTGGTACCTGGG - Intergenic
1092927004 12:13280371-13280393 CTGACTTTGGGCTGCCACACTGG + Intergenic
1093380027 12:18480786-18480808 CTGCCTCTGAGCTGCTAGTCTGG + Intronic
1093389662 12:18602714-18602736 CTGGCTTTGGGCTGGTACTGGGG - Intronic
1093995017 12:25631489-25631511 CTGGCTCTGGGCTGATACTGGGG - Intronic
1094027146 12:25970690-25970712 CTGGCTCTGGTCTCACACCCTGG + Intronic
1095892833 12:47250475-47250497 CAGGCTCTAGGCTGCTACTGGGG - Intergenic
1095932136 12:47637512-47637534 CTGGCTCTGGGTTGGTACTGGGG - Intergenic
1095976604 12:47944269-47944291 CTGAGCCTGGGCTGCTTCCCAGG + Intergenic
1096347945 12:50866822-50866844 CAGGCTCTGGGCTGGTACTGGGG - Intronic
1096956908 12:55535195-55535217 CTGGCTCTGGGCTGGTACTGGGG - Intergenic
1097503077 12:60431137-60431159 CTGTCTCTGGGCTGCAATCAAGG + Intergenic
1097760612 12:63459868-63459890 CTGGCTCTGGGCTGGTACTGGGG - Intergenic
1098178620 12:67820942-67820964 CTGGCTCTGTACTCCTACCCGGG + Intergenic
1098898912 12:76092692-76092714 GTGCCTCTGAGCTGCTACTCTGG + Intergenic
1099307134 12:80971444-80971466 CTGCCTCTCAGCTGCTACTCTGG - Intronic
1100088075 12:90936242-90936264 CTGGCTCTGGGCTGGTACTGGGG + Intronic
1100669455 12:96795039-96795061 CGGGCTCTGGGCTGGTACAGAGG + Intronic
1100937113 12:99681529-99681551 TTGGCTCTGGGCTGGTACTGGGG - Intronic
1100951331 12:99853425-99853447 CAGGCTCTGGGCTGGTACTGGGG - Intronic
1100970337 12:100063307-100063329 CAGGCTCTGGGCTGGTACTGGGG - Intronic
1101147075 12:101851257-101851279 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
1101796052 12:107975285-107975307 CTGCCTCTGAGCTGCTGCTCTGG - Intergenic
1102152614 12:110699210-110699232 CTGGGTCTTGGCTGCAGCCCAGG + Intronic
1102449750 12:113032574-113032596 CTGCCTCTGAGCTGCTACTCTGG + Intergenic
1103536569 12:121637662-121637684 CCTGCTCTGGCCTGCCACCCCGG - Intronic
1103702895 12:122856833-122856855 CTGGGTCAGGGCTGCATCCCAGG - Intronic
1103761606 12:123254234-123254256 CTGGTGCTTGGCTGCTGCCCCGG + Intronic
1103922072 12:124404294-124404316 CTGGCCCTGGGCTGTTGCCAGGG - Intronic
1103975037 12:124696933-124696955 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
1104345385 12:127991864-127991886 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
1104424815 12:128667435-128667457 CTGGAGCTGGGCTGCAATCCAGG - Intronic
1104504445 12:129318443-129318465 CTGGCTCCGGGCTGGTACTGGGG + Intronic
1104621127 12:130313601-130313623 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
1104750876 12:131237572-131237594 CAGGCTCTGCCCAGCTACCCAGG - Intergenic
1105571108 13:21603843-21603865 TTGGCTCTGGGCGGCTCTCCCGG - Intronic
1105598799 13:21866749-21866771 CAGGCTCTGGGCTGTTACTGGGG + Intergenic
1106115971 13:26817992-26818014 CTGGCACTGAGCTGCTCACCTGG - Intergenic
1106127363 13:26911368-26911390 TTGGCTCTGTGCTGGGACCCTGG - Intergenic
1106246534 13:27954528-27954550 CTGGGTCTGCGCCGCTGCCCGGG - Intergenic
1106467575 13:30026504-30026526 CTGCCTCTGGGTTTCTCCCCTGG - Intergenic
1107049954 13:36036249-36036271 CTGCCTCTGAGCTGCTCCTCTGG + Intronic
1107822280 13:44296623-44296645 GTAGCTCTGTGCTGCTATCCCGG - Intergenic
1108131957 13:47310931-47310953 CAGGCTCTGGGCTGGTACTGGGG - Intergenic
1108503311 13:51087286-51087308 CTGGGTCTGGGCAGCCACCGTGG + Intergenic
1109058250 13:57580647-57580669 CAGGCTGTGGGCTGCTACTGGGG + Intergenic
1109405336 13:61890597-61890619 CAGGCTCAGGGCTGCTTCCTGGG - Intergenic
1109534600 13:63699945-63699967 CAGGCTCTGGGCTGGTACTGAGG + Intergenic
1110561926 13:76918444-76918466 CTGGCTCTGGGCTGGTACTGGGG - Intergenic
1110603120 13:77399401-77399423 CTGTGTCTGAGCTGCTACTCTGG + Intergenic
1110627627 13:77668903-77668925 CTGGCTCTGGGCTGGTACTGGGG - Intergenic
1111225332 13:85263827-85263849 CTGCCTTTGAGCTGCTACTCTGG + Intergenic
1112040312 13:95540466-95540488 CTGTCTCTGCTCTGCTGCCCAGG - Intronic
1112265509 13:97919949-97919971 CTCCCTCTGGGCTGCTGCCCAGG + Intergenic
1112342615 13:98565264-98565286 CAGGCTCTGCCCTGCTGCCCTGG - Intronic
1112738145 13:102443826-102443848 CCGGCTCTGGGCTGGTACTGGGG - Intergenic
1112945382 13:104920670-104920692 TTGGCTCTGGGCTGGTACTGGGG - Intergenic
1113058944 13:106300351-106300373 CTGGCCCTGGACTGTGACCCCGG - Intergenic
1113413007 13:110106901-110106923 GTGCCTCTGGGCAGCTTCCCAGG - Intergenic
1113891960 13:113740842-113740864 CTGCCTCTGGCCTCCTCCCCTGG + Intergenic
1114030727 14:18577686-18577708 CTGGCTTTGGGCTGGTACTAGGG + Intergenic
1115835425 14:37397274-37397296 CCGGCTCTGGGCTGGTACTGGGG + Intronic
1115930193 14:38482601-38482623 CTGGGACTGAGCTGGTACCCAGG - Intergenic
1116145933 14:41069165-41069187 CTGCCCCTGAGCTGCTACGCTGG - Intergenic
1117723093 14:58646304-58646326 CTGACACTGGGCTGCTGCCCCGG - Exonic
1119098528 14:71856767-71856789 CCGGCTCTGGGCTGGTACTGGGG - Intergenic
1120400272 14:84022596-84022618 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
1120931413 14:89852456-89852478 TTGGATGTGGGCTGCTCCCCAGG - Intronic
1121433887 14:93906259-93906281 CTGGGTCAGGGGTGCTACCTGGG - Intergenic
1121503409 14:94458310-94458332 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
1122002695 14:98674801-98674823 CTGCCTCTGAGCTGCTGCTCTGG - Intergenic
1122228372 14:100292644-100292666 CGGGCGCTGGGCTGCGAGCCGGG - Exonic
1122436459 14:101704451-101704473 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
1122791904 14:104187547-104187569 CTGGCACGGGGCTGTGACCCTGG - Intergenic
1122814885 14:104307471-104307493 CTGGCACTGGGCAGGCACCCTGG - Intergenic
1123935325 15:25191275-25191297 CTGGCTCTGGGCTCAGCCCCTGG + Intergenic
1124575232 15:30902253-30902275 CTGGCTCTCTGCTGCCTCCCTGG + Intergenic
1124667969 15:31609912-31609934 CCGGCTCTGGGCTGGTACTGGGG - Intronic
1125055871 15:35358683-35358705 CTGGCTCTGGGCTGGTATTGGGG + Intronic
1125558203 15:40603794-40603816 CTGCCTCTGAGCTGCTACTCTGG - Intronic
1125591682 15:40858087-40858109 CAGGCTCTGAGCTCCTTCCCAGG + Exonic
1125903752 15:43371373-43371395 TTGGCTCTGAGCGGGTACCCTGG + Exonic
1126460717 15:48912888-48912910 CTGGCTCTGGGCTGGTTCTGGGG + Intronic
1126577562 15:50211322-50211344 CTGGCTCTGGGCTGGTACTGGGG - Intronic
1127194528 15:56569234-56569256 CAGGCTCTGGGCTGGTACTGGGG - Intergenic
1127350036 15:58142084-58142106 TGGGCTCTGGGCTGATTCCCGGG - Intronic
1128560863 15:68666951-68666973 TTGGCTCTGGGCTCCTTCCTGGG + Intronic
1128755521 15:70181069-70181091 CTGGGTGAGGGCTGCTCCCCAGG + Intergenic
1129147964 15:73666417-73666439 CGGCCTCTGAGCTGCTACTCTGG - Intergenic
1129457383 15:75683099-75683121 CCGGCCCTGGGCTGCCACCAGGG + Intronic
1129726408 15:77903846-77903868 CTGGCCCTGGGCTGCCACCAGGG - Intergenic
1129829623 15:78660246-78660268 CTGCCTGTGAGCTGCTACTCTGG + Intronic
1130274443 15:82469194-82469216 CCGGCCCTGGGCTGCCACCAGGG - Intergenic
1130461309 15:84159788-84159810 CTGGCTCAGGGCTGCTTGCTGGG + Intergenic
1130466790 15:84196568-84196590 CCGGCCCTGGGCTGCCACCAGGG - Intergenic
1130497474 15:84476968-84476990 CCGGCCCTGGGCTGCCACCAGGG + Intergenic
1130572788 15:85063434-85063456 CTGGCACTGGGCTGCTACCCAGG - Intronic
1130589085 15:85201161-85201183 CCGGCCCTGGGCTGCCACCAGGG - Intergenic
1131326780 15:91455818-91455840 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
1131419005 15:92287887-92287909 CTGCCTCCTGGCTGCTCCCCTGG + Intergenic
1132354629 15:101162351-101162373 CTGGCTCTGAGCTGCAACTTGGG + Intergenic
1132456540 16:26820-26842 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
1132845560 16:1999464-1999486 CTGGCTCAGGCCTGCTCCCTGGG - Intronic
1133033610 16:3022971-3022993 CTTGCTCTGAGCTGCTTCTCTGG - Exonic
1133165433 16:3943646-3943668 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
1133447873 16:5877695-5877717 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
1133748748 16:8707893-8707915 CTGGTTCTGGGATGATAACCTGG - Intronic
1134749969 16:16618123-16618145 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
1134995507 16:18735492-18735514 CTGCCTCTGAGCTGCTACTCTGG + Intergenic
1135491376 16:22912649-22912671 CTGCCTCCGAGCTGCTACACTGG - Intronic
1135783429 16:25326464-25326486 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
1135877591 16:26217574-26217596 CTCGGTCTGGGCTGGGACCCTGG + Intergenic
1135883170 16:26279224-26279246 CTGGCTCTGGGCTGGTACTGGGG + Intergenic
1135980604 16:27143936-27143958 CAGTCTCTGAGCTGCTACTCTGG - Intergenic
1136139814 16:28281444-28281466 CTGACTCTGGGTTGCTGCCTGGG - Intergenic
1137263794 16:46852312-46852334 CTGACCCTGGCCTGCTTCCCTGG + Intergenic
1137396079 16:48116937-48116959 CTGGCTCTGTCCTGCAAACCAGG - Intronic
1137888548 16:52132937-52132959 CTTGCTCTGGGCTGTTATACAGG - Intergenic
1138669125 16:58598689-58598711 CTGGCTTTGGGCTGGTGCTCAGG - Intronic
1138797906 16:59992819-59992841 CTGGCTCTGGGCTGGTACTGGGG + Intergenic
1138850810 16:60627399-60627421 CTGCCTCTGAGCTGCTACTGTGG - Intergenic
1140339809 16:74146543-74146565 CTGCCCCTGAGCTGCTACTCTGG + Intergenic
1140636249 16:76918041-76918063 CTGCCTCTGAGCTGCCACCCTGG - Intergenic
1140845952 16:78888349-78888371 CTGCCTCTGGGCAGGTACCTGGG - Intronic
1141442277 16:84037127-84037149 CTGGCTCTAGGCTGTGAACCTGG + Intronic
1141626811 16:85265825-85265847 CTGGCCCTGGGCTGCTCATCAGG - Intergenic
1142135120 16:88448429-88448451 CTGGCTCTGGGATGCTGCCTGGG - Intergenic
1142801895 17:2351518-2351540 CTGGCCCTGGCCTGGTTCCCTGG + Intronic
1143108041 17:4539177-4539199 CCGGTTCTGGGCTGGGACCCTGG - Intronic
1143369309 17:6428534-6428556 CTAGCTCTGGGCAGGTAGCCTGG - Intronic
1143437825 17:6942308-6942330 CTGCCTCTGAGCTGCTACTCTGG + Intronic
1143456921 17:7074069-7074091 CTGGCTCTGGGCTGGGACAATGG - Intergenic
1143621962 17:8085950-8085972 CTAGCTCCAGCCTGCTACCCTGG - Intronic
1144739919 17:17576116-17576138 GTGCTTCTGGGCTGCTTCCCGGG - Intronic
1145122915 17:20276962-20276984 CTGACTTCGGGCTGCTCCCCTGG - Intronic
1145979659 17:29004261-29004283 CTGGCGCTGGACAGCTCCCCTGG - Intronic
1146480534 17:33201633-33201655 CTGCCTCTGAGCTTCTACTCTGG + Intronic
1146840890 17:36153397-36153419 CTGGCTCTGGGTTCCAACCCTGG + Intergenic
1147215022 17:38893948-38893970 CTGTCTCTGGGAAGCTGCCCAGG + Intronic
1147431633 17:40374976-40374998 CTGCCTCTGAGCTGCTTCTCTGG - Intergenic
1147459263 17:40557978-40558000 CAGGCTATGGGCTGCAGCCCAGG + Intronic
1147463131 17:40588738-40588760 CTGGCTCTGGGCTGGTACTGGGG + Intergenic
1147874083 17:43608396-43608418 CTGCCTCTGAGCTGCCACTCTGG - Intergenic
1148014450 17:44511274-44511296 CTGGCTCTGCTCTGTCACCCAGG - Intergenic
1148103062 17:45104491-45104513 CTGGCTCTGGTCAGCTACATGGG - Intronic
1148462083 17:47844689-47844711 CTTCCTCTGGGTTGGTACCCGGG - Intergenic
1148561093 17:48606615-48606637 CTGGATCTGGGCTGCAGCCCAGG - Intergenic
1148583705 17:48761753-48761775 CAGGCTCTGGGCTCCTAGCAAGG + Intergenic
1148666919 17:49381925-49381947 CAGACTCTGGGCTGAGACCCAGG - Intronic
1148668671 17:49393810-49393832 CTGCCTCTGAGCTGCTACTCTGG + Intronic
1148835578 17:50464064-50464086 CTGGCCCTGGGCTGGTGTCCAGG - Intronic
1148904813 17:50905322-50905344 CTGGCTCTGGTCTGAGACTCAGG - Intergenic
1149858639 17:60107571-60107593 CTGACTCTGGGTTCCAACCCTGG - Intergenic
1149895777 17:60427191-60427213 CTGCCCCTGTGCTGCTACTCTGG - Intronic
1149969339 17:61200913-61200935 CTGACTCAGGGCTGCTAACTTGG - Intronic
1150013087 17:61524652-61524674 CTGCCTCTGAGCTGCTACTCTGG + Intergenic
1150217796 17:63479971-63479993 CTGACTCTGGGCTGGGACTCTGG - Intergenic
1150338912 17:64349961-64349983 TTCGCTCTGGGCTGCTGCCATGG - Intronic
1150539017 17:66076894-66076916 CTGGCTCCGGGCTGGTACTGGGG - Intronic
1150641716 17:66953894-66953916 CTGGCTCTGTGATGCTCCCAGGG + Intergenic
1151048475 17:70948615-70948637 CTGGCTATGGGCTGGTACCAGGG - Intergenic
1151390215 17:73781892-73781914 CTGGCTCAGTCCTGGTACCCAGG + Intergenic
1151423634 17:74015466-74015488 CTGACTGTGGGCTGCGACCTCGG + Intergenic
1152041511 17:77906682-77906704 CTGCCTGTGGCCTGCTCCCCAGG + Intergenic
1152121261 17:78420099-78420121 GTGGCTCTGGCTTGCTGCCCTGG + Intronic
1152717139 17:81905577-81905599 CTGGCTGTGGGCTCCTAGGCGGG - Intronic
1152872824 17:82767116-82767138 CCGGCCCTGGGCTGGTATCCAGG - Intronic
1152934647 17:83128922-83128944 CTGCCTCTGGGCAGCACCCCTGG - Intergenic
1153168914 18:2293118-2293140 CTGGCTCTGCACTGGTACCGGGG + Intergenic
1154086344 18:11309162-11309184 GCTGCTCTGGGCTGCTACCCTGG - Intergenic
1155225186 18:23723638-23723660 CTGGCTCTGGGTTTTTACCTAGG + Intronic
1155508238 18:26550977-26550999 CTGGCTCCGGGCTGCGCTCCTGG + Intronic
1155630131 18:27883375-27883397 CTGCCTCTGAGCTGCTGCTCTGG - Intergenic
1156180745 18:34601195-34601217 CTGCCTCTCAGCTGCTACTCTGG - Intronic
1156198390 18:34802241-34802263 CTGGCTGTCAGCTGCAACCCAGG - Intronic
1156538637 18:37888165-37888187 CTGGCTCTGGACTGCTTAGCAGG + Intergenic
1156645951 18:39162503-39162525 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
1157293443 18:46425651-46425673 CTGGCTCTTTGCTCCTGCCCAGG + Intronic
1157682726 18:49619563-49619585 CTGGCACTGGCCTGCTTCACAGG - Intergenic
1157703225 18:49778840-49778862 CAGGCTCTGGGCTGGTACCGGGG + Intergenic
1158097710 18:53793173-53793195 CAGGCTCTGGGCTGGTACTGGGG - Intergenic
1158646595 18:59254119-59254141 CTAGCTCTGGACTACTACCCAGG - Intergenic
1158829825 18:61264505-61264527 CTGGTTCTGGGCTGGTACTGGGG - Intergenic
1159190396 18:65034484-65034506 CTGTCTGTGGGCTTCTACCAGGG - Intergenic
1159262939 18:66039410-66039432 CTATCTCTGGGCTGCTACTCTGG + Intergenic
1160219690 18:76965685-76965707 CTGGCTCCGGGCTGGTACTAGGG + Intronic
1160424884 18:78772957-78772979 CTGGCTCTGGGCGGCTGCCCAGG - Intergenic
1160729476 19:634424-634446 CCGCCTCTGGCCTGCTGCCCCGG - Intergenic
1160907868 19:1460255-1460277 CTGGCGCTGCGCCGCTACGCGGG + Exonic
1161250179 19:3276082-3276104 CTGGCTCTGGGGTGGGACCCTGG + Intronic
1161680127 19:5675992-5676014 CATGCTCTGGGCTGGTACCATGG + Intronic
1161741576 19:6024167-6024189 CTCGCCCAGGGCTGATACCCTGG + Intronic
1161859980 19:6790719-6790741 CTGCCTCTGAGCTGCTACTCTGG - Intronic
1162024409 19:7885567-7885589 CAGGTTCTGAGCTGCCACCCAGG + Intergenic
1162418887 19:10554425-10554447 CTGGCTTTGGCCTGAAACCCAGG - Intronic
1162794522 19:13079615-13079637 CTGCCTCTGGGCTCCCAGCCAGG - Intronic
1162947433 19:14052300-14052322 CTGGCTGGGGGCTGCCAGCCAGG + Exonic
1162997477 19:14345492-14345514 CTGGCTCAGGGCTACTCCCAGGG - Intergenic
1163349748 19:16768917-16768939 CTGGCCCTGGGCTGATGGCCAGG - Intronic
1163361604 19:16850485-16850507 CTGGCTCTGGGCTGCTGTTAGGG - Intronic
1163413735 19:17172881-17172903 CGTGCTCCGGGCTGCTATCCGGG + Exonic
1163862462 19:19749423-19749445 CTGAATTAGGGCTGCTACCCAGG + Intergenic
1164561003 19:29292212-29292234 CTGCCTCTGAACTGCTACTCTGG - Intergenic
1164779844 19:30883499-30883521 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
1164958460 19:32406167-32406189 CAGGGCCTGGGCTGCGACCCCGG + Exonic
1165200758 19:34142464-34142486 CTGCCTCTGAGCTGCTCCTCTGG - Intergenic
1165786448 19:38464646-38464668 CTGGCTCTGGGCTGCCACGTGGG + Exonic
1166282322 19:41802454-41802476 CTGTCCCTGGGCTTCTGCCCAGG - Intronic
1166315700 19:41988288-41988310 CAGGCTGTGGGCTGGGACCCTGG - Intronic
1166372662 19:42310679-42310701 ACTGCTCTGGGCTACTACCCAGG - Exonic
1166744360 19:45133559-45133581 CTGGCTCTGAGCTCCAGCCCAGG + Intronic
1167082930 19:47289669-47289691 CTGCCTCTGGGCTGCTCTTCTGG - Intergenic
1167103348 19:47417281-47417303 CTGTCTCTGGGAAGCTAGCCAGG + Exonic
1167465074 19:49646302-49646324 CTGGCTCTGCGATGCTGACCAGG + Intronic
1167819176 19:51910388-51910410 CTGCCTCTGAGCTGCTACTCTGG + Intronic
1168474345 19:56665087-56665109 CTGGCTCTGGACAGCTTTCCTGG + Exonic
925609451 2:5691812-5691834 CGGGCTCGGGGCGGCGACCCGGG + Intergenic
926106566 2:10155805-10155827 CTGACTCAGCGCTGCTTCCCAGG - Intronic
926313321 2:11691214-11691236 CTGGCTCTGGACTGTGCCCCCGG - Intronic
926445417 2:12935894-12935916 CTGGCTCTGGACTCCCACCCTGG - Intergenic
927363435 2:22264421-22264443 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
928685366 2:33744246-33744268 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
928783007 2:34848141-34848163 CGAGCTCTGGGCTGCTACTAGGG + Intergenic
928856019 2:35803474-35803496 CTGGCTGTGGGCTGGTACTGGGG - Intergenic
929010214 2:37434697-37434719 CAGGCTCTAGGCTGGTACCGGGG + Intergenic
929806079 2:45145881-45145903 CAGGCTCTGGGCTGGTACTGGGG - Intergenic
930940040 2:57001077-57001099 CTGGCTCTGTGTTTCTATCCAGG + Intergenic
931072620 2:58670024-58670046 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
931547943 2:63409239-63409261 CTGGCTCTGGTCTGGTACTGGGG - Intronic
931602513 2:64018947-64018969 CTCGCTCAGGGCGGCTGCCCCGG - Exonic
931972126 2:67600438-67600460 CTGCCTTTGAGCTGCTACTCTGG - Intergenic
932270436 2:70404134-70404156 CAGGCTCTGGGCTGGTACTGGGG - Intergenic
932770973 2:74500633-74500655 CTGGTTCTGGGCTCATACCTGGG + Intronic
932784675 2:74589720-74589742 CCAGCTCTGGTCAGCTACCCAGG + Intronic
932811610 2:74831069-74831091 CTGCCTCTGAGCTGCTACTCTGG + Intergenic
933110811 2:78397634-78397656 CGGGCTCTGGGCTGGTACTGGGG - Intergenic
933603736 2:84360074-84360096 CTGGCTCTGTGTTGCTCCCAGGG - Intergenic
933941889 2:87251950-87251972 CTGTCCCTGAGCTGCTACTCTGG - Intergenic
934177679 2:89591145-89591167 CTGGCTTTGGGCTGGTACTAGGG + Intergenic
934187076 2:89756641-89756663 CTGGCTTTGGGCTGGTACTAGGG + Intergenic
934287978 2:91665446-91665468 CTGGCTTTGGGCTGGTACTAGGG + Intergenic
934309559 2:91851284-91851306 CTGGCTTTGGGCTGGTACTAGGG - Intergenic
934890437 2:98063659-98063681 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
935384388 2:102485734-102485756 CTGGGGCTGGCCTGCTGCCCAGG + Intronic
935876616 2:107514672-107514694 CTGCCTCTGAGCTGCTACTTTGG + Intergenic
936092857 2:109512172-109512194 CTGGCTCTGGCCTGGGACCCTGG + Intergenic
936164514 2:110107879-110107901 CTGGCTCTGGGCTGGTACTCTGG - Intronic
936338333 2:111609619-111609641 CTGCCCCTGAGCTGCTACTCTGG + Intergenic
937153544 2:119702387-119702409 CTGGCTGCTGGCTGCTGCCCAGG + Intergenic
937347612 2:121136258-121136280 CTGCCTCTGAGCTGCTGCTCTGG - Intergenic
937828885 2:126399002-126399024 CAGGCTCTGGGCTGGTACTGAGG + Intergenic
938379066 2:130826473-130826495 CTGGCCCTGGGCTTCTCCCAGGG - Intergenic
938961865 2:136351467-136351489 CTGGGTCAGGGATTCTACCCAGG + Intergenic
939240200 2:139548290-139548312 CAGGCTCTGGGCTGGTACTAGGG + Intergenic
939570963 2:143839270-143839292 CTGGCTCTGGGCTCTGACCAGGG - Intergenic
940122869 2:150287071-150287093 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
940217594 2:151316196-151316218 CAGGCTCTGGGCTGGTACTGGGG - Intergenic
940704565 2:157087730-157087752 CTGGCACAGGGCTCCTACTCAGG + Intergenic
940709327 2:157143624-157143646 CTGGCTCTGAGCTGGTACTAGGG + Intergenic
941060687 2:160843277-160843299 CAGGCTCTGGGCTGCTGCTAGGG - Intergenic
941138418 2:161746271-161746293 CTGGGGCTGAGCTGGTACCCAGG + Intronic
942065126 2:172263604-172263626 ATGGGTCTGGGATGCTACCTTGG + Intergenic
943261175 2:185665595-185665617 CTGCCTCTGTGCTGCTACTCTGG + Intergenic
943449300 2:188028300-188028322 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
945321198 2:208425523-208425545 CTGCCTTTGAGCTGCTACTCTGG + Intronic
945369514 2:208999686-208999708 CTGCCTCTGAACTGCTACTCTGG + Intergenic
945819859 2:214650792-214650814 CAGGCTCTGGGATTCCACCCTGG - Intergenic
946036523 2:216746641-216746663 CTGACTCTGGGCTGGTACTGGGG - Intergenic
946332262 2:219017138-219017160 CTGGCTCTGGGCTGGTCTTCAGG - Intronic
946354439 2:219176389-219176411 CTGGCTCTGGGCTGGAAGGCGGG + Intronic
946365338 2:219245552-219245574 CGGGCTCTGGGCTCCTAGACCGG + Intronic
946805877 2:223470954-223470976 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
946806661 2:223477291-223477313 CTGCCTCTGAGCTGCTATTCTGG - Intergenic
947235978 2:227941258-227941280 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
947565598 2:231190951-231190973 CTGCGTCTGGGCCGCTTCCCGGG + Intergenic
948338132 2:237227208-237227230 CTGGGTCTGGGTTGCTTGCCTGG - Intergenic
948596050 2:239080403-239080425 TGGGCTGTGGGCTGCTGCCCTGG + Intronic
948605025 2:239129490-239129512 CCTGCTCTGGGCTCCTCCCCTGG + Intronic
948850408 2:240702793-240702815 CAGGCTCAGGACTGCCACCCAGG + Intergenic
1169093236 20:2873834-2873856 CGGGCTCTGGGCTGTGGCCCGGG - Intronic
1169270982 20:4199248-4199270 CTGCCTCTGAGCTGCTCCTCTGG - Intergenic
1169369955 20:5021049-5021071 CAGGCTCTGGGCAGCTACTGTGG - Intergenic
1169925942 20:10783941-10783963 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
1169980401 20:11378290-11378312 CTGCCTCTGAGCTGCTGCTCTGG - Intergenic
1170461568 20:16581595-16581617 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
1170940423 20:20844135-20844157 CTTGAACTGGGCTGCTCCCCTGG + Intergenic
1171291291 20:23984451-23984473 CTCCCTCTGGGCTGCGTCCCCGG + Intergenic
1172803850 20:37597471-37597493 CTGGCTCTAAGCTGCTACTCTGG + Intergenic
1172937064 20:38628045-38628067 CTGCCCCTGGGCTGCTGTCCTGG - Intronic
1172969736 20:38864764-38864786 CTGGCTCTCTGCTGGTACCTAGG - Intronic
1173457721 20:43216745-43216767 CTGGCTGAGGGCTGCTCCCAGGG + Intergenic
1173580795 20:44145166-44145188 CTGGCTCTGAGCTGAGCCCCAGG - Intronic
1173781153 20:45758520-45758542 CTGGCTGTGGGCTGCCAGGCAGG - Intronic
1173833960 20:46113047-46113069 ATGGAGATGGGCTGCTACCCAGG + Intergenic
1173900026 20:46581005-46581027 CTGCCTCTGAGCTACTACTCTGG + Intronic
1174407542 20:50311952-50311974 CTGGCTCTGCTCTGTGACCCTGG + Intergenic
1175231366 20:57475494-57475516 CTGGCCCTGGAATGCTGCCCCGG - Intergenic
1175819678 20:61902063-61902085 CTGGCTCCAGGCTGCTCCTCAGG - Intronic
1175889115 20:62308311-62308333 GTGGCTCTGGGGTGCAGCCCGGG + Intronic
1176067831 20:63208336-63208358 CTGGGTCAGAGCTGCTTCCCAGG - Intronic
1176295281 21:5068819-5068841 CGGCCTCTGGGCTGCTTACCAGG - Intergenic
1177140584 21:17353458-17353480 CAGGCTCTGGGCTGGTACTGGGG - Intergenic
1177447499 21:21216836-21216858 GTGGCTCTGGCCTATTACCCAGG - Intronic
1177995293 21:28089602-28089624 CTGGCTCTGGGCTGGTACTGGGG + Intergenic
1178240418 21:30893513-30893535 CTGCTTCTGAGCTGCTACCCTGG + Intergenic
1178974638 21:37210285-37210307 CTGCCTCTGAGCTGTTACTCTGG - Intergenic
1179413544 21:41180066-41180088 CTGCCTCTGAGCTGCTACTGTGG - Intronic
1179414426 21:41186779-41186801 CTGCCTCTGAGCTGCTACTCAGG - Intronic
1179579442 21:42331537-42331559 CTGGCCCTGCCCTGCTGCCCTGG - Intergenic
1179861768 21:44193309-44193331 CGGCCTCTGGGCTGCTTACCAGG + Intergenic
1180454841 22:15504742-15504764 CTGGCTTTGGGCTGGTACTAGGG + Intergenic
1180536653 22:16398421-16398443 CTGGCTTTGGGCTGGTACTAGGG - Intergenic
1180766112 22:18346643-18346665 CTCCCTCTGGGCTGCGTCCCCGG - Intergenic
1180780201 22:18515735-18515757 CTCCCTCTGGGCTGCGTCCCCGG + Intergenic
1180812917 22:18773056-18773078 CTCCCTCTGGGCTGCGTCCCCGG + Intergenic
1180937928 22:19638151-19638173 AGGGCTCTTGGCTGCTTCCCAGG - Intergenic
1181199095 22:21207372-21207394 CTCCCTCTGGGCTGCGTCCCCGG + Intergenic
1181371100 22:22417473-22417495 CCGGCTCTGGGCTGGTACTGGGG - Intergenic
1181400668 22:22648484-22648506 CTCCCTCTGGGCTGCGTCCCCGG - Intergenic
1181648722 22:24247404-24247426 CTCCCTCTGGGCTGCATCCCCGG + Intergenic
1181702649 22:24629582-24629604 CTCCCTCTGGGCTGCGTCCCCGG - Intergenic
1181753666 22:25007804-25007826 TTGCCTCTGAGCTGCTACTCTGG + Intronic
1181754915 22:25016951-25016973 GTGCCTCTGAGCTGCTACTCTGG - Intronic
1182029603 22:27147520-27147542 CTGCCTCTGAGCTGCTACTCTGG + Intergenic
1182111089 22:27724230-27724252 CTGTCTCTGAGCTGCTACTCTGG - Intergenic
1182475280 22:30573735-30573757 CTGGCTCTGGGCAGCTGGGCGGG + Intronic
1182490377 22:30667823-30667845 CTGTCTCTCGGCTGCAGCCCTGG - Exonic
1183045278 22:35214492-35214514 CTGTCACAGGCCTGCTACCCAGG + Intergenic
1183451633 22:37899084-37899106 TTGGCTCTGAGCTGCTCCCTGGG - Intergenic
1184632470 22:45793948-45793970 CTGTCTCTGAGCTGCTATTCTGG - Intronic
1184714522 22:46273316-46273338 CTGGCTCAGGCCTGGGACCCAGG - Intronic
1185006974 22:48285054-48285076 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
1185274358 22:49943944-49943966 CTGGCTGGGTGCTGCTCCCCGGG - Intergenic
1203227730 22_KI270731v1_random:87534-87556 CTCCCTCTGGGCTGCGTCCCCGG - Intergenic
950629740 3:14274523-14274545 CTGCCTCTGAGCTGCCACTCTGG - Intergenic
951183857 3:19689146-19689168 CAGGCTCTGGGCTGGTACTGGGG - Intergenic
951269682 3:20608695-20608717 CTGGCTCTGGGCTGGTACTGGGG - Intergenic
953749364 3:45597357-45597379 CTGGCTGTTGGCTGTTACCTGGG - Intronic
953873131 3:46644953-46644975 CTGTCTCTGAGCTGCCACTCTGG - Intergenic
954643850 3:52118653-52118675 CTGGCTTTCGACTGCTACGCTGG + Intronic
955803853 3:62713560-62713582 CTGCCCCTGGGCTGCTATTCTGG + Intronic
956197594 3:66668854-66668876 CTGTCTTTGAGCTGCTACTCTGG + Intergenic
956689801 3:71865007-71865029 CAGGCTCTGGGCTGGGCCCCAGG + Intergenic
956839255 3:73121774-73121796 CTGCCTCTGAGCTGCTACCCTGG - Intergenic
956927473 3:74004698-74004720 ATGGCTCTGGGCTGTTGCCATGG + Intergenic
957415356 3:79895207-79895229 CTGCCTTTGGGCTGCTACTCTGG + Intergenic
957501731 3:81066640-81066662 CTGGCTTTCTCCTGCTACCCAGG + Intergenic
958013878 3:87915042-87915064 CTGCCTCTGGGCTGGTACTGGGG - Intergenic
959009674 3:101060858-101060880 CTGGCTCTGGGCTGGTACTGGGG + Intergenic
959715673 3:109430754-109430776 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
959780545 3:110227670-110227692 CTGGCCCCGAGCTGCTACTCTGG + Intergenic
959875230 3:111374021-111374043 CAGGCTCTGGGCTGGTACTTGGG - Intronic
960516604 3:118608669-118608691 CAGGCTCTGGGCTGATACTGGGG - Intergenic
960703555 3:120460181-120460203 CAGGGTCTGGGCTACTCCCCAGG + Intergenic
960712387 3:120544483-120544505 CAGGCTCTGGGCTGGTGCCTGGG + Intergenic
961475995 3:127146723-127146745 CTGGCTCTGGGCTGCAGCCAGGG + Intergenic
961503568 3:127355238-127355260 CTGCCTCTGAGCTGCTGCTCTGG - Intergenic
962401783 3:135066989-135067011 CAGGCTCTGGGCTGTTACTGGGG + Intronic
962504882 3:136036515-136036537 CAGGCTCTGGACTGCTACTGGGG + Intronic
962848255 3:139289304-139289326 CAGGCCCTGAGATGCTACCCAGG + Intronic
962862112 3:139414022-139414044 CTGGCTCTGGGCTGGTGCTGGGG + Intergenic
963066193 3:141266340-141266362 CTGAGTCGGGGCTGCCACCCTGG + Intronic
963832530 3:150023380-150023402 CAGGCTCTGGGCTGGTACTGAGG - Intronic
964075727 3:152689117-152689139 CAGGCTCTGGGCTGGTACTGGGG - Intergenic
964917418 3:161854131-161854153 CTGGCTCTGGGTTGGTACTGGGG + Intergenic
965469003 3:169066648-169066670 CATGCTCTGGGCTGTTACCCAGG + Intergenic
966337030 3:178879883-178879905 ATGGCTAGGGGCTGCTACACTGG - Intergenic
966503343 3:180671360-180671382 CTGCCTCTGAGCTGCTACTCTGG + Intronic
967843603 3:194027222-194027244 CTGCCTCTGAGCTGATACTCAGG - Intergenic
968372900 4:11698-11720 CTGTCTCTGCGCTGCGCCCCAGG - Intergenic
968579764 4:1384414-1384436 CTGGCTCTGGGAGGCTGGCCTGG + Intronic
968745196 4:2356365-2356387 CTTGCTCTGGGCTGTGTCCCAGG - Intronic
968814550 4:2815195-2815217 CTGGCACTGGGCTCCTGGCCAGG + Intronic
968969518 4:3786301-3786323 GTGGCCCTGGGCTGCCAGCCTGG - Intergenic
969356784 4:6632578-6632600 CTGCCTCTGAGTTGCTACTCTGG - Intergenic
969538998 4:7774150-7774172 CTGGCCCAGGGCTGCCACTCTGG + Intronic
969656795 4:8503368-8503390 CTTGCTTTAGGCTGCTTCCCCGG - Intergenic
969692102 4:8709409-8709431 CTGGCTCTGGGGGGCAATCCTGG - Intergenic
969698964 4:8755256-8755278 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
970549252 4:17163221-17163243 CAGGCTCTGGGCTACTACTGGGG + Intergenic
970658564 4:18259838-18259860 CTGGCTCTGGGCTGATACTGGGG + Intergenic
970693971 4:18654185-18654207 CTGCTTCTGGGCTGGCACCCTGG - Intergenic
970817878 4:20179209-20179231 CTGGCTCTCGGGTGCTGCGCTGG - Intergenic
971050343 4:22855094-22855116 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
972569474 4:40297151-40297173 CTATCCCTGGGCTGCTGCCCTGG + Intergenic
972899709 4:43668537-43668559 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
973244448 4:47995944-47995966 CAGGCTCTGGGCTGGTACTAGGG + Intronic
973260684 4:48160386-48160408 CTGTCTCTGGACTGCTGCGCTGG - Intronic
973278526 4:48335353-48335375 CTGGCTCTCGTCTGTTTCCCAGG + Intergenic
973787143 4:54342542-54342564 CTGGCTCTAGGCTGGTACCAAGG - Intergenic
973831497 4:54764457-54764479 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
974880701 4:67753652-67753674 CTGGCTCTGTTCTGTTACCTTGG - Intronic
975942888 4:79668770-79668792 CAGGCTCTGGGCTGGTACTGGGG - Intergenic
976375310 4:84339164-84339186 CTGGCTCTGAGCTGCTCCTAGGG - Intergenic
976556259 4:86453955-86453977 CAGGCTCTGGGCTGGTACTGGGG - Intronic
977510525 4:97956658-97956680 TAGGCTCTGGGCTGCTACTGGGG - Intronic
977816237 4:101416841-101416863 CTGGCTCTGGTCTGCTGAACTGG + Intronic
978169488 4:105652044-105652066 CTGGCTCTGCCCTGGTAACCAGG - Intronic
978672718 4:111270330-111270352 ATGGCTCTGAGCAGCTATCCTGG + Intergenic
979511223 4:121556111-121556133 CTGCCCCTGAGCTGCTACTCTGG + Intergenic
980226975 4:129999109-129999131 CTGGGACTGAGCTGGTACCCAGG - Intergenic
981116362 4:140995358-140995380 CTGCCTCTGAGCTGCTACTCTGG - Intronic
982063605 4:151629749-151629771 CTGGCTCGGAGATGCTACGCAGG - Exonic
982313245 4:154006772-154006794 CTGGCTGGGGGCTGGTTCCCAGG + Intergenic
983251496 4:165351356-165351378 CGGGCTCTGGGCTGGTACTGGGG + Intergenic
983845519 4:172513710-172513732 CTGGCTCTAGGCTGCTACTAGGG + Intronic
983903189 4:173158597-173158619 CTCGCTCTGCTCTGCCACCCAGG + Intergenic
984197541 4:176677001-176677023 CTGCCTCTTGGCTGCTATTCTGG + Intergenic
984460265 4:180026887-180026909 CTGGCTCTTGGCTGATACTTGGG + Intergenic
985038965 4:185869441-185869463 CTGTCTTTATGCTGCTACCCTGG + Intronic
985668723 5:1195589-1195611 CTGGCTGAGGGCTGCTTCCCAGG - Intergenic
985875664 5:2592001-2592023 TTGTCTCTGGGCAGCTGCCCTGG + Intergenic
987006033 5:13710154-13710176 CTGGCTCTGGGCTGGTACTGGGG - Intronic
987563634 5:19555964-19555986 CAGGCTCTGGGCTGATACTGGGG - Intronic
987671512 5:21016048-21016070 CTGCCTCTGGGCTGCTATTCTGG - Intergenic
987704327 5:21443955-21443977 CTGGCTCCGGGCTGGTACTGGGG + Intergenic
988226052 5:28412392-28412414 CTGCCTCTGAGCTGCTTCTCTGG - Intergenic
989533736 5:42539469-42539491 CTGGCTCTGAGCTGGTACTGAGG + Intronic
990616007 5:57509013-57509035 CTGCCTCTGAGCTGCTACTCTGG + Intergenic
991944421 5:71885690-71885712 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
992165124 5:74042101-74042123 CTGACTCAGGGCTGACACCCAGG - Intergenic
992508463 5:77410250-77410272 CTGCCTCTGAGCTGCTACCAGGG - Intronic
994801292 5:104380472-104380494 CTGCCTCTGAGCTCCTACTCTGG + Intergenic
994883511 5:105528890-105528912 CTGGCTCTGGGCTGGTACTGGGG + Intergenic
995370476 5:111412936-111412958 TTGCCTCTGAGCTGCTACTCTGG + Intronic
995472941 5:112522916-112522938 CTGGCTCTGGGCTCATACTGGGG + Intergenic
996031870 5:118714463-118714485 CAGGCTCTGGGCTGGTACTGGGG - Intergenic
996080866 5:119256394-119256416 CAGGCTCTGGGCTGCTACTGGGG - Intergenic
997105916 5:131019379-131019401 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
997445300 5:133935787-133935809 CTGGTTCTGGGCTCCTCCCCCGG + Intergenic
997641951 5:135455177-135455199 CGGGCGGTGGGCTGCTACTCTGG + Intergenic
997724250 5:136106910-136106932 CTGGCTCTCACCTGCTGCCCAGG - Intergenic
997760986 5:136446915-136446937 TTGGCTCTGGGCTGGTACTGGGG - Intergenic
998611586 5:143695018-143695040 CTGGCTCTGGGTCACTTCCCTGG - Intergenic
999034598 5:148333458-148333480 CTGCCTCTGAGCTGCTACTCTGG - Intronic
999367630 5:151033442-151033464 CTGGCTCTGGGCTGCTACCCAGG - Intronic
999891495 5:155982760-155982782 CTCGGTCTGGGCTGCTTTCCGGG + Intronic
1000593454 5:163186317-163186339 CTGCTTCTGGGCTGCTACTCTGG + Intergenic
1001563202 5:172683562-172683584 CTGGCGCTGGGCCGCGCCCCGGG + Exonic
1002424351 5:179166652-179166674 CTGGCTCTGAGCTGCCCGCCGGG + Intronic
1002463933 5:179394551-179394573 CTGCCCCTGAGCTGCTACTCTGG + Intergenic
1002859169 6:1064812-1064834 CAGGCTCTGTCCTGCTGCCCTGG - Intergenic
1003063215 6:2878116-2878138 CTGGCTCCGGGCTGGTACTGGGG - Intergenic
1003297417 6:4844127-4844149 CGGGCTCTGGGCTGGTACTCGGG + Intronic
1003422070 6:5967608-5967630 CTGCCTCTGTGCTTCTCCCCTGG - Intergenic
1003924238 6:10861924-10861946 CTGCCTCTGAGCTGCTACTCTGG + Intronic
1004453561 6:15770255-15770277 CTTGCTCTGAGGTTCTACCCTGG - Intergenic
1005072557 6:21875012-21875034 CTGGCTCTGGGCTGGTACTGGGG - Intergenic
1005452591 6:25988194-25988216 CTGCCCCTGAGCTGCTACTCTGG + Intergenic
1006196111 6:32243566-32243588 CTGTCTCAGGGCTGCTGTCCAGG + Intergenic
1007400598 6:41600268-41600290 CTGACCCTGGGCTGCTTCCTGGG + Exonic
1008305384 6:49892778-49892800 CAGGCTCTGGGCTGGTACTGGGG - Intergenic
1008387763 6:50913364-50913386 CTGGCTATGGGCAGCTGGCCTGG + Intergenic
1008775339 6:55031626-55031648 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
1009332445 6:62440838-62440860 CAGGCTCTGGGCTGATACTGGGG + Intergenic
1009392033 6:63155975-63155997 CAGGCTCTGGGCTGGTACTGCGG - Intergenic
1009800181 6:68527485-68527507 CAGGCTCTGGGCTGGTACTCGGG + Intergenic
1010008891 6:71027838-71027860 CAGGCTCTGGGCTGGTACCTGGG + Intergenic
1010045352 6:71436715-71436737 CTGGCTCTGGGCTGGTACCAGGG - Intergenic
1010378517 6:75202282-75202304 CTGGCTCGGGGCTGCGACCTCGG - Intronic
1010679391 6:78781633-78781655 CTGGCTCTGGGCTGGTACTGGGG - Intergenic
1011133076 6:84072374-84072396 CTGGCTCTGGGCTGGTACTGGGG + Intronic
1011329013 6:86183490-86183512 CTGGCTCTGGGCTGGTACTGGGG + Intergenic
1011620349 6:89237030-89237052 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
1011965803 6:93156376-93156398 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
1012239001 6:96851131-96851153 AAGCCTCTGGGCTGCTAGCCTGG + Intergenic
1012777519 6:103516544-103516566 CAGGCATGGGGCTGCTACCCTGG + Intergenic
1013509376 6:110830600-110830622 CTGCCCCTGAGCTGCTACTCTGG + Intronic
1013975509 6:116073903-116073925 CTGGCTCCTGGCTGCTGCCAGGG + Intergenic
1014531326 6:122563263-122563285 CTGGCTCTGGGCTAGTACTGGGG + Intronic
1014533189 6:122585082-122585104 CTGCCTCTGAGCTGCTATTCTGG + Intronic
1014603961 6:123448911-123448933 CCGGCTCTGGGCTGGTACTGGGG - Intronic
1014865402 6:126522495-126522517 CTCTCTCTGGGCTGCTATACTGG + Intergenic
1015213441 6:130722616-130722638 CTGGCTCTGGGCTTCTACACAGG - Intergenic
1015663245 6:135600039-135600061 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
1016045883 6:139479960-139479982 CATGCTCTGGGCTGCTGCCTTGG + Intergenic
1016186113 6:141199161-141199183 CTGGCTTTAGGCTGCTGTCCTGG + Intergenic
1016548061 6:145246404-145246426 CTGCCTCTGAGCTGCTACTCTGG + Intergenic
1016910067 6:149190088-149190110 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
1017093960 6:150787653-150787675 CTGGCTCTGGACTGTTCCACAGG + Intronic
1017729719 6:157304824-157304846 CTGGCTGTTTGCTGCTATCCAGG - Intronic
1018273855 6:162108996-162109018 CTGCCTCTGAGCTGCTGCCCTGG - Intronic
1018755348 6:166843611-166843633 CTGGCTCTGGGCTGGTACTGAGG - Intronic
1018998660 6:168729233-168729255 CTGGCTCATGGCTGCTCCGCTGG + Intergenic
1019724803 7:2595608-2595630 CTGGCTCTCTGCTGCCTCCCTGG + Intronic
1020211037 7:6158486-6158508 CTGGCTCTGGGCTGCTGGGAGGG - Intronic
1021650432 7:22827869-22827891 CTGCCCCTGAGCTGCTACTCTGG + Intergenic
1021767076 7:23960584-23960606 CTTTCTCTGGGGTGCTTCCCAGG + Intergenic
1022107962 7:27210327-27210349 CTGGGTCTGGGTTCCCACCCAGG - Intergenic
1022443715 7:30453194-30453216 CTGGCTCTGTGACGCTCCCCAGG - Intronic
1022687802 7:32612886-32612908 CTGCCTCTGAGCTGTTACTCTGG - Intergenic
1022716688 7:32905342-32905364 CTGCCTTTGAGCTGCTACTCTGG - Intergenic
1022777639 7:33544493-33544515 CTGGCTCCGGGCTGGTACTGCGG + Intronic
1023746755 7:43329242-43329264 CTGACCCTGGGCTCCTTCCCTGG - Intronic
1023874206 7:44278005-44278027 CAGGCTCTGGGCTGGGAGCCAGG + Intronic
1024063658 7:45716285-45716307 CTGGCTGTGGGCTGAGATCCTGG + Exonic
1024114400 7:46178694-46178716 CTGCCTCTGGCCTGCTCACCTGG + Intergenic
1024455829 7:49605411-49605433 CAGGCTCTGGGCTGCTACTGGGG - Intergenic
1024545554 7:50514169-50514191 CCAGCTCTGGGCTGGTACCAGGG - Intronic
1024563843 7:50665699-50665721 CTGGGTCTGGGGTCCTGCCCAGG - Intronic
1024669229 7:51577122-51577144 CTGGCTCTGGGCTGGTACTGGGG + Intergenic
1024967126 7:55033691-55033713 CTGGCTCTTGGCGACTTCCCAGG - Intronic
1025186287 7:56862152-56862174 CTGGCTCTGAGCTGCAGTCCTGG - Intergenic
1025685634 7:63714746-63714768 CTGGCTCTGAGCTGCAGTCCTGG + Intergenic
1025907877 7:65802497-65802519 CTGGCTCTGAGCTGCAGTCCTGG + Intergenic
1026009494 7:66625838-66625860 CTGCCTCTGAGCTGCTACGCTGG + Intergenic
1026042663 7:66881322-66881344 CTGGCTCTGAGCTGCAGTCCTGG + Intergenic
1026222940 7:68416041-68416063 CTGCCTTTGAGCTGCTACTCTGG + Intergenic
1026236251 7:68529568-68529590 CTGCCTCTGAGCTGCTACTCTGG + Intergenic
1027206104 7:76100767-76100789 CTGGCTCTGAGCTGCAGTCCTGG - Intergenic
1027250599 7:76396441-76396463 CTGCCTCTCAGCTGCTACTCTGG + Intronic
1027265837 7:76494845-76494867 CTGGCTCCGGGGTGCTGGCCAGG - Intronic
1027265919 7:76495232-76495254 CTGGCACTGGGCTCGAACCCAGG + Intronic
1027317209 7:76992962-76992984 CTGGCTCCGGGGTGCTGGCCAGG - Intergenic
1027317293 7:76993349-76993371 CTGGCACTGGGCTCGAACCCAGG + Intergenic
1027328972 7:77071286-77071308 CAGGCTCTGGGCTGGTACGGGGG + Intergenic
1028636442 7:92994529-92994551 CTGGTTCTGGGTTGGGACCCAGG + Intergenic
1028880022 7:95869718-95869740 CTGGCTCTGGGCTGGAAGTCAGG - Intronic
1029172979 7:98643841-98643863 CTGGCTCTGAGCTGGTGACCTGG - Intergenic
1029195509 7:98802637-98802659 CTGGATCTGGGCTGCAGCCTGGG + Intergenic
1029570912 7:101368502-101368524 CTGCCTCTGAGCTGCTAGTCTGG - Intronic
1029576671 7:101407952-101407974 CTACCTCTGAGCTGCTACTCTGG + Intronic
1029577434 7:101412692-101412714 CTGCCTCTGAGCTGCTACTCTGG + Intronic
1031675858 7:124610945-124610967 CAGGCTCTGGGCTGGTACTGGGG - Intergenic
1031892330 7:127309181-127309203 CTGCCTCTGAGCTGCTACTCTGG + Intergenic
1031910647 7:127513424-127513446 CTGCCTCTGAACTGCTACTCTGG + Intergenic
1033527279 7:142228731-142228753 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
1034075762 7:148229668-148229690 ATGGCTCTCGGGTGCCACCCAGG - Exonic
1034443833 7:151101668-151101690 CAGCCTCTGTACTGCTACCCAGG - Intronic
1034970607 7:155417092-155417114 CTGCCGCTAAGCTGCTACCCTGG + Intergenic
1035938472 8:3868916-3868938 TTGGCTCTGGGGTGTTAGCCAGG - Intronic
1036732346 8:11276955-11276977 ATGCCTCTGAGCTGCTACTCTGG + Intergenic
1036782266 8:11657965-11657987 CTGCCTGTGGGCTGCTCCCAGGG - Intergenic
1037236070 8:16720690-16720712 CTGGTCCTGGACTGCTTCCCTGG + Intergenic
1037456739 8:19071596-19071618 CTGCCTCTGGGCAGCTCCCCGGG - Intronic
1037471469 8:19215486-19215508 CCGCCTCTGAGCTGCTACCCTGG + Intergenic
1037530686 8:19769858-19769880 CTGCCTCTGGGCTGCTACTCTGG + Intergenic
1038125523 8:24668961-24668983 ATGGCTCTGGGAGGCTGCCCTGG + Intergenic
1038448988 8:27626839-27626861 CTGCCTCTGAGCTGCTAACCTGG + Intergenic
1038704619 8:29881893-29881915 CTGGCTAGGAGCTGTTACCCAGG + Intergenic
1039083226 8:33754971-33754993 CTGGCTCTGAGCTGGTACTGGGG + Intergenic
1039324987 8:36475155-36475177 CTGCCTCTGAGCTGCTAGCCTGG - Intergenic
1039375289 8:37026714-37026736 CTGCCTCTGAGCTGCTATTCTGG + Intergenic
1040856958 8:51958383-51958405 CTGCCTCTGAGCTGTTACTCTGG - Intergenic
1041637176 8:60156883-60156905 CCGGCTCTGGGCTGGTACTGGGG - Intergenic
1041897205 8:62938591-62938613 CGGGCTCTGGGCTGGTACTGGGG - Intronic
1042431465 8:68711008-68711030 CGGGCTCTGGGCTGGTACTGGGG - Intronic
1043121620 8:76332312-76332334 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
1043545186 8:81307072-81307094 CAGGCTCTGGGCTGGTACCGGGG - Intergenic
1043848617 8:85190181-85190203 CTGCCTCAGGGCTGCTGCACAGG + Intronic
1046646865 8:116794777-116794799 CTGCCTCTGGGCTGCTATTTTGG - Intronic
1047032422 8:120896762-120896784 CTGGCTCTGGGCTGGTACTGGGG - Intergenic
1047937437 8:129796690-129796712 CAGGCTCTGGGCTGGTACTGGGG + Intergenic
1048330700 8:133468864-133468886 CTGGCTGTGGTCCTCTACCCTGG - Intronic
1049429641 8:142554560-142554582 GTGCCTCTGAGCTGCTTCCCTGG - Intergenic
1049627374 8:143631328-143631350 GTGCCTCTGAGCTGCTTCCCTGG - Intergenic
1050147448 9:2584013-2584035 CTGGCTCGGGGCTGGTACTGGGG - Intergenic
1050469292 9:5969106-5969128 CTGCCTCAGCGCTGCTTCCCAGG + Exonic
1050612786 9:7370636-7370658 CTAGCTCAGGGCTGCTAGGCTGG - Intergenic
1050988210 9:12110034-12110056 TTGCCTCTGGGTTGATACCCAGG - Intergenic
1051289139 9:15527788-15527810 CTGGCTATGGGCGGCTGGCCGGG + Intergenic
1051362745 9:16295256-16295278 CTGGTTCTGGGCTGGTACTGGGG - Intergenic
1051369873 9:16349196-16349218 TTGGCTCTGGGCTGCTAGCCTGG + Intergenic
1051920453 9:22258069-22258091 CTGGGTCTGGACTGAGACCCTGG + Intergenic
1055033795 9:71796678-71796700 CTGCCTCTGAGCTGCCACTCTGG + Intronic
1056283155 9:85062157-85062179 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
1056316377 9:85394643-85394665 CTGGGTGAGGGCTGCTCCCCAGG - Intergenic
1056655519 9:88505665-88505687 CTGGCACTGGGCTGCAAACCAGG - Intergenic
1056760319 9:89409866-89409888 CTGGCTCTGGACTCTTAGCCTGG - Intronic
1057119434 9:92558440-92558462 CCGGCTCTGGGCTGGTACTGGGG + Intronic
1057134921 9:92680722-92680744 CTGGCTTAGGGCTGCTCCCTGGG + Intergenic
1057397011 9:94689464-94689486 CTGGCTGAGGGCTGCTGCCTGGG - Intergenic
1057407518 9:94786771-94786793 CTGGCCCTGGGCTTCTTGCCTGG - Intronic
1058084972 9:100739365-100739387 CTGGCTCTGGGCTGGTACTGGGG + Intergenic
1058784489 9:108374044-108374066 CAGGCTCTGGGCTGGTACTAGGG + Intergenic
1060265439 9:122109162-122109184 CTGGCTTTGGCCTGGTCCCCAGG + Intergenic
1060485857 9:124045755-124045777 CCGGCTCTGGGCTGCCAGCGCGG + Intergenic
1060874241 9:127068780-127068802 CTGCCTCTGAGCTGCTACTCTGG - Intronic
1061006214 9:127929711-127929733 AGGGCTGTGGGCTGCCACCCAGG - Exonic
1061223142 9:129264081-129264103 CGGCCTCTGAGCTGCTACTCTGG - Intergenic
1061275422 9:129567275-129567297 CTGACTCTGGGAGGCTTCCCCGG + Intergenic
1061290752 9:129649219-129649241 CAGGCTCTGGGCTGCCCACCTGG - Intergenic
1061422054 9:130477885-130477907 CTGGCGCTCGGCTCTTACCCCGG + Intronic
1061851953 9:133421561-133421583 CTGGCTTGGGGCTGCTTTCCTGG + Intronic
1062078731 9:134607244-134607266 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
1062131233 9:134894536-134894558 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
1062342253 9:136098977-136098999 CTGGCTCTGGGGAGCTGTCCCGG - Intergenic
1062554361 9:137107280-137107302 CTGGCTCTGGGCGTCTACCACGG + Exonic
1185523535 X:759802-759824 CTGCCTCTGAGCTGCTACTCTGG + Intergenic
1186045696 X:5534254-5534276 CTGCCTCTGAGCTGCTACTCTGG + Intergenic
1187219139 X:17307427-17307449 CTGGCTCTGGGCTGGTACTGGGG + Intergenic
1187260579 X:17682023-17682045 CTGGCTTTGGGCTGCTCTGCAGG + Intronic
1187286734 X:17912495-17912517 CTGGGTCAGGGTTGCTTCCCTGG + Intergenic
1187337210 X:18391875-18391897 CTGACTCTGGGGTCCTTCCCAGG - Intergenic
1187748448 X:22434034-22434056 CTGGCTCTGGGCTGGTACTGGGG - Intergenic
1188045832 X:25425742-25425764 CTGGCTCTGGGCTGGTACTGGGG + Intergenic
1189218229 X:39345394-39345416 TTGGCTCTGGGCTGGTACTGGGG - Intergenic
1190897243 X:54633045-54633067 TGGGCTCTGGGCTGGTACTCGGG + Intergenic
1191138677 X:57093221-57093243 CAGGCTCTGGGCTGGTACTGGGG - Intergenic
1191151752 X:57227448-57227470 CTGGCTCTGGGCTGGTACTGGGG + Intergenic
1191903507 X:66063996-66064018 CTGGCTCTGGGCTGGTACTGGGG + Intergenic
1192313671 X:70035940-70035962 CTTTCTCTGGCCTGCTGCCCTGG - Exonic
1192970210 X:76220885-76220907 CTGGCTCAGGGCTGGTACTGGGG + Intergenic
1193076623 X:77362579-77362601 CTGGCTCTGGGCTGGTGCTGGGG + Intergenic
1193156925 X:78183693-78183715 CTGGCTCTGGGCTGGTACTGGGG - Intergenic
1193255442 X:79343039-79343061 CAGGCTCTGGGCTGCTGCTGGGG - Intergenic
1193447551 X:81622272-81622294 CTGGCTCTGGGCTGGTACTGGGG + Intergenic
1193578585 X:83233189-83233211 CTGGCTCTAGGCTGGTACCGGGG - Intergenic
1193775884 X:85641533-85641555 CGGGCTCTGGGCTGGTACTGGGG + Intergenic
1194571822 X:95561837-95561859 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
1194701424 X:97119352-97119374 CTGGCTCTGGGCTGGTACTGGGG + Intronic
1195277903 X:103300095-103300117 CTGCTTTTGGGCTGCTACTCTGG - Intergenic
1195313081 X:103652984-103653006 TTGCCTCTGAGCTGCTACTCTGG - Intergenic
1197083591 X:122446864-122446886 CTGGCTCTGGGCTGGTACTGGGG - Intergenic
1197120147 X:122881075-122881097 CGGGCTCTGGGCTGGTACTGGGG - Intergenic
1197132472 X:123020511-123020533 CTGGCTCTGGGCTGGTACTGGGG - Intergenic
1197953758 X:131924221-131924243 CTGGCTCTGGGCTGGTACTGGGG - Intergenic
1198203312 X:134443313-134443335 CTGGCCCAGGGCTGCTGCACAGG + Intergenic
1198604480 X:138322050-138322072 CTGGCTCTGGACTGGTACTGGGG + Intergenic
1198759778 X:140019145-140019167 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
1198779007 X:140214905-140214927 CTGCCTCTGAGCTGCTACTCTGG + Intergenic
1198928522 X:141825995-141826017 CTGCCTCTGAGCTGCTATTCTGG - Intergenic
1199121649 X:144061310-144061332 CAGGCTCTGGGCTGGTACTGGGG - Intergenic
1199206006 X:145148959-145148981 CAGGCTCTGGGCTGGTACTGGGG - Intergenic
1199511927 X:148631908-148631930 ATGGCTCTGGCATGGTACCCTGG - Intronic
1200093256 X:153645456-153645478 CGGGCAGTGGGCTGCTAGCCGGG - Intronic
1200399822 X:156012903-156012925 CTGCCTCTGAGCTGCTACTCTGG + Intergenic
1200685512 Y:6254940-6254962 CCAGCCCTGGGCTGCTTCCCTGG + Intergenic
1200687903 Y:6273549-6273571 CCAGCCCTGGGCTGCTTCCCTGG + Intergenic
1200991042 Y:9346181-9346203 CCAGCCCTGGGCTGCTTCCCTGG + Intergenic
1200993700 Y:9366474-9366496 CCAGCCCTGGGCTGCTTCCCTGG + Intronic
1200996363 Y:9386792-9386814 CCAGCCCTGGGCTGCTTCCCTGG + Intergenic
1200998878 Y:9455347-9455369 CCAGCCCTGGGCTGCTTCCCTGG + Intergenic
1201001532 Y:9475656-9475678 CCAGCCCTGGGCTGCTTCCCTGG + Intronic
1201004198 Y:9495958-9495980 CCAGCCCTGGGCTGCTTCCCTGG + Intergenic
1201006853 Y:9516270-9516292 CCAGCCCTGGGCTGCTTCCCTGG + Intergenic
1201009505 Y:9536576-9536598 CCAGCCCTGGGCTGCTTCCCTGG + Intergenic
1201012096 Y:9557278-9557300 CCAGCCCTGGGCTGCTTCCCTGG + Intergenic
1201047366 Y:9901153-9901175 CCAGCCCTGGGCTGCTTCCCTGG - Intergenic
1201306758 Y:12557007-12557029 CTGGCTCTGGGCTGGTACTGGGG - Intergenic
1201345704 Y:12982468-12982490 CTAGCTATGGGCTGCAGCCCTGG + Intergenic
1202131983 Y:21621061-21621083 CCAGCCCTGGGCTGCTTCCCTGG - Intergenic
1202377946 Y:24255356-24255378 CTGGCTCAGGGCTGCTTGCTGGG - Intergenic
1202492836 Y:25414765-25414787 CTGGCTCAGGGCTGCTTGCTGGG + Intergenic