ID: 999369464

View in Genome Browser
Species Human (GRCh38)
Location 5:151045202-151045224
Sequence CCACCCACTCAGACTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 509
Summary {0: 1, 1: 0, 2: 13, 3: 95, 4: 400}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999369464_999369473 28 Left 999369464 5:151045202-151045224 CCTGCCTCAGTCTGAGTGGGTGG 0: 1
1: 0
2: 13
3: 95
4: 400
Right 999369473 5:151045253-151045275 TAATTTTTTGTATTTTTAGTAGG 0: 623
1: 530
2: 860
3: 3276
4: 6000

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999369464 Original CRISPR CCACCCACTCAGACTGAGGC AGG (reversed) Intronic
900278560 1:1850078-1850100 CCAGCTACTCAGGCTGAGGCAGG - Intronic
900457264 1:2783372-2783394 CTATCCACACAGACTGAGGCTGG + Intronic
900610464 1:3542474-3542496 CCCCCCACTCAGCCTGATGTGGG + Intronic
901205754 1:7494945-7494967 CTACGCCCTCAGACTGGGGCTGG + Intronic
901269617 1:7941800-7941822 CCAGCTACTGAGGCTGAGGCAGG + Intronic
901731552 1:11283934-11283956 TCTCCCACTCAGACTGAAACAGG - Intronic
901857258 1:12052498-12052520 CCACCTACCCAGACTGTGGTGGG - Intergenic
902591753 1:17480016-17480038 CCAGCTACTCAGGCTGAGGTGGG + Intergenic
903335923 1:22624493-22624515 CCAGCTACTGAGACTGAGGCAGG + Intergenic
903829693 1:26167302-26167324 CCAGCTACTCAGGCTGAGGCGGG - Intergenic
903850399 1:26302246-26302268 CCAGCTACTGAGGCTGAGGCAGG + Intronic
904232411 1:29087054-29087076 CCAGCTACTCAGGCTGAGGCAGG - Intronic
904476788 1:30770248-30770270 CCATCCACACAGAAGGAGGCTGG + Intergenic
904489966 1:30852528-30852550 ACACACAGTCACACTGAGGCAGG + Intergenic
904661721 1:32090560-32090582 CCAGCTACTCAGGCTGAGGTAGG - Intronic
905360225 1:37414152-37414174 CCAGCTACTCAGGCTGAGGTGGG - Intergenic
907171194 1:52466780-52466802 CCAGCTACTCAGGCTGAGGCAGG - Intronic
907272036 1:53296816-53296838 CCACCCTCTCAGGCTGTGGCGGG + Intronic
907611018 1:55871230-55871252 GTACCCACCCAGACTGAGGGTGG - Intergenic
907921678 1:58919783-58919805 CCCCTCACTCAGAATGAGGGAGG - Intergenic
908245258 1:62222762-62222784 CCAGCTACTCAGGCTGAGGCAGG + Intergenic
908249809 1:62256495-62256517 CCAGCTATTCAGGCTGAGGCAGG - Intronic
910396085 1:86795117-86795139 CCAGCCTCAGAGACTGAGGCAGG + Intergenic
910630527 1:89348779-89348801 CTACCCAACCAGACTGAGGTTGG - Intergenic
912935408 1:113999808-113999830 TCACCAACTCAGGCTCAGGCAGG + Intergenic
914705372 1:150165949-150165971 CACCCCACTGAGGCTGAGGCAGG + Intergenic
914786411 1:150836364-150836386 CAAACCATTCAGACTGTGGCTGG + Exonic
915149830 1:153821676-153821698 CCAGCTACTGAGGCTGAGGCAGG - Intronic
915207596 1:154282100-154282122 CCAGCCACTCAGGCTGAGGCAGG - Intergenic
915307936 1:154991738-154991760 CCAGCTACTCAGGCTGAGGCGGG + Intronic
915337142 1:155151318-155151340 CCAGCTACTCAGGCTGAGGCAGG + Intergenic
915777126 1:158502012-158502034 CCAGCTACTCTGGCTGAGGCGGG - Intergenic
915828867 1:159106235-159106257 CCACCAACTCAGAAGCAGGCAGG + Intronic
916345579 1:163787545-163787567 CCACCCACTCTGCCTTAAGCAGG - Intergenic
917154415 1:171981015-171981037 CCCACCACTGAGGCTGAGGCGGG - Intronic
917605893 1:176629116-176629138 CCACCTACTCAAAAAGAGGCTGG - Intronic
919800285 1:201350006-201350028 CCAGCTACTGAGGCTGAGGCAGG - Intergenic
920142998 1:203833251-203833273 CCAGCTACTCAGGCTGAGGCAGG + Intronic
920185426 1:204156395-204156417 CCACCCACCCACACTCAGGAAGG - Intronic
920224316 1:204427023-204427045 CCAGCTACTCAGGCTGAGGCAGG + Intronic
920346409 1:205308541-205308563 CCACCCACTGAGAATATGGCTGG + Intronic
921082790 1:211756440-211756462 CCAGCTACTCAGGCTGAGGTGGG - Intronic
922606693 1:226894115-226894137 CCAGCCACTCACAATGAGGATGG - Exonic
922671251 1:227510035-227510057 ACCCCCACTCAGACTCAGGTGGG - Intergenic
922755524 1:228094573-228094595 CAACCCCCTCAGACTGGAGCAGG - Intronic
922801031 1:228364881-228364903 CCACCCACCCTGCCTGTGGCAGG + Intronic
923357722 1:233176898-233176920 CCAGCTACTCGGGCTGAGGCAGG + Intronic
923459640 1:234197205-234197227 CTACCCACTCCCACTGAGGCTGG + Intronic
923767349 1:236904510-236904532 CCAGCTACTCAGGCTGAGGCAGG + Intergenic
924350801 1:243112839-243112861 CCGGCCACTGGGACTGAGGCAGG - Intergenic
924893104 1:248306392-248306414 CCACGGACTCAGACGGAGCCAGG + Intergenic
1064537848 10:16377007-16377029 CCAGCTACTCAGGCTGAGGTCGG - Intergenic
1066458715 10:35594836-35594858 CCAGCTACTCAGGCTAAGGCAGG + Intergenic
1066572907 10:36792445-36792467 CCAGCTACTCAGGCTGAGGCTGG + Intergenic
1067122713 10:43487989-43488011 CCAACTACTCAGGCTGAGGCAGG + Intergenic
1067830408 10:49608520-49608542 CCACCAACCCAGACAGAGCCTGG + Intergenic
1068032855 10:51724806-51724828 CCAGCTACTCAGGCTGAGGCAGG - Intronic
1068837666 10:61571925-61571947 GCACCCACCCAGACTGAGCATGG - Intergenic
1070240936 10:74679844-74679866 CCAGCTACTCAGGCTGAGGCTGG + Intronic
1070562910 10:77581418-77581440 CCAGCTACTGAGGCTGAGGCAGG - Intronic
1071183191 10:83010520-83010542 GCACCCACCCAGATTGAGGGTGG + Intergenic
1072501023 10:96017823-96017845 CCACATACTTAGACTGAGGAGGG + Intronic
1072840485 10:98768933-98768955 CCAGCTACTCAGACCGAAGCAGG + Intronic
1072858338 10:98974175-98974197 ACAGCTACTCAGCCTGAGGCAGG + Intronic
1072861811 10:99014000-99014022 CCACCCCCTTAGCCTGAGCCAGG - Intronic
1072893135 10:99343075-99343097 CCAGCTACTTAGGCTGAGGCAGG - Intronic
1073100491 10:101003901-101003923 CCTCCCACTCAGACAGTGGCCGG + Exonic
1073200893 10:101734499-101734521 CCAGCAACTGAGGCTGAGGCAGG + Intergenic
1074457817 10:113611023-113611045 CCACCCACACGAACTCAGGCAGG - Intronic
1074536923 10:114334736-114334758 CCACCCACTGAGACTCAGAGGGG + Intronic
1075141842 10:119844699-119844721 CTGCCCACCCAGACTGAGGGTGG - Intronic
1075348096 10:121699151-121699173 CCACCCTCTCAGCCTGACGGAGG - Intergenic
1076188569 10:128467179-128467201 CCACCCGCTCGGACTTGGGCTGG + Intergenic
1076825365 10:132964593-132964615 CCACCCACCCAGCCTGGGCCAGG + Intergenic
1081657184 11:44865018-44865040 CCAACCACCCCGGCTGAGGCTGG - Intronic
1082035028 11:47638432-47638454 CTAGCTACTCAGGCTGAGGCAGG + Intronic
1082047714 11:47743668-47743690 CTACCCACCCACACAGAGGCTGG + Intronic
1082056335 11:47820489-47820511 GCACCCTATTAGACTGAGGCAGG - Intronic
1082846475 11:57729990-57730012 CCAGCTACTAAGACTGAGGCAGG + Intronic
1083228003 11:61296501-61296523 CCAGCTACTCAGGTTGAGGCAGG + Intergenic
1083920577 11:65779925-65779947 CCAGCCACTCAGCCTGTTGCTGG - Exonic
1083985955 11:66215486-66215508 CCAGCTACTGAGGCTGAGGCGGG + Intronic
1083989728 11:66239406-66239428 CTAGCTACTCAGGCTGAGGCAGG + Intronic
1084291458 11:68172342-68172364 CCAGCTACTTAGGCTGAGGCAGG - Intronic
1084420868 11:69059861-69059883 ACAACCACTCAGCCAGAGGCAGG - Intronic
1085273005 11:75281386-75281408 ACGGCCACCCAGACTGAGGCAGG - Intronic
1085388578 11:76170908-76170930 CCATCCACGGTGACTGAGGCTGG - Intergenic
1085702539 11:78757740-78757762 CCACACGCTTACACTGAGGCTGG - Intronic
1086727994 11:90212744-90212766 GCAGCTACTCAGGCTGAGGCAGG - Intronic
1087525807 11:99311041-99311063 CCAGCTGCTCAGGCTGAGGCAGG - Intronic
1089371047 11:117957876-117957898 GTACCCACCCAGACTGAGGGTGG + Intergenic
1089617149 11:119701354-119701376 CCACCAACTCTGAATGAGGTGGG + Intronic
1090229651 11:125092464-125092486 GCCACCACTAAGACTGAGGCTGG + Intergenic
1091737696 12:2936635-2936657 CCAGCTACTCAGGCTGAGGCAGG + Intronic
1093952773 12:25182495-25182517 CCAGCTACTCAGGCTGAGGTGGG + Intronic
1093981257 12:25478073-25478095 CCACCCACCCAGATTAAGGGTGG + Intronic
1094371281 12:29740269-29740291 CCACCCACACAGACTCACCCAGG - Intronic
1094544317 12:31390522-31390544 CCAGCTACTCAGGCTGAGGCAGG + Intronic
1094813398 12:34163020-34163042 CCCCCCACTCAGACCCAGGTGGG + Intergenic
1095179043 12:39125917-39125939 CAACACAGACAGACTGAGGCAGG - Intergenic
1095763605 12:45869129-45869151 CCAGCTACTCAGGCTGAGGCAGG - Intronic
1095766222 12:45898800-45898822 CCAGCTACTCAGGCTGAGGCAGG + Intronic
1096048341 12:48584503-48584525 CCATCCACTATCACTGAGGCAGG - Intergenic
1096776203 12:53965902-53965924 CCGCCCACCCAGACTGCTGCAGG - Intergenic
1097217008 12:57421979-57422001 CCAGCTACTCAGGATGAGGCAGG + Intronic
1097553345 12:61104347-61104369 ACACCCACTTCCACTGAGGCTGG + Intergenic
1098021248 12:66158522-66158544 CCAGCTACTCGGGCTGAGGCAGG + Intronic
1098107248 12:67082330-67082352 GCACCCACTCAAACCAAGGCAGG + Intergenic
1099982692 12:89625152-89625174 CCAGCTACTCAGGCTGAGGCAGG + Intronic
1100459897 12:94789142-94789164 CCAGCTACTCAGGCTGAGGCAGG - Intergenic
1101581009 12:106040633-106040655 CCACCCACTCAGCAGGGGGCAGG + Intergenic
1101982765 12:109421935-109421957 CTAGCTACTCAGACTGAGGCAGG - Intronic
1102497806 12:113331437-113331459 GCACCCACCCAGATTGAGGGTGG - Intronic
1102974503 12:117196728-117196750 CCAGCTACAGAGACTGAGGCAGG - Intergenic
1103221337 12:119248313-119248335 CTACTCGCTAAGACTGAGGCAGG + Intergenic
1103555980 12:121766688-121766710 CCAGCCACCCAGACTGAGTGTGG + Intronic
1103614025 12:122141069-122141091 CCACTCACTCGGCCTGAGGATGG - Exonic
1103662561 12:122532961-122532983 CCAGCTACTCAGGCTGAGGCAGG + Intronic
1103723229 12:122985761-122985783 CCTCCCACTCAGACTGGCCCGGG - Exonic
1104849698 12:131866401-131866423 CCAACTACTCAGGCTGAGGCAGG + Intergenic
1105635592 13:22212493-22212515 CCAGCTACTCAGGCTGAGGCGGG + Intergenic
1106211563 13:27652753-27652775 CCAGCTACTCAGGCTGAGGCAGG + Intronic
1106379003 13:29218003-29218025 CCAGCTACTGAGGCTGAGGCAGG + Intronic
1108255431 13:48605086-48605108 TCAGCTACTCAGGCTGAGGCAGG + Intergenic
1109713130 13:66184671-66184693 GCGCCCACTCAGATTGAGGGTGG + Intergenic
1109928628 13:69183286-69183308 CTTCCTCCTCAGACTGAGGCAGG + Intergenic
1111261768 13:85749742-85749764 GCACCCACCCAGATTGAGGATGG + Intergenic
1111966355 13:94866014-94866036 CCACCCACACAAGCTAAGGCAGG + Intergenic
1114481015 14:23034571-23034593 CCACCAACCCAGGCGGAGGCTGG - Intronic
1114619401 14:24086100-24086122 CCAGCTACTCCTACTGAGGCAGG + Intronic
1114690564 14:24576168-24576190 CTACCCACTGGGGCTGAGGCAGG - Exonic
1116081283 14:40175797-40175819 CCAGCTACTCAGGCTGAGGTGGG - Intergenic
1117156291 14:52945360-52945382 CCAGCTACTCAGGCTGAGCCAGG - Intronic
1117930758 14:60838657-60838679 CCACCATCTCAGAATGGGGCGGG - Intronic
1118207835 14:63739564-63739586 CCAGCTACTGAGGCTGAGGCAGG + Intergenic
1118281503 14:64433231-64433253 CCAGCTATTCAGGCTGAGGCAGG - Intronic
1118328447 14:64797353-64797375 CCAGCTACTGAGACTGAGGTGGG + Intronic
1118735965 14:68702249-68702271 GTACCCACGGAGACTGAGGCTGG - Intronic
1119192502 14:72692725-72692747 CCAGCCACTCAGACTGGGTTGGG - Intronic
1119257294 14:73209193-73209215 CCACCAACTCAGAAGGGGGCAGG + Intronic
1119291834 14:73501499-73501521 CCAGCTACTCAGGCTGAGGCAGG - Intronic
1119447882 14:74681656-74681678 CCAGCTACTCAGCGTGAGGCAGG + Intronic
1120347925 14:83313980-83314002 CCAGCTACTCAGTCTGAGGCAGG - Intergenic
1120884126 14:89438873-89438895 CCAGCTACTCAAGCTGAGGCAGG - Intronic
1121217438 14:92259447-92259469 CCTCCCAGTCAGAGGGAGGCTGG - Intergenic
1122253283 14:100456230-100456252 CCAGCCACTCAGGCTGAGACGGG + Intronic
1122462996 14:101911161-101911183 CCAGCTACTCGGGCTGAGGCAGG + Intronic
1122721846 14:103726664-103726686 GCACCCAAGCAGCCTGAGGCAGG - Intronic
1123030393 14:105448734-105448756 CCAACAGCTAAGACTGAGGCTGG - Intronic
1123110265 14:105863924-105863946 GGACCCTCTCAGACTGAGCCCGG + Intergenic
1123697300 15:22888367-22888389 CCACCCACTCAAGAAGAGGCTGG - Intronic
1124016257 15:25878362-25878384 CCAGCTACTTAGGCTGAGGCAGG + Intergenic
1124933392 15:34146058-34146080 CCAGCTACTCAGGCTGAGGCAGG - Intronic
1125934638 15:43624538-43624560 CCAGCTACTGAGGCTGAGGCAGG - Intergenic
1126096626 15:45095043-45095065 CCAGCCACTCAAACTGACGCTGG + Exonic
1126108770 15:45163558-45163580 CCAGCCACTCAAACTGACGCTGG - Exonic
1126488308 15:49207885-49207907 CTAGCTACTCAGGCTGAGGCAGG - Intronic
1126829360 15:52584254-52584276 CCAGCTACTCAAGCTGAGGCAGG - Intronic
1127531064 15:59843905-59843927 CCACCCAGTCAGAGGGAAGCTGG - Intergenic
1128229607 15:66025370-66025392 CCCCTCAGTCAGCCTGAGGCAGG + Intronic
1128890366 15:71326560-71326582 CCAGCTACTCAGGATGAGGCAGG + Intronic
1129329490 15:74819826-74819848 CCTCACACTCAGTCAGAGGCAGG - Intronic
1129674529 15:77625172-77625194 ACAGCCTCACAGACTGAGGCTGG + Intronic
1129678949 15:77647142-77647164 ACACGCACTCCCACTGAGGCTGG + Intronic
1129784080 15:78296618-78296640 CCAGCCACTCGGGCTGAGGTGGG - Intronic
1129824707 15:78627057-78627079 CCACCCTTTCTGACTGAGCCAGG - Intronic
1130049886 15:80475117-80475139 CAAACCACTCTGACTGGGGCTGG - Exonic
1130565799 15:84993774-84993796 CCAGCTACTTAGACTGAGGTGGG + Intronic
1132285360 15:100658540-100658562 AAACCCACCCAGCCTGAGGCAGG - Intergenic
1132313015 15:100870851-100870873 CAAGCCACTCAGCCTGAGTCAGG + Intergenic
1132907640 16:2291212-2291234 CCAGCTACTGAGGCTGAGGCAGG + Intronic
1133054696 16:3139853-3139875 CCAGCTACTCAGGCTGAGGCAGG - Intronic
1133394523 16:5435570-5435592 CCACCCACTGAGACACAGGTGGG + Intergenic
1133440581 16:5817803-5817825 CCAGCTACTGAGGCTGAGGCAGG - Intergenic
1133735370 16:8610994-8611016 CCACAGAATCAGACTGAGGATGG + Intergenic
1133876642 16:9741012-9741034 CCACCCACTCAAGCTGACCCTGG + Intergenic
1134107910 16:11497186-11497208 CAACCCACACACACTGAAGCAGG - Intronic
1134257308 16:12622862-12622884 CCAGCTACTCAGGCTGAGGCAGG - Intergenic
1134680807 16:16123903-16123925 GCAGCTACTCAGGCTGAGGCAGG + Intronic
1135627122 16:24005723-24005745 CCTGCCACTCACACTGAGGCAGG - Intronic
1138707040 16:58926123-58926145 CAACCCACTTACACTGAGGAAGG + Intergenic
1139677341 16:68533285-68533307 CCAGCTACTCAGGCTGAGGCAGG - Intronic
1139697771 16:68687452-68687474 CCACCCAGTCAGCCTCAGGGGGG - Intronic
1139916083 16:70429243-70429265 CTCCCCACTCAGGCTGTGGCGGG + Intronic
1140760606 16:78105345-78105367 CTAGCTACTCAGGCTGAGGCGGG + Intronic
1140806881 16:78540796-78540818 CCATCTACTCAGGCTGAGGTGGG - Intronic
1141097904 16:81175807-81175829 CAACCCACTCAGGTAGAGGCTGG + Intergenic
1141122881 16:81375446-81375468 CCAGCTACTCAGGCTGAGGTGGG - Intronic
1141615052 16:85205696-85205718 ACACCCACTCACACTGAGGAGGG - Intergenic
1141904283 16:87013303-87013325 CCACACACGCAGGCTGCGGCGGG + Intergenic
1142046087 16:87926106-87926128 CCAGTTACTCAGGCTGAGGCAGG + Intronic
1142870163 17:2814752-2814774 CCACCCTCTCAGAATGAGCTGGG - Intronic
1143049436 17:4111919-4111941 CCAGCTACTGAGACTGAGGCAGG + Intronic
1143049641 17:4113855-4113877 CCAGCGACTGAGACTGAGGCAGG + Intronic
1143057440 17:4172969-4172991 CCAGATACTCAGGCTGAGGCAGG - Intronic
1143062841 17:4217433-4217455 CCAGCTACTCGGGCTGAGGCAGG + Intronic
1143178084 17:4967966-4967988 CCGCCCCCGCAGACAGAGGCCGG + Intergenic
1143485638 17:7252179-7252201 CCGCCCACGCAGTTTGAGGCGGG - Intronic
1143723939 17:8832778-8832800 CCAGGCACCCAGACAGAGGCAGG + Intronic
1143815775 17:9513249-9513271 CCAGCTACTCAGGCTGAGGTGGG + Intronic
1144299313 17:13908773-13908795 CCAGCTACTCAGGCTGAGGCAGG + Intergenic
1144726604 17:17505532-17505554 CCACACAGACAGACAGAGGCTGG + Intergenic
1146095019 17:29921686-29921708 CCAGCTACTCCTACTGAGGCAGG - Intronic
1146114757 17:30125082-30125104 CCAGCTACTCAGGCTGAGGCAGG + Intronic
1146379467 17:32318102-32318124 CTAGCTACTTAGACTGAGGCAGG + Intronic
1146410456 17:32579180-32579202 CCAGCTACTCAGGCTGAGGCAGG - Intronic
1146422291 17:32699077-32699099 CCAGCTATTCAGGCTGAGGCAGG - Intronic
1146937885 17:36823941-36823963 CCACCCTCTCTGGCTGAGGCTGG - Intergenic
1147417764 17:40306009-40306031 CCAGCTACTCAGGATGAGGCAGG - Intergenic
1147790831 17:43013525-43013547 CTCCTCACTCAGCCTGAGGCTGG - Exonic
1148134629 17:45284367-45284389 CTGCCCACTCCCACTGAGGCTGG + Intronic
1148450359 17:47773712-47773734 CACCCAACACAGACTGAGGCAGG - Intergenic
1148911509 17:50945412-50945434 CTAGCTACTCAGGCTGAGGCAGG - Intergenic
1149005190 17:51797737-51797759 CCAGCTACTCAGGCTGAGGCAGG + Intronic
1149459957 17:56820440-56820462 CCACCCACACACACTCACGCGGG + Intronic
1149695806 17:58615276-58615298 CCACCCACCCACACTGCAGCAGG - Exonic
1149770708 17:59318684-59318706 GTACCCACCCAGACTGAGGGTGG - Intergenic
1150702604 17:67460854-67460876 CCAGCTACTGAGGCTGAGGCAGG - Intronic
1151614824 17:75202925-75202947 CCAGCTACTGAGGCTGAGGCAGG - Intergenic
1151881351 17:76897028-76897050 CCAGCTACTCAGATTGAGGCAGG - Intronic
1152622246 17:81370859-81370881 CCAGCTACTCGGGCTGAGGCAGG + Intergenic
1154510576 18:15096774-15096796 CCATCCAGTCAGACTGAGGCTGG + Intergenic
1155464109 18:26116552-26116574 CCAGCTACTTAGGCTGAGGCAGG - Intergenic
1156196164 18:34776454-34776476 CCAGCTACTCAGGCTGATGCAGG - Intronic
1156390063 18:36641839-36641861 CCAGCTACTGAGGCTGAGGCAGG + Intronic
1156565459 18:38184103-38184125 CCAGCTACTCAGGCTGAGGCAGG - Intergenic
1157644612 18:49255264-49255286 CCACATGCCCAGACTGAGGCAGG + Intronic
1158743439 18:60169266-60169288 CCAGCTACTCAGGCTGAGGCAGG - Intergenic
1159234320 18:65651401-65651423 ACACCCACTCACACTGAGAAGGG - Intergenic
1159987909 18:74866899-74866921 CCAGCTACTCCGGCTGAGGCTGG + Intronic
1160279157 18:77471095-77471117 CCACCCAACCAGCCTGTGGCCGG + Intergenic
1160439700 18:78879794-78879816 CCAGACACTCAGGCTGAGTCAGG + Intergenic
1161254195 19:3297740-3297762 CCAGCTACTCAGGCTGAGACAGG - Intergenic
1161575754 19:5053371-5053393 CCAGCCACACACACTGAGCCAGG + Intronic
1162048829 19:8019672-8019694 CCAGCTACTCAGGCTGAGGCAGG + Intronic
1162504324 19:11073986-11074008 CCAGCTACTGAGGCTGAGGCAGG + Intergenic
1162581541 19:11534186-11534208 CCACCCACTCACAGTCAGTCTGG + Intergenic
1162654897 19:12121210-12121232 CCAGACACTCAGGCTGAGGCAGG - Intronic
1162979612 19:14230212-14230234 CCACCTACTCAGGAGGAGGCAGG + Intergenic
1163021051 19:14480897-14480919 TCACCCACTGAGCCTGAGCCAGG + Intronic
1164899523 19:31906725-31906747 CCATCCACCCAGACAGAGCCAGG - Intergenic
1165284167 19:34825425-34825447 CCACCTTCTCTGACTGAGGCCGG + Intergenic
1165925543 19:39323939-39323961 CCAGCTACTCAGGCTGAGGTAGG - Intergenic
1166058531 19:40309301-40309323 CCAGCTACTCAGGCTGAAGCAGG - Intergenic
1166704601 19:44901623-44901645 CCAACTACTGAGGCTGAGGCGGG + Intronic
1167109804 19:47453376-47453398 CTGCCTGCTCAGACTGAGGCAGG + Intronic
1167274678 19:48529694-48529716 CCAGCTACTCAGGCTGAGGCAGG + Intergenic
1167550948 19:50160592-50160614 CCAGCTACTCAGGCTGAGGCAGG - Intronic
1167847261 19:52174655-52174677 CCATCTACTCAGACTGAGGCAGG + Intergenic
1167918001 19:52757898-52757920 CCAGCTACTCTGGCTGAGGCAGG - Intergenic
1168281042 19:55305445-55305467 CCACCCCCTCCCACTCAGGCTGG + Exonic
925894976 2:8464072-8464094 CCTCCTACTCAGACATAGGCCGG + Intergenic
926578480 2:14608806-14608828 CCACCTACTTGGGCTGAGGCAGG + Intergenic
926756654 2:16241873-16241895 CCACCCACACAGAATGAAGAGGG - Intergenic
927110534 2:19861145-19861167 CCACAAACTCAGAGGGAGGCTGG + Intergenic
927728846 2:25451910-25451932 GCACCCACAAAGTCTGAGGCAGG + Intronic
928020984 2:27704567-27704589 CCAGCTACTCAGGCTGAAGCAGG + Intergenic
928198475 2:29231678-29231700 CCACACAATCAGACTGTGGGAGG - Intronic
929949082 2:46392790-46392812 GCAGCCACTCAGGTTGAGGCTGG - Intergenic
931369801 2:61651433-61651455 CCAGCTGCTCAGGCTGAGGCAGG + Intergenic
931502392 2:62883596-62883618 CCAGCTACTCATATTGAGGCTGG + Intronic
932336851 2:70936437-70936459 CCAAGCACTCAGAGTCAGGCGGG + Intronic
932573729 2:72951453-72951475 CCCCCCACCCACAGTGAGGCAGG - Intronic
932580028 2:72987222-72987244 CCAGCTACTCAGGCCGAGGCAGG - Intronic
933042468 2:77487176-77487198 CCACCAACTCAGAAGGGGGCGGG - Intronic
933724722 2:85420224-85420246 CCAGCTACTGAGGCTGAGGCAGG - Intronic
933982088 2:87558907-87558929 CCGACCACACAGAGTGAGGCTGG + Intergenic
935189236 2:100762689-100762711 CCAGCTACTGAGACTGAGGTGGG - Intergenic
935649289 2:105368441-105368463 CCAGCTACTCAGGTTGAGGCAGG - Intronic
935882927 2:107584437-107584459 CTGCCCACCCAGACTGAGGGTGG + Intergenic
936311749 2:111391905-111391927 CCGACCACACAGAGTGAGGCTGG - Intergenic
938505792 2:131881221-131881243 CCATCCAGTCAGACTGAGGCTGG + Intergenic
939945897 2:148410539-148410561 CCACTCAGTGGGACTGAGGCAGG - Intronic
940265103 2:151828227-151828249 CCTCCCCCTCAGCCTGAGCCGGG - Exonic
940479752 2:154213193-154213215 CCAGCCACTGAGGCTGAGGTTGG - Intronic
941278817 2:163524586-163524608 ACACCCACTAAGACTGAATCAGG - Intergenic
941788028 2:169520267-169520289 ACACACACACACACTGAGGCAGG - Intronic
942327327 2:174787105-174787127 CCAGCTACTCAGGCTGAGGCAGG - Intergenic
942427252 2:175873117-175873139 CCTCCCACTCTGGCTGATGCTGG - Intergenic
943636250 2:190309977-190309999 GTGCCCACTCAGACTGAGGGTGG - Intronic
944804412 2:203267043-203267065 CCAGCTACTGAGGCTGAGGCAGG + Intronic
944812991 2:203346036-203346058 ACACACACACAAACTGAGGCAGG + Intronic
944832276 2:203545037-203545059 CCAGCTACTGAGGCTGAGGCAGG - Intergenic
945836754 2:214842987-214843009 CCAGCTGCTCAGACTGAGGCAGG + Intergenic
945989319 2:216380446-216380468 CTGCCTACTCAGAGTGAGGCTGG + Intergenic
946096020 2:217274667-217274689 CCACCCACTGAGTGGGAGGCAGG - Intergenic
946245019 2:218382532-218382554 CCACCCAGTGAGATTGAGTCTGG - Intronic
946945360 2:224815919-224815941 CCAGCTACTCAGGCTGAGGTGGG + Intronic
947896751 2:233681417-233681439 CCAGCTACTGAGGCTGAGGCAGG + Intronic
948310048 2:236978474-236978496 CCAGCTACTCAGGCTGAGGCAGG - Intergenic
948855273 2:240727407-240727429 CTCCTTACTCAGACTGAGGCTGG - Intronic
948908381 2:240990889-240990911 TCAGGCACTCAGAATGAGGCTGG - Intronic
1170546174 20:17437220-17437242 CCACCCACTCAGTCGTTGGCTGG + Intronic
1170582151 20:17707269-17707291 CCAGCTACTGAGGCTGAGGCAGG + Intronic
1171485299 20:25481529-25481551 CCCCCAAGTCTGACTGAGGCAGG - Intronic
1172301748 20:33855319-33855341 CCACCCGCTCAGCCTGCAGCTGG + Intergenic
1172882018 20:38208253-38208275 CCACGCAGTCAGGCAGAGGCAGG + Intergenic
1172888722 20:38248808-38248830 CCAGCTACTCGGGCTGAGGCAGG - Intronic
1173624572 20:44463003-44463025 CCAGCTACTAAGGCTGAGGCAGG - Intronic
1174456260 20:50650759-50650781 CCACTCACTGAGACTGGGGAAGG - Intronic
1176787292 21:13272636-13272658 CCATCCAGTCAGACTGAGGCTGG - Intergenic
1177325845 21:19587689-19587711 GTGCCCACTCAGACTGAGGGTGG - Intergenic
1177533030 21:22388159-22388181 GCGCCCACCTAGACTGAGGCTGG - Intergenic
1177986452 21:27981130-27981152 CCATCCAGTCAGACTGAGGCTGG - Intergenic
1178806964 21:35847235-35847257 ACACCCACTCACATTGAGGGTGG - Intronic
1178850512 21:36208815-36208837 CCCACCACGAAGACTGAGGCAGG - Exonic
1179224781 21:39443917-39443939 CCAGCTACTCAGGCCGAGGCAGG + Intronic
1179641763 21:42752381-42752403 CCACCTACTCAGGCTGAGGCAGG - Intronic
1179889307 21:44327611-44327633 ACCCCCACTCAGGCTGAGGTTGG - Intergenic
1179891146 21:44335635-44335657 CCTCCAACACAGACTGAGGGCGG - Intronic
1179930609 21:44568683-44568705 CCAGCCACTCAGCCTGGGCCAGG - Intronic
1179941871 21:44645465-44645487 CCAGCTACTTAGGCTGAGGCAGG - Intronic
1181743777 22:24941779-24941801 CCAGCTACTCAGGCTGAGGCAGG - Intronic
1182054498 22:27339388-27339410 TCACCCCCACACACTGAGGCAGG + Intergenic
1183046704 22:35226330-35226352 CCACAGAATCAGACTGAAGCTGG + Intergenic
1183916430 22:41124131-41124153 CCAGCTACTCAGGCTGAGGCAGG + Intronic
1184253634 22:43274981-43275003 CCACCGACTCAAACTTAGTCTGG + Intronic
1184520754 22:44992618-44992640 CCACCAACTCAGCCTGAGGCCGG + Intronic
1185032734 22:48453205-48453227 CCACCCACCCAGCCTGAGGGAGG - Intergenic
1185040919 22:48503954-48503976 CCACACACTCACACTCAGGTGGG + Intronic
950084453 3:10247805-10247827 CCAGCTACTCAGGCTGAGGTGGG - Intergenic
951652723 3:24968801-24968823 CTACCCACTCACACTGACTCTGG - Intergenic
952384041 3:32826324-32826346 CCAGCTACTGAGGCTGAGGCAGG + Intronic
953306688 3:41837673-41837695 CCAACTACTCAGGCTGAGGCAGG - Intronic
953808746 3:46094110-46094132 CCATCTAGTCAGACTGAGGTTGG + Intergenic
954082301 3:48219782-48219804 TCACCCACAGAGACAGAGGCTGG + Intergenic
955978380 3:64499519-64499541 GTGCCCACTCAGACTGAGGGAGG + Intergenic
955991306 3:64630463-64630485 CCAGCTACTCAGGCTGAGGTGGG + Intronic
956785098 3:72636074-72636096 CCAGCTACTAAGGCTGAGGCAGG - Intergenic
957242345 3:77675170-77675192 GCGCCCACCCAGACTGAGGGTGG - Intergenic
957255338 3:77828473-77828495 CCACCCATCCAGTCTGAGCCTGG + Intergenic
958840255 3:99195217-99195239 CAACCTACTCAGGCTGAAGCAGG + Intergenic
959061248 3:101618398-101618420 CCACCCAAACAGACTAAGACAGG - Intergenic
959282522 3:104362868-104362890 CCGCCCACCCAGATTGAGGGTGG + Intergenic
959699990 3:109289578-109289600 CCAGCCACTCAGGCTGAGGCAGG + Intergenic
959967877 3:112376693-112376715 GCACCCACTCAGATTGAGGGTGG + Intergenic
960318932 3:116210313-116210335 GTGCCCACTCAGACTGAGGATGG - Intronic
961571125 3:127799464-127799486 TCACCCACTCTGAGGGAGGCAGG - Intronic
961715485 3:128854436-128854458 TCACAGACACAGACTGAGGCTGG + Intergenic
961757149 3:129135230-129135252 CCAGCTACTCAGGCTGTGGCAGG + Intronic
961811101 3:129522285-129522307 TCACAGACGCAGACTGAGGCTGG - Intergenic
962821131 3:139047897-139047919 TCACCCAATCAGACTGTGGCCGG - Intronic
962895311 3:139708681-139708703 CCTCCCACCCAGGCTGTGGCTGG + Intergenic
963211919 3:142702166-142702188 CCAGCTACTTAGGCTGAGGCAGG - Intronic
963769942 3:149379204-149379226 CCACCTGCTCAGGCGGAGGCAGG + Intergenic
964791913 3:160460571-160460593 CCACCAACTCAGAAGGAGGGGGG + Intronic
965229351 3:166029901-166029923 CCACCAACTCAGAAGGAGGCGGG + Intergenic
966588044 3:181649668-181649690 CCAGCTACTGAGGCTGAGGCAGG - Intergenic
966590183 3:181673917-181673939 CCAGCTACTTAGGCTGAGGCAGG + Intergenic
966608107 3:181842179-181842201 CCAGCTACTCAGGCTGAGGTGGG + Intergenic
968438972 4:612040-612062 CCACCTCATCAGAGTGAGGCAGG - Intergenic
968588206 4:1443848-1443870 CCAGCTACTCAGGCTGAGGTGGG - Intergenic
968782271 4:2592201-2592223 CCAGCTACTCAAGCTGAGGCAGG - Intronic
969185183 4:5469363-5469385 CCAACCACCCAGGCTGAGCCAGG - Intronic
969405988 4:6992124-6992146 CAGCCCACTCAGGGTGAGGCAGG + Intronic
970610073 4:17716922-17716944 CCAGCTACTCAGACTGAGGCAGG - Intronic
970888612 4:21016408-21016430 CCAGCTACTCAGGATGAGGCAGG - Intronic
971043949 4:22784002-22784024 GCGCCCACCTAGACTGAGGCTGG - Intergenic
971156248 4:24086339-24086361 CCAGCCATTCAGGGTGAGGCAGG - Intergenic
972102289 4:35436058-35436080 CCAGCTACTCAGAATGAGGCAGG + Intergenic
972143844 4:35996670-35996692 CCAGCTACTCAGACTGAGGAAGG + Intronic
973738613 4:53897781-53897803 CCAGCTACTCAGGCTGAAGCAGG + Intronic
974478751 4:62418348-62418370 GTGCCCACTCAGACTGAGGGTGG + Intergenic
975141575 4:70923833-70923855 CCACCTACTCAGGCTGAGGCAGG + Intronic
975512735 4:75211519-75211541 ACTCCCACTTAGGCTGAGGCTGG - Intergenic
976519405 4:86008706-86008728 CCAGCTACTCAGGCTGAGGCAGG - Intergenic
976753148 4:88471081-88471103 CCAGCTACTCAGGCTGAGGTGGG - Intronic
976817204 4:89162852-89162874 CCACCGACACAGAATCAGGCTGG - Intergenic
977603515 4:98959073-98959095 CCACCTACTCGGGCTGAGGAAGG - Intergenic
978062597 4:104356298-104356320 GCACCCACTCAGATTAAGGGTGG - Intergenic
979251144 4:118567713-118567735 CCGGCCACTGGGACTGAGGCAGG + Intergenic
980282162 4:130736534-130736556 CCACCAACTCAGTAAGAGGCAGG - Intergenic
980622061 4:135320491-135320513 CCACCCACTGAGACACAAGCAGG - Intergenic
982004054 4:151047936-151047958 CCAGATACTCAGGCTGAGGCAGG - Intergenic
982676970 4:158387215-158387237 CCACCTACTCAGGCTAAAGCAGG + Intronic
984269974 4:177537781-177537803 CCAGCTACTCAGGCTGAAGCAGG + Intergenic
985519503 5:366729-366751 CCACCCACTCATCCTGTTGCGGG - Intronic
986254300 5:6088933-6088955 GCAACCAATCAGACTGATGCAGG + Intergenic
986258073 5:6118282-6118304 CCACCCACTCAAACTCTAGCAGG + Intergenic
986318249 5:6605807-6605829 ACAGCTACTCAGGCTGAGGCAGG - Intronic
986385191 5:7226389-7226411 ACACCCACCCAGGCTGAAGCTGG - Intergenic
986972851 5:13357166-13357188 CCAGCTACTCAGGCTGAGGCAGG + Intergenic
987062204 5:14253465-14253487 CCAGCTACTCAGGCTGAGGCAGG - Intronic
988277925 5:29106931-29106953 CCAGCCACTGACACTCAGGCTGG + Intergenic
988361835 5:30246372-30246394 CCAGCTACTCCGGCTGAGGCAGG - Intergenic
989708101 5:44362352-44362374 CCAAACACTCAGACCTAGGCAGG + Intronic
991245564 5:64505727-64505749 TCACCAACTGAGACTGAGACAGG - Intergenic
992286240 5:75238128-75238150 CCAGCTACTCAGGTTGAGGCGGG + Intergenic
994106902 5:95959566-95959588 CCTCCCACTCCGTCTGATGCTGG + Intronic
994610939 5:102038297-102038319 CCAGCTACTGAGGCTGAGGCAGG + Intergenic
996306606 5:122054198-122054220 CCACACTCCCAGACTGAGGCAGG - Intronic
997081187 5:130740217-130740239 CCACCCACAGACACTGAGGAGGG + Intergenic
997483155 5:134205045-134205067 CCAGCTACTCAGGCTGAGGTGGG - Intronic
997549654 5:134740706-134740728 CCAGCTACTCTGGCTGAGGCAGG - Intronic
997647684 5:135491841-135491863 CCCCCCACCCAGACGGAGGAGGG - Intergenic
998015424 5:138727838-138727860 GCAGCCACTCAGACTGAGCAAGG - Intronic
998465356 5:142339552-142339574 CCAGCTACTTAGGCTGAGGCAGG - Intergenic
999369464 5:151045202-151045224 CCACCCACTCAGACTGAGGCAGG - Intronic
999442490 5:151613345-151613367 CCACCCACACAGTCTCAGCCTGG + Intergenic
999700005 5:154219299-154219321 GAACCCACTCAGGCTGAGGAGGG - Intronic
1000351080 5:160353488-160353510 CCACCCACTCACACACACGCAGG + Intronic
1000417631 5:160999012-160999034 GCACCCACCCAGACTAAGGGTGG - Intergenic
1001151692 5:169234516-169234538 CCAGCTACTCAGGCTGAGGCTGG - Intronic
1001509600 5:172310340-172310362 CCAGCTACTCAGGCTGAGGCAGG + Intergenic
1001830297 5:174781317-174781339 CCAGCTACTCGGGCTGAGGCAGG - Intergenic
1002042541 5:176525129-176525151 CCAGCTACTCGGGCTGAGGCAGG + Intergenic
1004144119 6:13048644-13048666 CCAGCTACTGAGGCTGAGGCAGG - Intronic
1004221830 6:13753910-13753932 CCAACTACTCAGGTTGAGGCAGG - Intergenic
1004404937 6:15324065-15324087 CCAGCTACTCAGGCTGAGGCAGG + Intronic
1006179177 6:32143741-32143763 ACACCTACTAAGGCTGAGGCAGG + Intergenic
1006328968 6:33375813-33375835 CCAGCTACTGAGGCTGAGGCAGG - Intergenic
1006402130 6:33823937-33823959 CCACCCACTGAGGCTGAGAGAGG - Intergenic
1006552750 6:34838827-34838849 CCAGCCACTCAGACTGAAGCGGG + Intronic
1006557348 6:34879088-34879110 TCAACTACTCAGACTGAGGCAGG + Intronic
1006685654 6:35831202-35831224 CCAACTACTCAGGCTGAGGCAGG - Intronic
1008457933 6:51733423-51733445 CCAGCTACTGAGGCTGAGGCAGG + Intronic
1008471368 6:51888975-51888997 ACAACCACTCAGACTGAGAGAGG - Intronic
1008954632 6:57201193-57201215 TCAGCTACTCAGGCTGAGGCAGG - Intronic
1011847184 6:91580620-91580642 ACACCCACCCAGATTGAGGGTGG + Intergenic
1011897592 6:92250926-92250948 TCACCAACACATACTGAGGCAGG - Intergenic
1012262151 6:97100028-97100050 CCAGCTACTCAGGCTGAGGTAGG + Intronic
1012487425 6:99737668-99737690 CCACCCACTCAGAGAGAGTTAGG + Intergenic
1012577407 6:100819755-100819777 GCACCCACCCCGACTGAGGGTGG + Intronic
1012995829 6:105973070-105973092 GCACCCACTCACACTGAGGAGGG - Intergenic
1013236535 6:108201617-108201639 CCAGCTACTCAGGCTGAGGCAGG + Intergenic
1013695431 6:112697450-112697472 GCACCCACCCAGATTGAGGGTGG + Intergenic
1014515574 6:122374448-122374470 CCACCCCCTGAGACTAAGTCAGG + Intergenic
1015499075 6:133911660-133911682 CCAGCTACTCAGGATGAGGCAGG + Intergenic
1015941483 6:138456993-138457015 CCAGCTACTCAGGCTGAGGCAGG - Intronic
1017031096 6:150222881-150222903 CCAGCTACTGAGACTGAGGTAGG - Intronic
1017963777 6:159246261-159246283 CCACCCACTCTCACTGACTCAGG - Intronic
1018729980 6:166641606-166641628 CCAGCTACACGGACTGAGGCAGG + Intronic
1019441987 7:1052196-1052218 TCACCCACTCAGCCTGGAGCAGG - Intronic
1019661544 7:2226873-2226895 CCAGCTACTCAGGCTGAGGCAGG + Intronic
1019921691 7:4167273-4167295 CCAGCTACTCAGGCTGAGGTAGG + Intronic
1021216981 7:17928246-17928268 CCAGCTACTCAGACTGAGGCAGG + Intronic
1021893478 7:25211013-25211035 CAACCTACTAAGACTGAGTCAGG - Intergenic
1022015600 7:26346139-26346161 CCAGCCAGTCAGGCTGGGGCTGG - Intronic
1022133541 7:27425829-27425851 CCACCCACTCAGACCCTGGAGGG + Intergenic
1022344509 7:29501378-29501400 CCAACCACTCATCCAGAGGCAGG - Intronic
1023595443 7:41824837-41824859 TCAGCTACTCAGGCTGAGGCAGG - Intergenic
1023967530 7:44970707-44970729 CCACCCACTCAAACAGCCGCTGG + Exonic
1024904349 7:54359482-54359504 CCACACACCTAGACTGAGGAAGG - Intergenic
1025966194 7:66274251-66274273 CCAGCTACTCAGGCTGAGGCAGG + Intronic
1027247245 7:76375491-76375513 CCCCACACGCAGACGGAGGCAGG + Intergenic
1027269136 7:76510723-76510745 CCACTCACCCAGGCTCAGGCTGG - Exonic
1027807853 7:82852354-82852376 GTACCCACCCAGACTGAGGGTGG - Intronic
1029176319 7:98667195-98667217 CCAGCTACCCAGGCTGAGGCAGG + Intergenic
1029241669 7:99167562-99167584 CCAGCTACTTAGGCTGAGGCAGG - Intergenic
1029275471 7:99401438-99401460 CCAAATACTCAGGCTGAGGCAGG - Intronic
1029680403 7:102104778-102104800 CCAGCTACTTAGGCTGAGGCAGG + Intronic
1033351610 7:140566796-140566818 CCAGCTACTCAGGCTGAGACAGG - Intronic
1034058299 7:148059474-148059496 CCAGCTACTCTGGCTGAGGCAGG + Intronic
1034903003 7:154919300-154919322 CCAGCTACTCAGGCTGAGGCAGG + Intergenic
1035358401 7:158293942-158293964 ACACTCACACAGACTCAGGCAGG - Intronic
1036470293 8:9046937-9046959 CCTCCGAATCAGCCTGAGGCTGG + Intronic
1037675964 8:21050945-21050967 CCTGGGACTCAGACTGAGGCCGG - Intergenic
1039470868 8:37813116-37813138 CCAGCCACTCAGGCAGAGGCAGG + Intronic
1039515294 8:38127629-38127651 CCAGCTACTCAGGCTGAGGCAGG + Intronic
1039603290 8:38860046-38860068 CCAGCTACTCAGGCTGAGGCAGG - Intergenic
1041205609 8:55495370-55495392 CCACCCACTCAGAAGGAGCAGGG + Intronic
1041370269 8:57152323-57152345 CCAGCTACTGAGGCTGAGGCAGG - Intergenic
1043148525 8:76683466-76683488 ACACTGACTCAGACAGAGGCAGG + Intronic
1043264110 8:78240955-78240977 CCAGCTACTCAGGCTGAGGCAGG - Intergenic
1044248303 8:89976637-89976659 CCACCCACAGACACTGAGGAGGG - Intronic
1044495190 8:92869324-92869346 CCAGCTACTCGGGCTGAGGCAGG + Intergenic
1044581138 8:93827473-93827495 CCACCCTCCCAGGCTGAGCCTGG - Intergenic
1045887921 8:107122516-107122538 CCTCCCACTCAGAAAGGGGCGGG - Intergenic
1046650851 8:116835215-116835237 CCACCCTCTCATACTGAGTCTGG + Intronic
1047929521 8:129712939-129712961 CAACACATTCAGACTGAAGCTGG + Intergenic
1048423317 8:134298459-134298481 CAACACAGTCAGGCTGAGGCTGG + Intergenic
1048601420 8:135922664-135922686 GCACCCACCAAGACTGAGGGTGG - Intergenic
1049281286 8:141747363-141747385 CCAGCTACTCAGGTTGAGGCAGG - Intergenic
1049647756 8:143743347-143743369 CCAGCTACTCAGGCTGAGGCAGG - Intergenic
1049724668 8:144140156-144140178 GCACCCACTCAATCTGAGACTGG - Exonic
1049977188 9:871146-871168 CCAGCTACTCAGGCTGAGGTAGG - Intronic
1050908317 9:11034208-11034230 CCAGCTACTCATGCTGAGGCAGG - Intergenic
1051655090 9:19372749-19372771 CCAGCTACTCAGGCTGAGGCAGG + Exonic
1052332426 9:27283355-27283377 CTAGCTACTCAGGCTGAGGCAGG - Intergenic
1053221578 9:36317376-36317398 CCAGCTACTCAGGCTGAGGCAGG - Intergenic
1056733928 9:89188834-89188856 CCACCCACACCTACTGAGTCAGG - Intergenic
1056820315 9:89836954-89836976 CCACCCACCCCGCCAGAGGCAGG - Intergenic
1058386691 9:104444715-104444737 GTACCCACCCAGACTGAGGGTGG - Intergenic
1058710757 9:107677147-107677169 CCAGCTACTCAGGCTAAGGCAGG - Intergenic
1058807513 9:108606615-108606637 CCATTCACTCACACCGAGGCAGG + Intergenic
1060021136 9:120132234-120132256 CCACCCACTGAGACAGAGCTGGG - Intergenic
1060958391 9:127661242-127661264 CCACCCTCTCAGAATAAGACAGG - Intronic
1061661483 9:132133199-132133221 CCACCAAATCAGACTGAATCAGG + Intergenic
1062045829 9:134424061-134424083 CACCCCACACAGGCTGAGGCTGG - Intronic
1062105941 9:134754840-134754862 CCACCCAGACAGGCTGGGGCAGG + Intronic
1062617966 9:137406743-137406765 CCGCCCACTGAGGCTGTGGCCGG - Intronic
1062732241 9:138116668-138116690 GCACCCACTCAGACTGGGTCTGG + Intronic
1186207597 X:7216644-7216666 CTGCTCACTCAGACTGAGGATGG + Intergenic
1188012596 X:25073630-25073652 GTGCCCACTCAGACTGAGGGTGG + Intergenic
1188467163 X:30495020-30495042 CCAACCACTGAGACTGAGGTGGG - Intergenic
1189303182 X:39967605-39967627 CCAACACCTCAGACTGAGTCAGG + Intergenic
1189729489 X:44004182-44004204 CCACCCACTCACACTCAGATCGG - Intergenic
1189839749 X:45061996-45062018 CTACCCACTCAAAATGTGGCTGG + Intronic
1190155306 X:47986719-47986741 GTACCCACCCAGACTGAGGGTGG - Intronic
1192422935 X:71050112-71050134 CCGGCTACTCAGGCTGAGGCAGG - Intergenic
1192717401 X:73658968-73658990 CCACCCACAGACACTGAGGAGGG + Intronic
1192952311 X:76029727-76029749 CCTCCCCCTCAGCCTGAGCCCGG + Intergenic
1196558257 X:117117167-117117189 GCACCCACCCAGATTGAGGGTGG + Intergenic
1196759287 X:119186891-119186913 CCTCCCACTCAGCTTGAGACAGG - Intergenic
1197237454 X:124083870-124083892 CCAGCTACTCAGATTAAGGCAGG - Intronic
1199718627 X:150525687-150525709 ACAGCCACTCAGAAGGAGGCAGG - Intergenic
1200227195 X:154424853-154424875 CCAAGCACTCAGGCCGAGGCGGG + Intergenic
1200563804 Y:4739364-4739386 CCAGCTACTCAGGCTGAGGCAGG - Intergenic
1201579428 Y:15495315-15495337 CTGCTCACTCAGACTGAGGATGG + Intergenic