ID: 999369580

View in Genome Browser
Species Human (GRCh38)
Location 5:151045795-151045817
Sequence GCCTTTGTGCTGCTGGTCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 226}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999369572_999369580 4 Left 999369572 5:151045768-151045790 CCTGCCAGAGCCAGGAGGCCAGG 0: 1
1: 0
2: 11
3: 70
4: 641
Right 999369580 5:151045795-151045817 GCCTTTGTGCTGCTGGTCCCGGG 0: 1
1: 0
2: 0
3: 30
4: 226
999369568_999369580 22 Left 999369568 5:151045750-151045772 CCTCATGGTGACCTGGGACCTGC 0: 1
1: 1
2: 1
3: 18
4: 195
Right 999369580 5:151045795-151045817 GCCTTTGTGCTGCTGGTCCCGGG 0: 1
1: 0
2: 0
3: 30
4: 226
999369566_999369580 28 Left 999369566 5:151045744-151045766 CCAACTCCTCATGGTGACCTGGG 0: 1
1: 0
2: 2
3: 10
4: 173
Right 999369580 5:151045795-151045817 GCCTTTGTGCTGCTGGTCCCGGG 0: 1
1: 0
2: 0
3: 30
4: 226
999369576_999369580 -6 Left 999369576 5:151045778-151045800 CCAGGAGGCCAGGGCAAGCCTTT 0: 1
1: 1
2: 2
3: 30
4: 437
Right 999369580 5:151045795-151045817 GCCTTTGTGCTGCTGGTCCCGGG 0: 1
1: 0
2: 0
3: 30
4: 226
999369570_999369580 11 Left 999369570 5:151045761-151045783 CCTGGGACCTGCCAGAGCCAGGA 0: 1
1: 0
2: 5
3: 47
4: 502
Right 999369580 5:151045795-151045817 GCCTTTGTGCTGCTGGTCCCGGG 0: 1
1: 0
2: 0
3: 30
4: 226
999369575_999369580 0 Left 999369575 5:151045772-151045794 CCAGAGCCAGGAGGCCAGGGCAA 0: 1
1: 0
2: 8
3: 45
4: 463
Right 999369580 5:151045795-151045817 GCCTTTGTGCTGCTGGTCCCGGG 0: 1
1: 0
2: 0
3: 30
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999369580 Original CRISPR GCCTTTGTGCTGCTGGTCCC GGG Intronic
900125168 1:1065656-1065678 GTCTTTGTGGTAGTGGTCCCCGG - Intergenic
900572037 1:3363410-3363432 GTCTCTGGGCTGCTGGTCCCTGG + Intronic
900778217 1:4600337-4600359 GCCATTCTGAAGCTGGTCCCAGG - Intergenic
901080486 1:6581091-6581113 GCCTCTGGGCTCCTGATCCCTGG - Exonic
901659117 1:10787689-10787711 GCCTCTTTGCTGATGGTCTCTGG - Intronic
901758395 1:11455268-11455290 GCCGTTATTCTGCTGGCCCCGGG + Intergenic
902393342 1:16118960-16118982 CCCTTTCTCCTGCTGGGCCCGGG - Intergenic
903226525 1:21896922-21896944 GCCTCCGCGCTGCTGGGCCCAGG - Intronic
903259430 1:22123300-22123322 CCCTGTGTACTGGTGGTCCCTGG + Intronic
904213333 1:28900209-28900231 ACCTTTCTGCTGCTAGTCTCTGG - Intronic
906102659 1:43273083-43273105 GGCCTCGTGCTGCTGGTCACCGG + Exonic
908261932 1:62345797-62345819 TGCTTTGTGCTGCTGGGCCTGGG + Intergenic
908329805 1:63060054-63060076 ATCTTTGTGCTTCTGGTGCCTGG - Intergenic
908524610 1:64975882-64975904 TCTTTTCTCCTGCTGGTCCCTGG + Intergenic
915635998 1:157187013-157187035 GCATTTGTGCTGTTGATCCTGGG + Intergenic
916053866 1:161054298-161054320 GCCTTTGGGAGGCTGCTCCCAGG - Intronic
916076142 1:161200962-161200984 GACTTTGGGCTGCTTGGCCCTGG - Intronic
916420380 1:164632469-164632491 GCCTTTCTCCTGCTGGACACAGG + Intronic
917187889 1:172382175-172382197 TTCTTTGTGCTGCTGTTACCTGG - Intronic
917834830 1:178933187-178933209 GCTTTTGTGCTGCAGGTTCTGGG - Intergenic
922857448 1:228787228-228787250 GCCTTCTAGCTGCAGGTCCCAGG + Intergenic
923092317 1:230750035-230750057 GCCTTGGTGGCCCTGGTCCCAGG - Intronic
923198602 1:231690988-231691010 GGCTTGTTGCTTCTGGTCCCCGG + Intronic
924627130 1:245704818-245704840 GCCATTGGGCTGCTGGTTGCTGG + Intronic
1063376679 10:5558347-5558369 GACATGGTGCTGCTGGTTCCGGG - Intergenic
1065131291 10:22622600-22622622 GCCTTTGTGCTGCCGCCCACTGG - Intronic
1066349451 10:34624014-34624036 GTCCTTGCTCTGCTGGTCCCAGG + Intronic
1067134849 10:43598815-43598837 GCTTTTGTGCTGCTGCACCTTGG - Intergenic
1067431187 10:46247159-46247181 GCCTTTGGTGTGCTGGCCCCAGG - Intergenic
1069741900 10:70690224-70690246 GCATTTGTGCTGCTAGTGCCTGG + Intronic
1070564230 10:77591243-77591265 GCCTTTGCCCTGCTGGCACCTGG - Intronic
1070568253 10:77620184-77620206 GCCTTTCTGCCGCTGGTTCTGGG - Intronic
1070994022 10:80759631-80759653 GCCTTTGTGCTGGTGTCCCTTGG + Intergenic
1071738718 10:88332068-88332090 GCGTGTCTACTGCTGGTCCCAGG + Intronic
1072448397 10:95519255-95519277 GCCTGTGTGCTGCTGAAGCCTGG - Intronic
1072620896 10:97078575-97078597 GCCTCTGAGCTGCTGTTCCTTGG - Intronic
1073558619 10:104478421-104478443 ACATTTCTGCTGCTGCTCCCAGG + Intergenic
1074300011 10:112225297-112225319 GCCTGGGAGCTGCTGGTTCCTGG + Intergenic
1074472019 10:113735851-113735873 GCCAATGCGCTGCTGGCCCCTGG - Intergenic
1074983418 10:118637543-118637565 TGCTTTGTTCTGCTGATCCCTGG - Intergenic
1075278975 10:121122487-121122509 CCCTGTGTGATGCTGGTACCAGG + Intergenic
1076411463 10:130254591-130254613 GTCTGTGTGCTGGTGCTCCCAGG + Intergenic
1077074225 11:693001-693023 GGCTTTGGGCGGCTGCTCCCAGG - Intronic
1077349439 11:2085668-2085690 GCCTCTGTGCCTCTGGTCCGGGG + Intergenic
1080384820 11:31805114-31805136 GGCTTTGTGCCGCTCGTTCCCGG - Intronic
1083620774 11:64048348-64048370 GCCTCTGTCCTGCTGACCCCGGG - Intronic
1083925578 11:65804083-65804105 TCATTTGTGCTGCTGGTGACAGG - Intergenic
1084359541 11:68660612-68660634 GCCTTTGGCCTGGAGGTCCCAGG - Intergenic
1084365292 11:68693580-68693602 ACCTTTGTGCTGCTGACCCTGGG - Intergenic
1084501546 11:69538434-69538456 GCCTTGTGGCTGCTGGTCCCTGG - Intergenic
1087994135 11:104782540-104782562 GATGCTGTGCTGCTGGTCCCTGG + Intergenic
1088369005 11:109068003-109068025 ACCTTTGAGCTGCTAGCCCCTGG + Intergenic
1088440804 11:109867867-109867889 GCCTATGTGTTGCTGGTCTCAGG - Intergenic
1089115038 11:116087958-116087980 TCCTGTGTGCTGCTCCTCCCTGG - Intergenic
1089376050 11:117995621-117995643 GCCTTTGTCCTGCTGCTCTCCGG + Exonic
1090351536 11:126111401-126111423 CCCTCTGGGCTGCTGGCCCCGGG + Intergenic
1090748276 11:129724194-129724216 GTGTTTGTGCTGCTGGTGACTGG + Intergenic
1091193317 11:133712146-133712168 GCCTCTGTACAGCTGCTCCCAGG - Intergenic
1096973713 12:55686429-55686451 GCCTCTGTGAAACTGGTCCCAGG - Intronic
1097669156 12:62515450-62515472 CCCTTTGTCCTCCTGGTCCTTGG - Intronic
1097884910 12:64719386-64719408 GCATTTGAGCTGCTGGTGGCAGG - Intronic
1097995354 12:65882168-65882190 GCCTTTCTGCTGCTGGTAGGAGG + Intronic
1100735609 12:97526217-97526239 TCATCTGTGCAGCTGGTCCCTGG + Intergenic
1101866648 12:108525157-108525179 GCCCGTATGCTGCTGGTCACAGG + Intronic
1102236674 12:111298269-111298291 GCCTTTGTCCTGGTAGTGCCTGG - Intronic
1102573805 12:113843589-113843611 GCCCTTTTGCTGCCGGGCCCAGG + Intronic
1102948449 12:117011025-117011047 CCTTTTGTGCTGATGGTTCCTGG - Intronic
1103429886 12:120874563-120874585 GCCTTTGTGCTGCTGTTATCAGG - Intronic
1103874455 12:124116403-124116425 ACCCCTGTGCTGCTGGTGCCTGG + Intronic
1104912850 12:132247953-132247975 GACATTGGGCTGCTGGACCCCGG - Intronic
1104915094 12:132260392-132260414 TGCTTTGTGCTGGTGGCCCCAGG + Intronic
1106652620 13:31708088-31708110 GCCACTGTGCAGCTTGTCCCAGG + Intergenic
1113839148 13:113348738-113348760 GCCCTGGTTCTGCTGGTTCCTGG - Intronic
1113893890 13:113751565-113751587 GCATTCTTGGTGCTGGTCCCAGG + Intergenic
1117339918 14:54784108-54784130 GCCTTTGCACCGCTGTTCCCTGG - Intronic
1117601894 14:57384747-57384769 GTGTCTGTGCTGATGGTCCCTGG - Intergenic
1119615893 14:76099041-76099063 GCCATGGTGCTGCGGGCCCCAGG - Intergenic
1120765590 14:88324154-88324176 GCATCTGCCCTGCTGGTCCCAGG - Intronic
1121087094 14:91154979-91155001 GCCTTGCTCCTGCTGGCCCCTGG + Intronic
1121241943 14:92437275-92437297 GCCTTTGCACTGCTGTTTCCTGG + Intronic
1123934453 15:25187372-25187394 GCCATTGGGTTGCTGGCCCCAGG + Intergenic
1124632050 15:31343543-31343565 GCCTGGGTGCTGATGGGCCCTGG + Intronic
1126679902 15:51192725-51192747 GGCTTTTTACTGCTGGCCCCTGG + Intergenic
1127300083 15:57644317-57644339 ACTTCTGTGCTCCTGGTCCCTGG - Intronic
1129115637 15:73363972-73363994 GACTTCCTGCTGCTGGTCACTGG - Intronic
1129977615 15:79835402-79835424 GCAGGTGTGCAGCTGGTCCCAGG - Intronic
1130204693 15:81865314-81865336 CCCTTTCTGCAGCTGGACCCTGG - Intergenic
1132024439 15:98392856-98392878 CCCTTGATGCTGCTGGTCCCTGG - Intergenic
1132700653 16:1220731-1220753 GCCTTTGAGCCGCTGGACCTCGG + Exonic
1134006669 16:10822650-10822672 TCCTGTGTGCTGCTGGCCCATGG - Intergenic
1134486931 16:14666163-14666185 GCCTTTGTTCTGATGGACCCAGG + Intronic
1134815289 16:17200561-17200583 GCCTTTGTCCTGGTGGTCCACGG - Exonic
1136612538 16:31375381-31375403 GCCTTTGTGCTGCATGTGCAAGG - Intronic
1137593257 16:49706835-49706857 GCCCTTGTGTTGTTGGTGCCCGG - Intronic
1140852957 16:78951836-78951858 GCCTTTGGCATGCTGGTGCCAGG - Intronic
1141523574 16:84597456-84597478 GCTGTGGTGCTGCTGGTCCGAGG - Intronic
1142581888 17:948482-948504 GCCTGTGGGCAGGTGGTCCCAGG - Intronic
1143028453 17:3954234-3954256 GACCTTGTCCAGCTGGTCCCAGG - Intronic
1143994277 17:10993311-10993333 GTCTCTGTGCTGCTCCTCCCAGG + Intergenic
1144638202 17:16924180-16924202 CCCTTCGTGCTGCTGGGCCTTGG + Intergenic
1147131982 17:38415120-38415142 GCCTTTGTTCTCCTGGCTCCGGG + Intergenic
1147565304 17:41532646-41532668 TTCCTTGTGCTGGTGGTCCCTGG - Intergenic
1147609215 17:41791888-41791910 GAGTTTCTGGTGCTGGTCCCTGG - Intergenic
1149355245 17:55832789-55832811 GCCTGTGTTCTGCTAGGCCCTGG + Intronic
1151720043 17:75849838-75849860 GCCATGGGGCTGCTGGACCCTGG - Intronic
1152058651 17:78052066-78052088 GCCCTTGTCCTGCTGGACACAGG - Intronic
1152183024 17:78836499-78836521 TCCTTTGTGCAGCTGATCCAGGG - Intronic
1152325817 17:79635298-79635320 GCCTTTGAGCAGATGGTTCCAGG - Intergenic
1152457619 17:80425311-80425333 GCCTTCCTGCTGCTTGTCCCTGG - Intronic
1152879991 17:82809093-82809115 GCCTTTGTGTTGCTGTACGCAGG + Intronic
1153494087 18:5679806-5679828 GCCTTTGATCTGCTAGTTCCTGG - Intergenic
1155512807 18:26594550-26594572 GCATTTGTGCTGCAGTTACCTGG - Intronic
1156204431 18:34870768-34870790 GCCTTGCTCCTGCTGTTCCCAGG + Intronic
1157384611 18:47250656-47250678 GCCTCTGTCCTGCTGCCCCCTGG + Intergenic
1162344692 19:10112402-10112424 GCCCCTGTGCTGCTGTGCCCTGG + Intronic
1165574175 19:36800048-36800070 GTCTGTCTCCTGCTGGTCCCTGG + Intergenic
1166010271 19:39936169-39936191 GCTTTGCAGCTGCTGGTCCCAGG - Intergenic
1166416763 19:42600929-42600951 GCCTTGGTGCTGCTGGGGACAGG + Intronic
1166666496 19:44683555-44683577 GGCCTTGTCCTGCTGGTCTCAGG - Exonic
1167217527 19:48174456-48174478 GCCATTGTGCTGCTGATGCTTGG + Intronic
1168436500 19:56321977-56321999 GTGCTTCTGCTGCTGGTCCCTGG + Intronic
925148148 2:1594749-1594771 GCCTGTGTGCTGCGCGTACCGGG - Intergenic
926134292 2:10325799-10325821 ACCTCGGTCCTGCTGGTCCCAGG + Intronic
926396778 2:12451124-12451146 GGCTTTGTCAAGCTGGTCCCAGG + Intergenic
926964551 2:18395930-18395952 GGCTTTGTGCAGCTGGTGCAGGG + Intergenic
927944767 2:27129036-27129058 CCCATTGTGCTGCTGCTTCCTGG + Exonic
929034147 2:37674398-37674420 GGCTTGGTGCTGCTGGTCCTGGG - Intronic
929567808 2:43000640-43000662 CCCTTTGTGCTGCCAGGCCCAGG + Intergenic
930031548 2:47061073-47061095 GCCTTGCTACTGCTGTTCCCTGG + Intronic
930107983 2:47654983-47655005 ACCTGGGGGCTGCTGGTCCCAGG + Intergenic
930519900 2:52452533-52452555 GACTTTATTCTGTTGGTCCCAGG + Intergenic
931224882 2:60321016-60321038 CCCTGTGTGCTGCTGCTGCCTGG - Intergenic
932205155 2:69873854-69873876 GCCTTTCTTCTACTGGGCCCAGG - Intronic
933383170 2:81577024-81577046 GCCTATGAGCTGCTGCTCCCTGG + Intergenic
934927774 2:98393639-98393661 CCCATTGGGCTGATGGTCCCTGG + Intronic
935333525 2:101994799-101994821 GTGTTTGTGCTGCCGGTCCATGG + Intronic
935646625 2:105341780-105341802 GTGCTGGTGCTGCTGGTCCCTGG + Intronic
936915115 2:117632386-117632408 GCCTATGAGCTACAGGTCCCGGG + Intergenic
937035356 2:118777102-118777124 TCCTTTGTTCTGCTGGACCCTGG - Intergenic
937902774 2:127034642-127034664 GCCTTTGTGCTGCAGGTCAGTGG - Intergenic
943725227 2:191245705-191245727 GCCTTTGTGCCCGCGGTCCCTGG + Intronic
945879702 2:215312687-215312709 GGCGTTTTGCTGCTGGTGCCTGG - Intronic
946357813 2:219199631-219199653 ACCTTTGTGCTGCTCTCCCCAGG + Intronic
946650505 2:221888196-221888218 GCCTTTCTGCTGTTCCTCCCAGG - Intergenic
946869826 2:224075383-224075405 GCCTTTAGGATTCTGGTCCCGGG - Intergenic
947433000 2:230046879-230046901 GTCTTTCTGCTGCTTATCCCTGG - Intronic
1169138701 20:3213970-3213992 GTCTTTGTGCTGCAGGTACAGGG + Exonic
1169239791 20:3966872-3966894 GCCTTAGTGCTGCTGGGGGCTGG + Intronic
1170404580 20:16022817-16022839 GCATTTGTGCTACAGGTCTCAGG - Intronic
1172048994 20:32101940-32101962 GTCTTTGTATTTCTGGTCCCCGG - Intergenic
1175271847 20:57739596-57739618 TCCCTGGTGCTGCTGGTCCACGG + Intergenic
1175290135 20:57870037-57870059 GCCTTTCCGCTGCTGCTCCTGGG + Intergenic
1175939035 20:62529429-62529451 TCCTTTGTCCTGGTGGCCCCTGG + Intergenic
1179957934 21:44751561-44751583 GCCTGTGAGCTGAGGGTCCCAGG - Intergenic
1180077616 21:45470988-45471010 GGCTTCGTGCTGCTGGGCCTGGG + Intronic
1180077631 21:45471057-45471079 GGCCTTGTGCTGCTGGGCCTGGG + Intronic
1180109280 21:45640506-45640528 GGCTGGGTGCTGCTGGTCCCTGG + Intergenic
1181403296 22:22664753-22664775 GCCTGGGTGCTGCTGGCACCAGG - Intergenic
1181407986 22:22698231-22698253 GCCTGGGTGCTGTTGGTACCAGG - Intergenic
1181412638 22:22734899-22734921 GCCTGGGGGCTGCTGGTACCAGG - Intronic
1181415979 22:22759021-22759043 GCCTGGGTGCTGTTGGTACCAGG - Intronic
1181420268 22:22792813-22792835 GCCTGGGTGCTGTTGGTACCAGG - Intronic
1181424317 22:22823099-22823121 GCCTGGGTGCTGTTGGTACCAGG - Intronic
1181428107 22:22856869-22856891 GCCTGGGTGCTGTTGGTACCAGG - Intronic
1181593498 22:23898420-23898442 GTCTTTGGGCTGGTGGCCCCAGG - Intronic
1181688959 22:24547757-24547779 GCCTCTCTGCTGCTGCTCCCTGG + Intronic
1182149916 22:28020678-28020700 GCCTGTGTGCAGCTGCTCCCTGG + Intronic
1182759989 22:32714734-32714756 GGCTTTGTGCTGCTACTTCCTGG + Intronic
1182805202 22:33063933-33063955 GCCTTGCTGCAGCTGCTCCCTGG - Intergenic
1183867415 22:40714778-40714800 GGCTTGGTCCTGCTTGTCCCTGG + Intergenic
1185139294 22:49091472-49091494 GCCTGAGTGCAGCAGGTCCCAGG + Intergenic
950117754 3:10462345-10462367 GCCTTTATGCTGATGCTTCCTGG - Intronic
950875596 3:16268851-16268873 GCCTTTGGTCTGCTGTTTCCTGG + Intronic
953508209 3:43507480-43507502 CCCCTGGTGCTGCTGGTCCCTGG + Intronic
953584341 3:44186295-44186317 GCCTTTGCTGTGCTGGCCCCAGG - Intergenic
954654929 3:52188543-52188565 GCCTCTGCACTGCTGATCCCAGG + Intergenic
961660508 3:128466375-128466397 GTGTTGGTGCTGCTGGTGCCGGG + Exonic
962380292 3:134893135-134893157 CCCTGGGTGCTGATGGTCCCAGG + Intronic
965364655 3:167783753-167783775 GCCTCTCTGCTGCTGGTTGCTGG - Intronic
966819112 3:183911041-183911063 GCTTTTATGCTGGTGCTCCCAGG + Intergenic
968264129 3:197349599-197349621 GCCTCGGTGCTGTCGGTCCCTGG + Intergenic
968503965 4:963522-963544 GCCTTTGTGCTGGGAGTGCCAGG - Intronic
968597318 4:1492147-1492169 GCCCCTGTGCTGCTGGTAACAGG - Intergenic
968974823 4:3816560-3816582 GCCTTTGTGCTGCAGGTAGCAGG + Intergenic
969286574 4:6206201-6206223 GCCTTCATGCTGCTGTTCACTGG - Intergenic
969392802 4:6902220-6902242 GCCTTCGTGTTCCTGGACCCTGG - Intergenic
969624008 4:8293396-8293418 CCCTTTGTCCTCCTGGTCCCTGG - Intronic
969686187 4:8675593-8675615 GCCTTTGGGCCGGTGGTGCCTGG - Intergenic
969705139 4:8787615-8787637 GCCTCTTTACTGCTGGTCCCTGG - Intergenic
970053540 4:11945155-11945177 GCCTTGCTGCTGCTGGTCACTGG + Intergenic
970485615 4:16521701-16521723 GCCTTTGTTCTTCTAGCCCCAGG + Intronic
972459575 4:39288416-39288438 GCCTTAGTACTACTGCTCCCAGG + Exonic
974021042 4:56692735-56692757 GCCTGTGTGCTGCTCCTCCAAGG - Intergenic
976407544 4:84677303-84677325 GCCGTTCTGCTGCTGATCACTGG - Exonic
977432846 4:96953844-96953866 GTGTTGGTGCTGCTGGTTCCTGG - Intergenic
981318342 4:143363780-143363802 GCCTTTGCTCTGGTGGTCCTTGG + Intronic
982176304 4:152708544-152708566 TCCTTTGTGCTGCATTTCCCTGG + Intronic
985574254 5:666210-666232 GCCTGTGGGCTGCTGGGCCATGG - Intronic
986236928 5:5919765-5919787 TCCTCAGTGCTGATGGTCCCTGG - Intergenic
987193418 5:15501091-15501113 GCCTTTGTGCTCCAGCCCCCTGG + Intronic
995029478 5:107464194-107464216 GCTGAAGTGCTGCTGGTCCCGGG - Intronic
995598736 5:113774257-113774279 GCCTTTGTGCTGATGTGCCAGGG + Intergenic
997030537 5:130122498-130122520 GCCTTTGTGCTACTTGCCACAGG - Intronic
997381942 5:133444604-133444626 GGCCTTGAGCTGCTGGGCCCTGG + Intronic
999369580 5:151045795-151045817 GCCTTTGTGCTGCTGGTCCCGGG + Intronic
1000207829 5:159079239-159079261 TCCTTGGTGGGGCTGGTCCCAGG - Intronic
1001412067 5:171519093-171519115 GCCTCTGTGCTCCCAGTCCCTGG - Intergenic
1002027389 5:176404749-176404771 CCCTTTGTGCAGCAGGTCCCGGG + Intronic
1002154532 5:177266062-177266084 GTCTTTGTACTGCCGGTCCTCGG + Intronic
1002400163 5:178987050-178987072 TCCTTTCTCCTGCTGGTCCCTGG - Intronic
1002703273 5:181142371-181142393 GCCTTGGTCATGCTGGTTCCAGG - Intergenic
1003117302 6:3291562-3291584 GCGTTTCAGCTGCTGGTCCACGG + Intronic
1003320377 6:5045906-5045928 CCCTTTGGGCTTCTGGTGCCTGG + Intergenic
1006313737 6:33278484-33278506 GCCCTTTTGCTCCTGGTTCCAGG + Exonic
1006644804 6:35508879-35508901 GCCTGTGTGCTCCTCCTCCCTGG + Intronic
1007789927 6:44303034-44303056 TCCTTTGTGCTGCCTGGCCCAGG - Intronic
1010007980 6:71016414-71016436 GCCTCTGTGCTGCTGGTCTGTGG + Intergenic
1010980476 6:82364601-82364623 GCCTCTCTCCTGCTTGTCCCAGG + Exonic
1015549090 6:134393423-134393445 GCCCTCCTGCTGCTGGGCCCAGG - Intergenic
1017137220 6:151158707-151158729 GCCCATGTACTGCTGGCCCCCGG - Intergenic
1017713576 6:157191220-157191242 CCCTCTGTGCTGCTGGTGTCCGG - Intronic
1019409657 7:900942-900964 GCCCTGGTGCTGCTGGGGCCTGG + Intronic
1019653285 7:2172411-2172433 GACTTCCTGCTGCTGGGCCCTGG - Intronic
1019696139 7:2447092-2447114 CCTTTCGTGCTGCTGGTCCCTGG - Intergenic
1019967397 7:4510948-4510970 GCCTTTGTGCAGGTGCTCTCTGG - Intergenic
1021687147 7:23197937-23197959 GCATTCTTGCTCCTGGTCCCTGG - Intronic
1024154191 7:46603461-46603483 GATGTTGTGCTGCTGGTCCAGGG + Intergenic
1024349825 7:48352431-48352453 GAGTCTGTGCTGCTGGTTCCAGG - Exonic
1025957718 7:66195648-66195670 GCCTGTGTGCTGGTGTCCCCTGG + Intergenic
1026848388 7:73710179-73710201 GCTTTTGTACAGCTGGTCCTGGG - Intronic
1029283225 7:99449972-99449994 TTCTTGGTGCTGGTGGTCCCTGG + Intronic
1037283646 8:17272137-17272159 GCCTTTGAGCAGATGGTCACCGG - Intronic
1038485972 8:27935584-27935606 TCCTTTGTGCCTCTGGCCCCAGG - Intronic
1039379385 8:37070721-37070743 GGCTTTGAGCTGCTGGATCCTGG + Intergenic
1044206453 8:89496738-89496760 GCCTTTCCCCTGCCGGTCCCGGG - Intergenic
1047645481 8:126865698-126865720 GCCTTTGTGATACGGCTCCCAGG - Intergenic
1049373947 8:142280306-142280328 GCTTTGCTGCTGCTGGACCCTGG + Intronic
1049675262 8:143886340-143886362 GAGTTTGTGCTGCTGTTGCCTGG + Intergenic
1050310948 9:4352726-4352748 GCCTTTGTGCTGCTGGCTCTTGG + Intergenic
1050662343 9:7896175-7896197 GGCATTGTGCTGCTGGTCTCTGG - Intergenic
1053426169 9:38011506-38011528 GTCTTTGTGGGGCTGGTCCTGGG + Intronic
1056910426 9:90695582-90695604 GTCTCTGTGCTGCTAGTCCCTGG + Intergenic
1057028908 9:91758534-91758556 GGCTTTGTCCTGCTGCACCCAGG + Intronic
1058904046 9:109467032-109467054 TCCTTTGCACTGCTGGTCCCAGG - Intronic
1059281117 9:113135064-113135086 GCACTGATGCTGCTGGTCCCTGG - Intergenic
1060836756 9:126761392-126761414 TCCTTTGAGCTGCTGTCCCCTGG - Intergenic
1060944227 9:127560463-127560485 GCCTTTGTCCTTAGGGTCCCAGG - Intronic
1061065547 9:128275669-128275691 GACTTTGGGCTGGTGCTCCCGGG - Intronic
1061922669 9:133790803-133790825 CTCTTTGTGCTGCTGGCACCGGG + Intronic
1187960125 X:24560145-24560167 GCCTTTGTGCCCCTGCTCCATGG - Intronic
1192198311 X:69047177-69047199 GCCTCTCTGCTCCTGCTCCCAGG + Intergenic
1197432075 X:126378306-126378328 CTCTTTGTGATGCTGGTGCCAGG - Intergenic
1199249855 X:145648074-145648096 GCCTTTGTGAATCTGGTGCCAGG + Intergenic
1200142200 X:153907844-153907866 GCCTTTGGGCTTCGGGGCCCAGG + Exonic
1201760793 Y:17536238-17536260 GTCTTTGTGCTGGTGGCCACAGG - Intergenic
1201840759 Y:18369752-18369774 GTCTTTGTGCTGGTGGCCACAGG + Intergenic
1202082002 Y:21093105-21093127 GCTTTTGTCCTGCTGGAGCCAGG + Intergenic