ID: 999369871

View in Genome Browser
Species Human (GRCh38)
Location 5:151048179-151048201
Sequence CCACCCTCTTCCTCCTTCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1184
Summary {0: 1, 1: 0, 2: 13, 3: 146, 4: 1024}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999369871_999369875 -7 Left 999369871 5:151048179-151048201 CCGGGGAAGGAGGAAGAGGGTGG 0: 1
1: 0
2: 13
3: 146
4: 1024
Right 999369875 5:151048195-151048217 AGGGTGGATTCCAGGCTCTAGGG 0: 1
1: 0
2: 0
3: 23
4: 192
999369871_999369876 -4 Left 999369871 5:151048179-151048201 CCGGGGAAGGAGGAAGAGGGTGG 0: 1
1: 0
2: 13
3: 146
4: 1024
Right 999369876 5:151048198-151048220 GTGGATTCCAGGCTCTAGGGTGG 0: 1
1: 0
2: 2
3: 25
4: 238
999369871_999369874 -8 Left 999369871 5:151048179-151048201 CCGGGGAAGGAGGAAGAGGGTGG 0: 1
1: 0
2: 13
3: 146
4: 1024
Right 999369874 5:151048194-151048216 GAGGGTGGATTCCAGGCTCTAGG No data
999369871_999369878 18 Left 999369871 5:151048179-151048201 CCGGGGAAGGAGGAAGAGGGTGG 0: 1
1: 0
2: 13
3: 146
4: 1024
Right 999369878 5:151048220-151048242 GTGCACCCTGAACCTCCGCGAGG 0: 1
1: 0
2: 0
3: 3
4: 79
999369871_999369879 19 Left 999369871 5:151048179-151048201 CCGGGGAAGGAGGAAGAGGGTGG 0: 1
1: 0
2: 13
3: 146
4: 1024
Right 999369879 5:151048221-151048243 TGCACCCTGAACCTCCGCGAGGG 0: 1
1: 0
2: 1
3: 5
4: 55
999369871_999369882 26 Left 999369871 5:151048179-151048201 CCGGGGAAGGAGGAAGAGGGTGG 0: 1
1: 0
2: 13
3: 146
4: 1024
Right 999369882 5:151048228-151048250 TGAACCTCCGCGAGGGAGAGAGG 0: 1
1: 0
2: 0
3: 6
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999369871 Original CRISPR CCACCCTCTTCCTCCTTCCC CGG (reversed) Intronic
900807995 1:4780504-4780526 CCCACCTCTTCCACATTCCCCGG - Intronic
900888553 1:5432528-5432550 CCTCACTCCACCTCCTTCCCTGG + Intergenic
901174494 1:7289061-7289083 CCCCTCTCTTCCTCCTGCTCTGG - Intronic
901178103 1:7319411-7319433 CACCCCGCTTCCTCCTGCCCCGG + Intronic
901183182 1:7355782-7355804 CCTCCCTCTTGCTCCTCCCTTGG + Intronic
901392909 1:8958826-8958848 TCTTTCTCTTCCTCCTTCCCTGG + Intronic
901730198 1:11273455-11273477 CCCCGTCCTTCCTCCTTCCCGGG + Exonic
901967187 1:12878152-12878174 CCACTCTCTTCCCGCTGCCCTGG - Intronic
901974988 1:12937289-12937311 CCACTCTCTTCCCGCTGCCCTGG - Intronic
901982587 1:13048416-13048438 CCACTCTCTTCCCACTGCCCTGG - Intronic
901999500 1:13180503-13180525 CCACTCTCTTCCCACTGCCCTGG + Intergenic
902010187 1:13264475-13264497 CCACTCTCTTCCCGCTGCCCTGG + Intergenic
902017978 1:13323634-13323656 CCACACTCTTCCCACTGCCCTGG + Intergenic
902332455 1:15737089-15737111 ACACCCTCTGCCCCCTCCCCTGG - Intronic
902554174 1:17237292-17237314 CCGCCCTCTCCCTCCTGGCCAGG + Exonic
902829697 1:19004087-19004109 CCAGCCTCCTCATCCCTCCCCGG + Intergenic
903020446 1:20390088-20390110 CCACCCCTTTCCACCCTCCCCGG + Intergenic
903037265 1:20500969-20500991 CCACCCTCTTCTTCATTCTCCGG - Exonic
903363189 1:22789977-22789999 CCATACTCTGCCTCGTTCCCTGG - Intronic
903500535 1:23797920-23797942 CCACCCTGTTACTCCTCCACAGG + Intronic
903501202 1:23800921-23800943 CCGCCCACTTCCGCCTTCCGCGG - Intergenic
903762575 1:25709103-25709125 CCACCCCCTTCAACCCTCCCTGG - Intronic
903763058 1:25712712-25712734 CCACCCGCTTCAACCCTCCCTGG + Intronic
904033736 1:27548398-27548420 CCACCTTCTTCCGCCGTCCACGG + Exonic
904208098 1:28867998-28868020 CCATCCTCCTCCTGCTTCTCTGG - Intergenic
904213227 1:28899431-28899453 CTCCCCTCTTCCCCCTTTCCTGG + Intronic
904224560 1:29005225-29005247 ACCCCCTCTTCCTCCTGCTCTGG - Intronic
904256435 1:29257783-29257805 CCTCCCTCTGCCTCCCACCCTGG - Intronic
904358069 1:29954279-29954301 TCCCCCTCTTCCTCCTTCGTCGG - Intergenic
904413737 1:30342350-30342372 CAGGCCTCTGCCTCCTTCCCCGG + Intergenic
904884431 1:33725716-33725738 CATCCCTCCTCCTCCTTCCATGG + Intronic
904912854 1:33948302-33948324 CTACCCTCTGCCTTCTGCCCTGG + Intronic
905482643 1:38271925-38271947 CCAAAGTCTTCCTCCTTCCCAGG + Intergenic
905931145 1:41788456-41788478 CCTCTCTCTCCTTCCTTCCCTGG - Intronic
906074638 1:43042979-43043001 CCTCCCCCTTCCTCTTTCACAGG + Intergenic
906241665 1:44245853-44245875 CCAGCCAGTTCTTCCTTCCCTGG + Intronic
906611160 1:47204473-47204495 CCACTCTTCTCCTCCTTCTCTGG + Intergenic
906693816 1:47810858-47810880 CCACCCTTCTCCTCCTTCCCTGG - Intronic
907317509 1:53581858-53581880 CCACCCCCTTCCTCCTCCCTAGG + Intronic
907319809 1:53595095-53595117 TCAGCCTCTGCCTCCTGCCCTGG - Intronic
907414061 1:54301971-54301993 CCTCCGTCTTCCTCTTTCCCAGG - Intronic
907447474 1:54518051-54518073 CCACCTCCTCCCTCCTTCCTGGG - Intergenic
907485905 1:54777949-54777971 CCTCTCTCTTGCTCCTTCTCTGG + Intergenic
907489139 1:54797928-54797950 CCCTCCTCCTCCTCCTTTCCTGG + Intronic
907659882 1:56382185-56382207 CCTCCCTCTTTCTTCTTCTCTGG - Intergenic
907880669 1:58546629-58546651 CCGCACTCTGCCTCCTCCCCTGG + Intronic
908105154 1:60833692-60833714 CCATCCTCTGCCTCCACCCCTGG - Intergenic
908267544 1:62394145-62394167 CCCTCCTCTTGCTGCTTCCCAGG + Intergenic
908351338 1:63288305-63288327 TCTCTCTCTTCCTCCTTCTCTGG - Intergenic
908534645 1:65066741-65066763 CCTCCCTCCTCCTCCTCCTCCGG + Intergenic
908582710 1:65532810-65532832 TCACCAGCTTCCTCCATCCCCGG - Intronic
908706767 1:66965791-66965813 CCTCTCTCTTACTCCTTTCCCGG + Intronic
909371095 1:74884452-74884474 CCACCCTCTACCTGTTACCCAGG - Intergenic
909382047 1:75009884-75009906 TCTCTCTCTTCCTCCTGCCCTGG + Intergenic
909528385 1:76653104-76653126 CCACCATCATTCTTCTTCCCTGG + Intergenic
909724645 1:78819646-78819668 CCTCTCTCTTCCTCCTGCTCTGG + Intergenic
910188250 1:84568801-84568823 CCTCTCTCTTTCTCCTTCTCTGG + Intronic
910473516 1:87580579-87580601 CCACCCTCTTCCACCATTTCAGG - Intergenic
910478486 1:87633992-87634014 CCATCCTCTTCTCACTTCCCCGG - Intergenic
911054998 1:93701673-93701695 CCCCACTCTGCCTGCTTCCCAGG + Intronic
911811196 1:102284315-102284337 CCACCCACTTCCTCCTGCTCTGG - Intergenic
912411061 1:109480960-109480982 CTTCCCTCTTCTTCCTTCCCTGG - Exonic
912491411 1:110064766-110064788 CCTGCATCTTCCTCTTTCCCCGG - Exonic
912798106 1:112705063-112705085 TCCCTCACTTCCTCCTTCCCTGG + Intronic
913435435 1:118842687-118842709 ACACCCACTCACTCCTTCCCAGG + Intergenic
914935002 1:151970902-151970924 CCACTCTCTCCCTCCTTGTCTGG - Intergenic
915042979 1:152983844-152983866 CCACCCTCATCCTCAGACCCAGG - Intergenic
915519292 1:156432070-156432092 TCTCCCCCTTTCTCCTTCCCTGG + Intergenic
916128018 1:161588612-161588634 CCTTCCTTTTCCTCCTTCCACGG + Intronic
916137936 1:161670442-161670464 CCTTCCTTTTCCTCCTTCCACGG + Intronic
916311777 1:163406337-163406359 ACACGTTCTTCCTCCTTCCTTGG - Intergenic
916544230 1:165786682-165786704 CCAGCCTCTTCCCCATTCCAAGG - Intronic
916645185 1:166777744-166777766 CCTCCCACTACGTCCTTCCCTGG - Intergenic
916702179 1:167308531-167308553 TCCCTCCCTTCCTCCTTCCCTGG + Intronic
916714554 1:167438392-167438414 GCACCCTCTTCCTTCCTCCTTGG - Intronic
916886940 1:169078633-169078655 CCAAGCTCTTCCTCCTCTCCTGG - Intergenic
917008409 1:170442750-170442772 CCTCCCTCTTCCTTTTCCCCTGG - Intergenic
917361710 1:174183758-174183780 TCAGCCTATTCCTCCCTCCCTGG + Intronic
918390046 1:184050565-184050587 CCACTCTCTGACTCCTTCCTTGG + Intergenic
918738541 1:188097694-188097716 GCGGCCTCTTCCTCCTGCCCTGG - Intergenic
919349153 1:196426865-196426887 CCACCCTCTTCCTCCTGCTCTGG + Intronic
920229618 1:204461758-204461780 CCACACTCTTCCTTCCTCCCAGG - Intronic
920380773 1:205533351-205533373 ACACCCTCGTCCTGCTGCCCTGG - Intergenic
920520292 1:206619487-206619509 CCACCCCCTTACCCCTTCCTTGG - Intergenic
920609006 1:207419218-207419240 CCACTCTCTTGCTCCTGCTCTGG + Intergenic
920716337 1:208343812-208343834 CCATCCTGTGCCTCCTTCCCAGG + Intergenic
921397653 1:214685841-214685863 CCCCTCTCTTCCTCCTTCATTGG + Intergenic
921621248 1:217328896-217328918 TCTCCCTCTTCCTCCTTCTCTGG - Intergenic
921745951 1:218740998-218741020 TCACTCTCTTCCTCCTGCTCTGG + Intergenic
921983373 1:221283182-221283204 CCTTCCCCTTCCTCCTTGCCTGG + Intergenic
922052627 1:222008653-222008675 GCAACCTCTGCCTCCCTCCCGGG - Intergenic
922213990 1:223506314-223506336 CCTGCCTCTTCCTACCTCCCAGG + Intergenic
922471417 1:225879611-225879633 CGACCCTACTCCTCCTTCCTCGG + Intronic
922538068 1:226397660-226397682 TCACTCTCTTCCTCCTGCTCCGG + Intronic
922718972 1:227890704-227890726 CCACCCTCTTCTTTCTGCCCTGG - Intergenic
922844560 1:228673623-228673645 TCACTCTCTTCCTCCTGCTCTGG + Intergenic
923087214 1:230710770-230710792 CCATCCTCTGCCTCCTGGCCTGG - Exonic
923134640 1:231107314-231107336 CCACACTCTGCCTTCATCCCAGG + Intergenic
923153441 1:231255213-231255235 CCACCCTCTCCCTCATCCTCAGG + Intronic
923211133 1:231805473-231805495 CCACCCCCCTCCTCCTGCTCTGG - Intronic
923269985 1:232346817-232346839 CCATCCACTACCTCTTTCCCAGG - Intergenic
923907505 1:238401781-238401803 CCACCCTCTTCCCCCTGCTCCGG - Intergenic
924404621 1:243730168-243730190 GCACGCACTTCCTCCTGCCCAGG + Intronic
924644280 1:245862964-245862986 CCTCCCTCTACCTCCTTCTCTGG + Intronic
1062764278 10:49051-49073 CCACCCGGTTCCACCGTCCCCGG + Intronic
1063377281 10:5561858-5561880 CCACCCCCGTCCTCCTCTCCTGG + Intergenic
1063504961 10:6589462-6589484 CCATCCTGGTGCTCCTTCCCTGG - Intergenic
1064016853 10:11779481-11779503 CCTCCCTCCTCCTCCTACCAGGG - Intergenic
1064099520 10:12451366-12451388 CCTACCTCTTCCTCCTCCCAAGG - Intronic
1064126639 10:12667183-12667205 CCACCCTTGTCATCCTTTCCAGG + Intronic
1064404285 10:15047341-15047363 CCAGGCTCTTCCTCCATCCCAGG + Intronic
1065239914 10:23694895-23694917 GCACCCTCTCCGTCCTCCCCCGG - Intronic
1065497774 10:26347674-26347696 GCACTATCTTCCTCCTCCCCAGG + Intergenic
1065689542 10:28319162-28319184 TCACCCTCTTCCTCCTGCTCTGG - Intronic
1066366302 10:34780037-34780059 CCTCCATCTTCTTCTTTCCCCGG + Intronic
1066674257 10:37872038-37872060 TCACTCTCTTCCTCCTGCTCTGG - Intergenic
1068210808 10:53917913-53917935 CCTCCCTCTTGCTCCTGCTCTGG + Intronic
1068224399 10:54087927-54087949 CCTCTCTCTTCCTCCTGCTCAGG + Intronic
1068712249 10:60147705-60147727 CCTCTCTCTTCCTCCTGCACCGG + Intronic
1068803449 10:61168039-61168061 CCACCCTCTTTCTCCTCTCCTGG + Intergenic
1068891357 10:62151296-62151318 CCATCCCCTTCCTCCTGCTCTGG + Intergenic
1069511740 10:69047741-69047763 CCACCCTCTCCCCTCTCCCCAGG + Intergenic
1069634282 10:69916063-69916085 CCACCCTCTTCCTCCGTGATGGG - Intronic
1069698471 10:70404832-70404854 CTCCTCTCTGCCTCCTTCCCGGG + Intronic
1069715771 10:70520290-70520312 CCACCTTCTTTGTCCTTCCAGGG - Intronic
1069881586 10:71596914-71596936 GCACTCCCTTCCTCCCTCCCAGG + Intronic
1069882639 10:71603284-71603306 CCTCCCTCCCCCTCCTTCCCTGG + Intronic
1070168483 10:73915042-73915064 CAACACTCTTCATCCATCCCTGG - Intronic
1070552698 10:77503203-77503225 CCACTCCCATTCTCCTTCCCTGG - Intronic
1070747781 10:78945197-78945219 CCACCCTCTCCCTCCCTGCTGGG - Intergenic
1070815835 10:79322678-79322700 GCACCCTTATCCTCCTTCCCTGG + Intergenic
1070819690 10:79347657-79347679 CCGTCCTCTTCCTCCTCCTCCGG + Exonic
1070982414 10:80660213-80660235 CCACCCTCCTTCTCCAGCCCTGG + Intergenic
1071573658 10:86711309-86711331 TCTCCTTCCTCCTCCTTCCCGGG + Intronic
1072222085 10:93335199-93335221 ACAGGCTCTTCTTCCTTCCCTGG - Intronic
1072439276 10:95439403-95439425 CCCCTCCCTTCCTCCTTCTCTGG + Intronic
1072848476 10:98859624-98859646 CAACCCTCTTCTCCCTTTCCAGG + Intronic
1073190382 10:101646641-101646663 GCACCAGCTTCCTTCTTCCCTGG + Intronic
1073200058 10:101727948-101727970 ACACCCTCTTCGGCCTCCCCAGG - Intergenic
1073217234 10:101843384-101843406 CCACACTCTGCCCCATTCCCAGG - Intronic
1073480027 10:103780507-103780529 CCAGCCTCTTTGGCCTTCCCAGG + Intronic
1073758962 10:106610219-106610241 CCATCCTCTTCCTTATTCCAAGG - Intronic
1074104157 10:110376309-110376331 CCACCCTTGCCCTCCTCCCCAGG + Intergenic
1074140775 10:110670605-110670627 CCAGCATGATCCTCCTTCCCTGG + Intronic
1074258870 10:111832009-111832031 TCACCCTCTTCCTCCTTCTCTGG - Intergenic
1074768318 10:116716707-116716729 CCACTCTCTTCATCCTCCTCAGG - Intronic
1075334563 10:121598707-121598729 CCACCTCCTCCCTCCTCCCCGGG + Intergenic
1075961545 10:126571508-126571530 CCTCCCTCTGCATCCTTCCAGGG - Intronic
1076107341 10:127834258-127834280 CCTCCAGCTTCCTCCTGCCCAGG + Intergenic
1076179688 10:128397558-128397580 CATCCCTGTTTCTCCTTCCCTGG + Intergenic
1076244106 10:128932740-128932762 TTTGCCTCTTCCTCCTTCCCAGG - Intergenic
1076670552 10:132118505-132118527 CCTCCCTCTGCCTGCTTCCCGGG + Intronic
1076868274 10:133180010-133180032 CCAGCCTCGTCCTGCTGCCCTGG + Intronic
1077283316 11:1755083-1755105 TCACCCTCTTACTCCTGACCTGG - Intronic
1077299450 11:1840327-1840349 CCACCCCCTTCCACGCTCCCTGG - Intronic
1077317404 11:1925590-1925612 CCACCCTAGTCCTCCACCCCAGG + Intronic
1077376959 11:2209619-2209641 CCACCCTGGCCCTGCTTCCCAGG + Intergenic
1077564421 11:3287947-3287969 ACCCTCTCTTCCTCCTTCTCTGG - Intergenic
1077570311 11:3333764-3333786 ACCCTCTCTTCCTCCTTCTCTGG - Intergenic
1078332958 11:10441028-10441050 CCACCCTCCTCCTTCTTCAGGGG - Intronic
1078697455 11:13648736-13648758 TCACCCTCTTCCTCCTGCTCTGG + Intergenic
1078748127 11:14134863-14134885 CCAGCTTCTTCCTACCTCCCTGG + Intronic
1078929388 11:15901511-15901533 TCATCCTCTTCTCCCTTCCCTGG - Intergenic
1079120143 11:17677110-17677132 CCTCTCTATTCCTCCTTCTCTGG - Intergenic
1080079091 11:28193384-28193406 TCTCTCTCTTCCTCCTGCCCTGG - Intronic
1080540191 11:33257621-33257643 TCTCCCTCATCTTCCTTCCCGGG - Exonic
1081529303 11:43947158-43947180 CCTCCCTCTTGCTCCCTCTCTGG - Intergenic
1081658622 11:44874277-44874299 CCACCCTTTTCCCCATGCCCAGG - Intronic
1081736385 11:45407523-45407545 CCTCCCTCTGACTCCTCCCCAGG + Intergenic
1081789623 11:45773768-45773790 CCCCACTTTTCCTCCTTCCTAGG - Intergenic
1083185819 11:61017372-61017394 CCACCCTATTCAGCCTACCCAGG + Intronic
1083274436 11:61588641-61588663 CCTCATTCTTCCTCCTTTCCAGG - Intergenic
1083289717 11:61682980-61683002 CCACCCTCATCCTCCCCACCTGG - Intronic
1083439704 11:62667747-62667769 CCCCTCTCTTCCTCCATCCCAGG - Exonic
1083514777 11:63246689-63246711 CCTCCATCTTCCCCCTTCTCTGG + Intronic
1083855381 11:65390615-65390637 CCACCCTCTTCCTGCTGCCCCGG + Intronic
1084020834 11:66416915-66416937 CCACCCTTCAACTCCTTCCCAGG + Intergenic
1084041212 11:66543720-66543742 CTGCCCTCCTCCTGCTTCCCTGG - Exonic
1084273051 11:68039164-68039186 CCACCCTCTTCCCCCTGCCCCGG + Intronic
1084402067 11:68950361-68950383 CCACATTCTTTCTCCATCCCAGG + Intergenic
1084548476 11:69826294-69826316 CCACCCTCTCCCTCTTTGTCGGG - Intergenic
1084683547 11:70680727-70680749 CCAGCCTCTCTCTCTTTCCCTGG + Intronic
1085312262 11:75523865-75523887 CCACGCTCCTCCACCTTCCAGGG + Intronic
1085479022 11:76806425-76806447 CCAGCCTCTTCCGTCTTCACAGG - Intergenic
1085575820 11:77601591-77601613 CCACCCGCTTCAGCCTTCCAAGG + Intronic
1085732496 11:79011579-79011601 CTACACTCTTCCTCCTCTCCAGG + Intronic
1086229028 11:84546289-84546311 CCTCTCTCTTCCTCCTGCTCTGG + Intronic
1086737254 11:90321786-90321808 CCAACCTTTTACTCCTTCTCTGG - Intergenic
1087403255 11:97695119-97695141 CTCCCCTCTTCCTCCTGCACTGG + Intergenic
1087708268 11:101520247-101520269 TCACCCTCTTCCTCCTTCTCTGG + Intronic
1087708533 11:101522313-101522335 TCACTCTCTTCCTCCTTCTCTGG + Intronic
1088437565 11:109832089-109832111 ACTCCCTTGTCCTCCTTCCCTGG + Intergenic
1088852992 11:113720691-113720713 ACTCTCTCTTCCTCCTTCTCTGG - Intergenic
1089028286 11:115294789-115294811 CCACCCACCTCCTCCTCCCAAGG - Intronic
1089147420 11:116339899-116339921 CCACAGCCTTCCTCCTGCCCAGG + Intergenic
1089175768 11:116547837-116547859 CCACCCCCTCCCTCTCTCCCTGG + Intergenic
1089361022 11:117886650-117886672 CCCTCCTCCTCCTCCTTCACGGG - Intergenic
1089691378 11:120188858-120188880 CCACCCACCACCTCCTGCCCTGG + Intergenic
1089746040 11:120617704-120617726 CCCCACTCTTCCTCCTGCTCCGG + Intronic
1090241909 11:125189815-125189837 CCTCCCTCTCCTTCCTTCCCTGG + Intronic
1090242724 11:125195427-125195449 CACCCCTCCTCCTGCTTCCCAGG - Intronic
1090374428 11:126278921-126278943 CCACCCTCTTAGTCCCACCCTGG - Intergenic
1090799117 11:130159800-130159822 TCTCCCTCTTCCTCTTTCTCCGG - Exonic
1091307066 11:134543050-134543072 CCCCTCTCTGCCTCCTTCCCAGG + Intergenic
1091538032 12:1431952-1431974 GCAGCCTCAACCTCCTTCCCAGG + Intronic
1091645952 12:2272390-2272412 CCTGCCTCCTCCTGCTTCCCCGG + Intronic
1092030137 12:5276971-5276993 TGACCCTCTTCCACCTTCCTGGG - Intergenic
1092171199 12:6374994-6375016 CCTCCCTCCTCCACCTTTCCTGG + Exonic
1092733310 12:11555346-11555368 CCTCCCTCCTCAGCCTTCCCAGG + Intergenic
1094322891 12:29204758-29204780 CCACCCATTTCCTCCTGCTCTGG - Intronic
1096789788 12:54037465-54037487 CCCCCCTCTTCCCACTCCCCCGG - Intronic
1097081899 12:56438119-56438141 GCAACCTCTGCCTCCCTCCCGGG + Intronic
1097139419 12:56887363-56887385 TCATCCTCTTCCTCCTTCTCTGG + Intergenic
1097567497 12:61289090-61289112 ACTCTCTCTTCCTCCTTCTCTGG - Intergenic
1097812541 12:64034271-64034293 TTGCCCTCTTCCTCCTTCTCTGG + Intronic
1098483357 12:70991899-70991921 CCTTCCCCTGCCTCCTTCCCTGG + Intergenic
1099085012 12:78235180-78235202 CCACCCAGTTCAACCTTCCCTGG - Intergenic
1099181694 12:79477003-79477025 ACATCCTCTCCCTCCCTCCCTGG - Intergenic
1099724907 12:86412980-86413002 TCACTCTCTTCCTCCTGCTCTGG + Intronic
1100813531 12:98363520-98363542 CCTCTCTCTTCCTCCTGCTCTGG - Intergenic
1100825869 12:98473723-98473745 GCATCCCCTTGCTCCTTCCCTGG + Intergenic
1101458187 12:104859810-104859832 GCAACCTCTGCCTCCCTCCCAGG + Intronic
1101876174 12:108598119-108598141 CCTCCTCCTTCCTCCCTCCCCGG + Exonic
1101970412 12:109308990-109309012 GCTCCCTTTTCCTCCTTCCTGGG - Intronic
1102000393 12:109554186-109554208 CCACCCAATGCCTCCTTCCAGGG + Exonic
1102453470 12:113057380-113057402 GCACCCCCTCCCCCCTTCCCAGG - Intronic
1102869533 12:116402731-116402753 TCACTCTCTTCCTCCTTCTCTGG + Intergenic
1103087691 12:118074160-118074182 GCAACCTCTGCCTCCCTCCCGGG + Intronic
1103615196 12:122147471-122147493 CCACCCAATGCCTCCATCCCAGG - Intergenic
1103841600 12:123869700-123869722 CCAGCCCCTTCCTCCTTCTCAGG + Intronic
1104242953 12:127008712-127008734 CCACCCCCTTTCTCCACCCCGGG + Intergenic
1104258505 12:127161199-127161221 CTTACCTCTTCCTCCTTCCCGGG + Intergenic
1104538087 12:129637541-129637563 CCACCCCCTTCCTCCTGGTCTGG + Intronic
1104622238 12:130325347-130325369 ATATCCTCTTCCTCCTTCCTAGG + Intergenic
1104761709 12:131300804-131300826 TCCTCCTCCTCCTCCTTCCCAGG + Intergenic
1104789248 12:131471620-131471642 CCATCCACGTCCTCCATCCCAGG - Intergenic
1104818064 12:131659981-131660003 TCCTCCTCCTCCTCCTTCCCAGG - Intergenic
1105647534 13:22337672-22337694 CCACACTCTTTCTCCTGCTCTGG + Intergenic
1105698516 13:22915472-22915494 CCGCCATCTTCCTCCTCCCTTGG - Intergenic
1105776732 13:23669351-23669373 GCACCTGCTGCCTCCTTCCCTGG + Intronic
1106370751 13:29130368-29130390 CCTCGCTCTTCCTTCTGCCCAGG + Intronic
1106493587 13:30252820-30252842 GCAACCTCTGCCTCCCTCCCAGG + Intronic
1106576341 13:30979105-30979127 GGACCCTCTTCCTTCTACCCAGG + Intergenic
1107344015 13:39439756-39439778 TCTCTCTCTTCCTCCTTCTCTGG + Intronic
1107400169 13:40061886-40061908 CTTCCCTCTTCCTCCTTAGCAGG + Intergenic
1108150601 13:47529888-47529910 CCACTCTCTTCTTACTTCCATGG - Intergenic
1108958807 13:56195772-56195794 CCACTATCTTTCTCCTTCTCTGG + Intergenic
1109994643 13:70107778-70107800 CCCGCCTCTTCCTCCGCCCCCGG - Exonic
1111013381 13:82342732-82342754 CCACCCACTTCAGCCTTCCAAGG + Intergenic
1111111962 13:83723041-83723063 CCTCCCCCTTCCTCTATCCCCGG - Intergenic
1111571406 13:90091781-90091803 TCACTCTCTTCCTCCTGCTCTGG - Intergenic
1111834460 13:93370629-93370651 CCAGCCTCTTCCTCCATAACAGG - Intronic
1111958816 13:94786770-94786792 GCACCTCCTTGCTCCTTCCCTGG + Intergenic
1112012760 13:95305814-95305836 CCCCACTCTTCCTTCTTCACAGG + Intergenic
1112406322 13:99123750-99123772 GCCAGCTCTTCCTCCTTCCCTGG - Intergenic
1112444658 13:99453325-99453347 CCACGCTCCTCCTCCTGCCCTGG + Intergenic
1112924678 13:104659580-104659602 CCTCCCTCTTCCTCCTGCTCTGG + Intergenic
1113319119 13:109214876-109214898 CCTCTCTCTTCCTCCTGCTCTGG - Intergenic
1113433787 13:110272981-110273003 CCACCTTCTCCTTCCTTCCAGGG + Intronic
1113496453 13:110733771-110733793 TCACTCTCTTTCTCCTTCTCCGG - Intergenic
1113606139 13:111608380-111608402 TCACTCTCTTCCTCCTGCTCTGG - Intronic
1113893364 13:113748243-113748265 CCTCCCTCCGCCTCCCTCCCTGG + Intergenic
1113949982 13:114066428-114066450 CCCCCTTCTCCCTCCTGCCCGGG - Intronic
1114257976 14:21018608-21018630 CTACCCAGTTCCTCCTTACCAGG + Intronic
1114567617 14:23644261-23644283 CCACCATCCTCCTGCTGCCCTGG + Intronic
1114582509 14:23775421-23775443 CCTCCTTCTTCCTCCCTCCTTGG - Intergenic
1115054522 14:29106509-29106531 TCACTCTCTTCCTCCTTGTCTGG + Intergenic
1115312678 14:31995282-31995304 ACACCATCCTCCTCCTTCTCTGG - Intergenic
1116229880 14:42202873-42202895 CCACCCTCCTCCGCCTCCCAAGG - Intergenic
1116314558 14:43370748-43370770 CCACCCAGTTCCAGCTTCCCCGG - Intergenic
1116410481 14:44615860-44615882 TCTCTCTCTTCCTCCTTCTCTGG + Intergenic
1116442701 14:44972002-44972024 GCCCTCTCTTCCTCCTTCTCCGG - Intronic
1116531906 14:45981775-45981797 CCTCCATCTTCCTCCTGTCCTGG - Intergenic
1116588392 14:46739498-46739520 CCACCCTCTTCTTGCTTGCATGG - Intergenic
1117122535 14:52583759-52583781 GCACTTTCTTCCTTCTTCCCTGG + Intronic
1118325241 14:64776015-64776037 ACAGCCTCTTCCTCCCACCCTGG + Intronic
1118366571 14:65102021-65102043 CCTCCCGCTCCCACCTTCCCCGG - Intronic
1118759785 14:68873220-68873242 CCACCCACCTCCTCCATCACTGG - Intergenic
1118766992 14:68916570-68916592 CCACTCTCCTTCCCCTTCCCTGG + Intronic
1118768575 14:68926760-68926782 CCAATCCCTTCCTCCTGCCCTGG + Intronic
1118933336 14:70263460-70263482 CCAACCTCTGCCTGCTACCCAGG - Intergenic
1119096325 14:71835013-71835035 GACCCCTCTTCCTCCCTCCCTGG - Intergenic
1119325071 14:73755045-73755067 CCCCACTCTCCTTCCTTCCCAGG + Intronic
1119416091 14:74470440-74470462 CCTCACTCCTTCTCCTTCCCTGG + Intergenic
1119720206 14:76885062-76885084 CCACCCTCTCCCGGCCTCCCGGG - Intergenic
1119769675 14:77212699-77212721 CCACCCTCCTCAGCTTTCCCAGG - Intronic
1119788067 14:77327359-77327381 CCACCCCCATCTCCCTTCCCTGG - Intronic
1120707546 14:87760465-87760487 CCTCTCTCTTGCTCCTGCCCTGG - Intergenic
1120767076 14:88338055-88338077 TCTCTCTCTTCCTCCTTCTCTGG + Intergenic
1121105001 14:91273816-91273838 CCACCCTCACCATCCTGCCCAGG - Intronic
1121156739 14:91692279-91692301 CCACTCTGTTCCTTCTGCCCAGG + Intronic
1121236083 14:92392088-92392110 ACAACTCCTTCCTCCTTCCCGGG + Intronic
1121317530 14:92971090-92971112 GCACCCTCTTCCTGCTCACCTGG + Intronic
1121342870 14:93115650-93115672 CCTCCCTCCTCCTCCCGCCCGGG + Intronic
1121452859 14:94020454-94020476 CCTCCCTCTTGCCCCTTCCATGG + Intergenic
1121483404 14:94295268-94295290 CCACCCCCTTCCTGGTTCCTCGG - Intergenic
1121577523 14:95000491-95000513 TCTCTCTCTTCCTCCTTCTCCGG - Intergenic
1121581506 14:95035643-95035665 CCAGCCTCCTCCTCCTTCCTTGG - Intergenic
1121758962 14:96427384-96427406 ACTCTCTCTTCCTCCTTCTCAGG - Intronic
1121777639 14:96600904-96600926 CCACCCTCTTCCACCTGGCTGGG + Intergenic
1121938688 14:98045630-98045652 TCACCCTCTTCCTCCTGCACTGG + Intergenic
1122056577 14:99102469-99102491 CCTCCCTCTTCCTCCTGCTCTGG + Intergenic
1122265533 14:100544949-100544971 CCACCCCACACCTCCTTCCCGGG - Intronic
1122637844 14:103138619-103138641 GCACCCTCTTCCTCCTCGCCTGG - Intergenic
1122722431 14:103729848-103729870 TCAGCCTCTTCCTCCTCACCGGG + Intronic
1122755255 14:103973562-103973584 CCTCCCTCATCCACCCTCCCCGG - Intronic
1122779830 14:104138895-104138917 TCACCCACTCCCTCCATCCCCGG - Intronic
1122832055 14:104403182-104403204 CCCCACCCTTCCTCCTTCTCTGG + Intergenic
1124242033 15:28036836-28036858 CAAACCTCTTCCTCCATGCCTGG - Intronic
1124346630 15:28927161-28927183 CCACCCTCTTCTTCCTTTACTGG + Intronic
1124492346 15:30165758-30165780 CCTGCCTCTTCCTCCTGCTCTGG + Intergenic
1124514290 15:30353008-30353030 CCCCCTTCTTCCTGCTTTCCTGG - Intergenic
1124721805 15:32117107-32117129 CTCCCCTCATCCTGCTTCCCAGG - Intronic
1124728629 15:32177756-32177778 CCCCCTTCTTCCTGCTTTCCTGG + Intergenic
1124751190 15:32372559-32372581 CCTGCCTCTTCCTCCTGCTCTGG - Intergenic
1124829264 15:33132176-33132198 TCCCCCTCTTCCTTCTTTCCTGG + Intronic
1124998761 15:34749883-34749905 CAACACTCTTCCTCCATCTCTGG + Intergenic
1125023488 15:35007792-35007814 GCAACCTCTGCCTCCCTCCCGGG + Intergenic
1125720672 15:41843733-41843755 CCACCTGCTTCCTCCTGCTCAGG - Exonic
1125758433 15:42081535-42081557 CCACCTGCTTCCTCCTGCTCAGG + Exonic
1126150955 15:45523006-45523028 GCGGCCTCTTCCACCTTCCCAGG + Intergenic
1126668995 15:51099276-51099298 CCACCCTCTGCCTCCTACAAGGG - Intronic
1127311095 15:57752980-57753002 CCATCCTTTGCCCCCTTCCCCGG - Intronic
1127462596 15:59212952-59212974 CCACACTCCTCCTCCTCCTCAGG - Intronic
1127960254 15:63885261-63885283 CCACCATCTTCCCACTGCCCAGG + Intergenic
1128219886 15:65961634-65961656 CCAGCCACTTCTTCCTTCCCAGG + Intronic
1128614617 15:69099439-69099461 CCACCCCCATCCCCCTTCACAGG - Intergenic
1129227801 15:74180006-74180028 CTACCATCCTCCTCCCTCCCCGG - Exonic
1129241204 15:74253240-74253262 ACAGCCTCCTCCTCCCTCCCTGG + Intronic
1130402978 15:83574349-83574371 CCATCCTCTTCTTCCATCTCAGG + Intronic
1130552008 15:84895249-84895271 CCACCCACTGGCTCCTGCCCTGG - Intronic
1130682058 15:86005619-86005641 CCCTCCTCCTCCTCCTCCCCTGG - Intergenic
1130767088 15:86881601-86881623 CTGCCATCTTCCTCCTCCCCTGG - Intronic
1131084006 15:89560193-89560215 CACCCCTCTTCCTCCCTGCCTGG + Intergenic
1131174434 15:90201252-90201274 CTTCCCCCTTCCTCCTTCCCGGG - Intronic
1131383773 15:91985938-91985960 GCACCCTCTTCCCCCAACCCAGG - Intronic
1131526687 15:93158376-93158398 CCCCACTCTGCCTCTTTCCCTGG - Intergenic
1131813837 15:96201888-96201910 CCTCCCTCTTCCTCTTCCTCTGG + Intergenic
1132299901 15:100768912-100768934 CCTCCCTCTACCACCTTCCCTGG + Intergenic
1132375765 15:101327294-101327316 TCACCCTCTAGGTCCTTCCCAGG + Intronic
1132638055 16:963020-963042 CCACCCTCTTCCTCCTCACTTGG - Intronic
1132666443 16:1083236-1083258 CCGCCCTCCTCGTCCTGCCCGGG - Intergenic
1132797946 16:1734447-1734469 CCACCCTCTCCTTCCTGGCCAGG - Intronic
1132854729 16:2039622-2039644 CTCCCCACTTCCTCCCTCCCAGG + Intergenic
1132875795 16:2136315-2136337 CCACCCTGATCCTTCTTCCGCGG + Intergenic
1132997686 16:2831709-2831731 GCGCCCCCATCCTCCTTCCCGGG - Intronic
1133041058 16:3059870-3059892 CCACCCACCTCCTCCTCCCCAGG + Exonic
1133102221 16:3486400-3486422 CCTCCCTCTCCCTCCTCCTCAGG - Exonic
1133258531 16:4533717-4533739 CCACCCCCGTACTCTTTCCCTGG + Intronic
1133294313 16:4743466-4743488 TCTCCCTCCTCCTCCTTCCTGGG + Intronic
1133794501 16:9035060-9035082 CTTCTCTCTTCCTCCTGCCCTGG - Intergenic
1133819846 16:9226435-9226457 CCTCCCACCTCATCCTTCCCAGG + Intergenic
1134060321 16:11195646-11195668 CAATCCTCTTGCTCCTTCCAAGG - Intergenic
1134562014 16:15219040-15219062 CCACCCACTTCCCCCTCCTCAGG + Intergenic
1134922552 16:18130666-18130688 CCACCCACTTCCCCCTCCTCAGG + Intergenic
1135055590 16:19229395-19229417 TCACTCTCTTCCTCCTGCTCTGG - Intronic
1135707639 16:24688452-24688474 CCACACTTTTCCTGCTTCCCTGG - Intergenic
1136012300 16:27371794-27371816 CCACCTCCTGCCTGCTTCCCTGG + Intergenic
1136134004 16:28243102-28243124 TCACCCACTTCCACCTTCTCAGG + Intergenic
1136381570 16:29898477-29898499 GCAGTCTCTGCCTCCTTCCCTGG + Intronic
1136491109 16:30609109-30609131 CTACCCTCTGCCTCCTTTCCAGG - Intronic
1136714919 16:32271028-32271050 CCCCCCTCTTCCTTCTGCCATGG - Intergenic
1136752998 16:32658702-32658724 TCCCCCTCTTCCTTCTTCCATGG + Intergenic
1136815115 16:33211662-33211684 TCCCCCTCTTCCTTCTTCCATGG - Intronic
1136821591 16:33321742-33321764 TCCCCCTCTTCCTTCTTCCATGG - Intergenic
1136828154 16:33378281-33378303 TCCCCCTCTTCCTTCTTCCATGG - Intergenic
1136833220 16:33477052-33477074 TCCCCCTCTTCCTTCTTCCATGG - Intergenic
1137585304 16:49660699-49660721 CCACACCCTTGCTGCTTCCCTGG - Intronic
1137725444 16:50653657-50653679 CCTTCCTCTTCCTCCTTAGCTGG - Intergenic
1138166416 16:54805845-54805867 TTGCTCTCTTCCTCCTTCCCAGG - Intergenic
1138198986 16:55075048-55075070 CCAACCCCTTGCTCCTTCACCGG - Intergenic
1138228819 16:55323581-55323603 CCACCCCCTCACTCCATCCCAGG - Intergenic
1138506351 16:57480150-57480172 CGACCCTCCTCCTCCATCTCTGG - Intronic
1139298300 16:65922123-65922145 CCCCCGTCTTCCTCTTTCACTGG + Intergenic
1139469814 16:67172101-67172123 CCCTCCTCTGCCTCCTTCTCTGG - Intronic
1139474026 16:67193526-67193548 CCACCCCCTTACCCCTACCCAGG - Intronic
1139514966 16:67447424-67447446 TCCTCCTCTTCCTCCTTGCCTGG + Intronic
1139582579 16:67882190-67882212 TCACCCTCTTCCCCTCTCCCAGG + Exonic
1140243541 16:73227443-73227465 CCACCTTTTTCTTCCTTCCATGG + Intergenic
1140343071 16:74184464-74184486 CCTGCCTCTGCCTCCTCCCCAGG - Intergenic
1140480328 16:75258955-75258977 CCCTCCTCCTCCTCCTTCCCAGG - Intronic
1141468210 16:84221093-84221115 CCTCCATCTGCCTCCTCCCCTGG + Exonic
1141694583 16:85613567-85613589 CCACCCCCTTCCTCCGCCCGCGG + Intronic
1141817315 16:86421093-86421115 CCTCTCTCTTCCTCCTACTCTGG - Intergenic
1141944930 16:87303422-87303444 CCACCCTCTCCCCCCACCCCCGG + Intronic
1142181690 16:88674342-88674364 ACACCCTCTTCCTCTTGTCCAGG + Intergenic
1142225538 16:88875475-88875497 CAGCCCTCTGCCTCCTCCCCAGG - Exonic
1142440372 16:90094188-90094210 CCACCCGGTTCCACCGTCCCCGG - Intergenic
1202993692 16_KI270728v1_random:34637-34659 TCCCCCTCTTCCTTCTTCCATGG - Intergenic
1203055134 16_KI270728v1_random:918741-918763 CCCCCCTCTTCCTTCTGCCATGG + Intergenic
1142471900 17:169347-169369 GCTCCCCCTTCCTCCTCCCCTGG - Intronic
1143028604 17:3954937-3954959 CCACCCTGATCCTCCGTGCCCGG - Intronic
1143129970 17:4671935-4671957 CCACGCTCCTCCTCCGTCCCTGG + Exonic
1143317250 17:6041950-6041972 CCCCTCTCTTGCTCCTTCCCTGG - Intronic
1143327379 17:6108345-6108367 CCACCCACTGCCTCCCTCCCTGG + Intronic
1143477171 17:7209270-7209292 CTGCCCTTTTCCTCCTTCTCTGG - Intronic
1143519634 17:7438047-7438069 CCAACCTCTCCTTCCTACCCAGG + Intergenic
1143575671 17:7791807-7791829 CCTGGGTCTTCCTCCTTCCCTGG - Intronic
1143655582 17:8291642-8291664 CCACCCCATTGTTCCTTCCCTGG + Intronic
1143855414 17:9844449-9844471 CCTCCCTCTTCTTCCACCCCTGG - Intronic
1145242374 17:21247536-21247558 CCACCACCTTCCTCCCTCCTGGG - Intronic
1146001162 17:29131381-29131403 ACAGCCCCTTCCTCCTTGCCAGG + Intronic
1146172460 17:30644490-30644512 GCAACCTCTGCCTCCCTCCCGGG - Intergenic
1146181903 17:30703807-30703829 CCATCCTCTCCATCCTTCCAGGG + Intergenic
1146255474 17:31389689-31389711 CCACTCCCTACCTCCTTGCCAGG + Intergenic
1146274587 17:31508627-31508649 CCTCCCTCTTGGTGCTTCCCAGG + Intronic
1146345913 17:32060501-32060523 GCAGCCTCTGCCTCCCTCCCGGG - Intergenic
1146720661 17:35121290-35121312 CCATCCTTATTCTCCTTCCCAGG + Exonic
1146846521 17:36184581-36184603 CCTCCCCATTCCTCCTCCCCCGG + Intronic
1147121793 17:38339398-38339420 CCATCCTCCTCATCCTTACCTGG + Exonic
1147441957 17:40452893-40452915 CCACCCACGTTCTCCTTCCTGGG - Intronic
1147535656 17:41320874-41320896 TCTCTCTCTTCCTCCTGCCCTGG - Intergenic
1147653053 17:42072778-42072800 CCCCTCTCTTCCTCCCACCCGGG - Intergenic
1148215656 17:45832883-45832905 CCACTGTCTACCTCCTGCCCCGG + Intronic
1149005581 17:51801960-51801982 ACACCCTGCACCTCCTTCCCAGG - Intronic
1149122450 17:53185772-53185794 CCACCTTCTTCCACTGTCCCTGG - Intergenic
1149430382 17:56592776-56592798 CCATCCTCCTCCTCCTTGGCCGG - Intergenic
1149604569 17:57915796-57915818 CCAGCTTGTTCCGCCTTCCCAGG - Intronic
1149608271 17:57940191-57940213 CCATCCCATGCCTCCTTCCCTGG + Intronic
1149866512 17:60154068-60154090 CCACCCTCTCCCTTCTTGCCTGG - Intronic
1150439466 17:65179526-65179548 CCACCCTCTCTCTCCTCCCCAGG - Intronic
1150490707 17:65572686-65572708 CCTACCTCCCCCTCCTTCCCTGG - Intronic
1150640727 17:66947886-66947908 CCTCCATCTGCCTCTTTCCCTGG + Intergenic
1151053566 17:71006589-71006611 CCTCTCTCTTCCTCCTGCTCTGG + Intergenic
1151069271 17:71189717-71189739 CCTCTCTCTTCCTCCTTCCCCGG - Intergenic
1151101541 17:71561694-71561716 ACACCCTTTTCCTCCCTGCCAGG - Intergenic
1151248651 17:72816373-72816395 CCACCCTCATTCTCCTGCCAGGG + Intronic
1151249945 17:72826243-72826265 TCACTCTCTTCCTCTTTCTCTGG + Intronic
1151274835 17:73026437-73026459 GCAACCTCTGCCTCCCTCCCGGG - Intronic
1151364878 17:73610724-73610746 ACACCCTCTCCATCCTTCCTGGG - Intronic
1151579999 17:74972380-74972402 CCACCCTCAGCCTCCTCTCCTGG - Intronic
1151728357 17:75897070-75897092 CCGCCCCCCTCCGCCTTCCCGGG - Intergenic
1151785406 17:76272659-76272681 CCTGCCTCTGCCTCCTGCCCGGG + Intergenic
1151844266 17:76640266-76640288 CCACCCTGCCCCTCCCTCCCAGG - Intronic
1152243818 17:79175046-79175068 CCTTCCTCTTCCTCCATACCTGG + Intronic
1152253047 17:79221673-79221695 CCACCCTGTCACTCCTTCCATGG + Intronic
1152324502 17:79627733-79627755 CCTCTCTCCTCCTCCTTCTCTGG + Intergenic
1152404778 17:80090997-80091019 CCTCCCTGTCCCTTCTTCCCCGG + Intronic
1152957189 18:49370-49392 CCACCCGGTTCCACCGTCCCCGG + Intronic
1152962448 18:87950-87972 CCACCCTTGTCCACCTTCCTGGG - Intergenic
1153060659 18:991570-991592 CTTCCTTCTTCCTCCTTCCCTGG + Intergenic
1154323837 18:13375757-13375779 GCACCCTCTTCCTCCCTGCCAGG + Intronic
1156365670 18:36424456-36424478 CCCCTCTCCTCCTCCTTCCCTGG + Intronic
1156426107 18:37014646-37014668 CCCCTCTCTTCCTCCTGCTCTGG - Intronic
1156914495 18:42449026-42449048 TCTCTCTCTTCCTCCTTCTCTGG - Intergenic
1157516339 18:48314499-48314521 CTGCCCTTTTCCTCCTTCACTGG - Intronic
1157580576 18:48771736-48771758 ACCTCCTCCTCCTCCTTCCCCGG + Intronic
1157583648 18:48787639-48787661 CCTGCCTCTTCTTCCTTCTCAGG - Intronic
1157592755 18:48845486-48845508 CCACCCTTTTCTTCCTTCTTTGG + Intronic
1157595972 18:48863835-48863857 CAACTCCCTTCCTCCTTCCCTGG + Intergenic
1157768994 18:50327818-50327840 CCATCCCCTCCCGCCTTCCCCGG - Intergenic
1157836395 18:50907230-50907252 CCAGCCCCTTCTTCCTGCCCTGG + Intronic
1157957227 18:52111991-52112013 CCATCCTCTTGCTCCTGCTCTGG - Intergenic
1158129012 18:54132285-54132307 CCACTCTCTTGCTCCTGCTCTGG + Intergenic
1158164182 18:54520458-54520480 TCACCATATTCCTCCTTCCAGGG + Intergenic
1158233955 18:55291703-55291725 CCACCCTCTTCCCTCCTGCCCGG + Intronic
1158688122 18:59633066-59633088 ACAGCCTCCTCCTCCTTCCCTGG + Intronic
1159030851 18:63229586-63229608 CCTCTCTCTTACTCCTTCTCTGG + Intronic
1159798310 18:72868526-72868548 GCCCCCTCTCCCTCCCTCCCTGG + Intergenic
1159840969 18:73398749-73398771 TCTCACTCTTCCTCCTTCTCTGG - Intergenic
1159958186 18:74534522-74534544 CCAGCCTCGTCTTCCTTCCGGGG + Exonic
1160011517 18:75110057-75110079 CCTCCCTCTCCCTCCTCCCCTGG - Intergenic
1160345620 18:78129459-78129481 CCACACTCTTGCTCCTGCTCCGG - Intergenic
1160460024 18:79032044-79032066 TCACTCTCTTCCTCCTTCTCCGG - Intergenic
1160605336 18:80045752-80045774 GAAGCCTCTTCTTCCTTCCCAGG + Exonic
1160773351 19:843662-843684 CCGCCCTCTTCCTCCAGCCCTGG + Intronic
1160864581 19:1251111-1251133 TCCCCCTCCTCCTCCCTCCCCGG - Intronic
1160915314 19:1493505-1493527 CAGCCTTCTTCCTCCTCCCCTGG - Intronic
1160941418 19:1622024-1622046 CCACCCCCTGCCCCCTGCCCTGG + Intronic
1160952701 19:1675349-1675371 GCACCTTCTTCCTTCTGCCCTGG - Intergenic
1161038792 19:2099194-2099216 CCACCCCCTGCCTCCCTCCCTGG - Intronic
1161248920 19:3270337-3270359 CCTCCCTCCTCCACCTTCTCTGG - Intronic
1161270514 19:3387073-3387095 CCTCCCTCTCCCTCTATCCCAGG - Intronic
1161391558 19:4023866-4023888 CCTCCCTCATCCTCCTTCCTGGG + Intronic
1161634348 19:5377783-5377805 TCATCCTCTTCCTCCTTCTGTGG - Intergenic
1161934946 19:7365814-7365836 GCACCCTCCTTCTCCTTCCCTGG + Intronic
1161985397 19:7650643-7650665 CCACCCTCTGCCCCCTCCCCAGG - Intergenic
1162070088 19:8148075-8148097 TTACCATCTTCCTCCTACCCTGG - Intronic
1162131737 19:8530237-8530259 CCACCCGCTCCCTCTTGCCCAGG + Exonic
1162176437 19:8833047-8833069 CCACCCACTGCCCCCTCCCCAGG - Intronic
1162500283 19:11049562-11049584 GCAACCTCTGCCTCCCTCCCTGG + Intronic
1162548538 19:11345628-11345650 CCACCCGGTGCCTCCTTCCCAGG - Exonic
1162569236 19:11461383-11461405 CCAGCCTCTTCCCCAGTCCCTGG - Intronic
1162976935 19:14211984-14212006 CCATCCTCTCCATCCTTCCAGGG - Intergenic
1163002331 19:14376025-14376047 CCACCCTCTTTCCCGTTCTCTGG + Intergenic
1163015456 19:14451528-14451550 CTACCCTGTTCCTGCTTGCCTGG + Intronic
1163120669 19:15215573-15215595 CCACCCTCTCCTTCCTCCTCTGG - Intergenic
1163275101 19:16278668-16278690 GCAACCTCTACCTACTTCCCGGG + Intergenic
1163479914 19:17549009-17549031 ACATCCTCTCCCTCATTCCCTGG - Intronic
1163511692 19:17739404-17739426 CCACACTCTTCCCCCTTTGCGGG - Intergenic
1163779653 19:19239712-19239734 CCTCCCTCCTGCTCCTCCCCAGG + Intronic
1164100778 19:22052658-22052680 CCACCCCCTTCCCCTCTCCCAGG - Intronic
1164548556 19:29188915-29188937 CGATCCTCTTCCTTCTTCCCAGG - Intergenic
1164723713 19:30451308-30451330 ACATCATCCTCCTCCTTCCCCGG + Intronic
1164800086 19:31068954-31068976 TCACCTTCCTCCTCCTCCCCTGG + Intergenic
1164871436 19:31647579-31647601 CCACCCTCTTCCTCCTGCTCTGG - Intergenic
1164878107 19:31707150-31707172 ACCACTTCTTCCTCCTTCCCAGG - Intergenic
1165258168 19:34592483-34592505 CCTCCCTCTCCCTCCCACCCAGG - Intergenic
1165316751 19:35060601-35060623 CCACCCTCCACCCCTTTCCCTGG + Intronic
1165772181 19:38386225-38386247 CCACCCTACACCACCTTCCCAGG - Exonic
1165884934 19:39071310-39071332 GCAACCTCTGCCTCCCTCCCAGG + Intergenic
1166139692 19:40799374-40799396 GCACCCACATCCCCCTTCCCGGG - Intronic
1166155642 19:40909372-40909394 ACACCTTCCTCCTCCCTCCCAGG - Intergenic
1166179167 19:41094937-41094959 ACACCTTCCTCCTCCCTCCCAGG + Exonic
1166332995 19:42089492-42089514 CCACCCGCTTCCATCTGCCCTGG + Intronic
1166347334 19:42174926-42174948 CCACTTTCTGCCTCCTTCCTGGG - Intronic
1166432967 19:42741984-42742006 CCACACACCTGCTCCTTCCCTGG - Intronic
1166436073 19:42767210-42767232 CCACACACCTGCTCCTTCCCTGG - Intronic
1166438484 19:42789653-42789675 TCTCTCTCTTCCTCCCTCCCAGG - Intronic
1166445955 19:42857238-42857260 CCACACACCTGCTCCTTCCCTGG - Intronic
1166448935 19:42881198-42881220 CCACACACCTGCTCCTTCCCTGG - Intronic
1166453334 19:42919389-42919411 CCACACACCTGCTCCTTCCCTGG - Intronic
1166465612 19:43027973-43027995 CCACACACCTGCTCCTTCCCTGG - Intronic
1166471754 19:43084177-43084199 CCACACACCTGCTCCTTCCCTGG - Intronic
1166482890 19:43187993-43188015 CCACACACCTGCTCCTTCCCTGG - Intronic
1166485373 19:43207126-43207148 CCACACACCTGCTCCTTCCCTGG - Intronic
1166492519 19:43271045-43271067 CCACACACCTGCTCCTTCCCTGG - Intergenic
1166795521 19:45423346-45423368 ACCCCCTCTTTGTCCTTCCCAGG + Exonic
1167093397 19:47359946-47359968 CCACCCCCTCCCTTCCTCCCAGG + Exonic
1167757377 19:51421314-51421336 GCACCGTCTTCCTCCTCCCGCGG + Intergenic
1167882415 19:52471030-52471052 CCACCCACTTCCTCCTGTTCTGG + Intronic
1168416446 19:56172126-56172148 CCTCTCTCTTCCTCCCTTCCTGG - Intergenic
1168428963 19:56262091-56262113 GCAACCTCTGCCTCCCTCCCAGG + Intronic
1168475741 19:56673716-56673738 CCACCCACTCCATCCTACCCAGG - Intergenic
1168511598 19:56978037-56978059 CCACCCTCATCCTCCTTTCTAGG + Intergenic
925023156 2:587700-587722 GCGCCCTCTTCCTCCCTCCGTGG - Intergenic
925101860 2:1253839-1253861 TCCCTCTCTTCCTCCTTCTCTGG - Intronic
925229754 2:2222414-2222436 GCAACCTCTGCCTCCCTCCCAGG - Intronic
925347318 2:3179992-3180014 CCTGTCTCTTCCTCCTTCCCCGG + Intergenic
925644382 2:6020992-6021014 TCGCCCTCTTCCTCCTGCCTTGG + Intergenic
925653336 2:6116630-6116652 ACTCTCTCTTCCTCCTTCTCTGG + Intergenic
925861023 2:8174952-8174974 CCACCCTCCACCTCTTTTCCTGG + Intergenic
926074075 2:9926491-9926513 CTAACCTCTTCCTCTATCCCTGG + Intronic
926285352 2:11483096-11483118 ACACCTTCCACCTCCTTCCCGGG - Intergenic
926781655 2:16478089-16478111 GCACCCGCCTCCTCCTTTCCCGG - Intergenic
926887620 2:17612563-17612585 TCACAGTCTTCCTCCTTCCCTGG - Intronic
927093395 2:19729179-19729201 TCCCCTTCTTCCTCCTACCCAGG - Intergenic
927142057 2:20137333-20137355 CCACCCTCCTCCTCAGGCCCCGG + Intergenic
927441927 2:23124937-23124959 CCACCTGCTTCTTCATTCCCAGG + Intergenic
927446181 2:23163954-23163976 CCCCCCTCTTCCTACTCCTCAGG + Intergenic
927811690 2:26184122-26184144 CCTTCCTCTTCCGCCCTCCCGGG - Intronic
928093094 2:28388252-28388274 CCACCTCCTACCTCCTTCTCTGG - Intergenic
928160804 2:28922524-28922546 CGCCTCTCTTCCTCCATCCCCGG - Intronic
928173782 2:29020767-29020789 CCAACCTCCCCATCCTTCCCTGG - Intronic
928317794 2:30259231-30259253 GCACCCTCGTCCTCCTGCCCCGG - Exonic
928404820 2:31006645-31006667 CCTCCTCCTTCATCCTTCCCAGG - Intronic
928407993 2:31029612-31029634 CCCCTCTCTTTCCCCTTCCCCGG + Intronic
928619843 2:33077503-33077525 CCTCTCTCTTCCTCCTGCTCTGG - Intronic
928714381 2:34043429-34043451 CTTCCCTCTTACTGCTTCCCTGG + Intergenic
928954993 2:36856870-36856892 CCCCCTTCTTCCTCCTGCTCCGG + Intronic
929017544 2:37513890-37513912 TCTCTCTCTTCCTCCTTCTCTGG - Intergenic
929329627 2:40665605-40665627 TCAACCTCTTCCTCCTTCTCAGG + Intergenic
929431741 2:41893198-41893220 CCTTCCCCTTCCTCCCTCCCCGG + Intergenic
930142140 2:47963350-47963372 CCACCCTCTTCTTGCTTGCATGG + Intergenic
930237334 2:48900620-48900642 CCAGCCTCTCCCTCCTTCCATGG - Intergenic
931384616 2:61786896-61786918 CCATTCTCTTCCTCCTTTCAGGG - Intergenic
931396502 2:61892447-61892469 CCACCCTCCTCCGCCTCCCAAGG - Intronic
931627454 2:64269832-64269854 CCCTCCTCTTCCTCCTCCTCAGG + Intergenic
931632098 2:64310914-64310936 CCTTCCTCTTCCTCCAACCCTGG + Intergenic
931845943 2:66203936-66203958 CACTCCTCTTCCTCCTGCCCTGG - Intergenic
931966137 2:67536863-67536885 CCTCTCTCTTCCTCCTGCTCTGG + Intergenic
932414364 2:71564797-71564819 GCTCCCTCTTCCTCCTTTCCAGG + Intronic
932493076 2:72133744-72133766 CCAGCCCCTTCCTCCATCGCAGG + Intronic
932572963 2:72947551-72947573 CCACCTTCTGCCCACTTCCCAGG - Intronic
932754523 2:74397504-74397526 GCAACCTCTGCCTCCCTCCCAGG - Intergenic
933833114 2:86226153-86226175 TCATCCTCATCATCCTTCCCAGG + Intronic
933850719 2:86364548-86364570 CCACCCCCTTGCTCCTGCTCTGG - Intergenic
934055331 2:88246835-88246857 GCTCCCTCTTCCTCCTACTCCGG + Intergenic
934073652 2:88408954-88408976 GCAACCTCTACCTCCTTCCTGGG - Intergenic
934554652 2:95281008-95281030 CCACCCTGTTCCTGGTTCCCTGG - Intronic
934645753 2:96058541-96058563 GGACTCTCTCCCTCCTTCCCTGG - Intergenic
934653955 2:96107806-96107828 CCACCCGCTTCCACCTGCCCTGG + Intergenic
934839157 2:97614630-97614652 GGACTCTCTCCCTCCTTCCCTGG - Intergenic
935123245 2:100200008-100200030 CCTCCCTCTTCCTCCTGCTCTGG + Intergenic
935140618 2:100349999-100350021 TCTCTCTCTTCCTCCTTCTCTGG + Intergenic
935235877 2:101138063-101138085 TCTCCCTCTTCCTCCTGCTCCGG - Intronic
936010568 2:108922665-108922687 CCACCCTCTGGCTCCTTCAAGGG - Intronic
936100237 2:109571093-109571115 GCACTCTCCTCCTCCTTCTCAGG + Intronic
936234838 2:110733361-110733383 CAACCCTCTGCCTGCTTCTCAGG - Intronic
937114764 2:119397283-119397305 CCAGCCTGTTCCTCCTCCTCAGG - Intergenic
937137709 2:119569025-119569047 CCACTCTCTTCTTGCTTCCATGG + Intronic
937144038 2:119627106-119627128 CCAGACTCTTCCTCCCTTCCTGG + Intronic
937334536 2:121053906-121053928 CCACTCTCTTGCTCCTGCTCTGG + Intergenic
937917276 2:127105488-127105510 TCCTCCTCCTCCTCCTTCCCTGG + Intronic
938133600 2:128736708-128736730 CCACCCTCATCCTCCCACCCAGG + Intergenic
938169123 2:129059172-129059194 ACACCCTCTTCCCCCTTCCAAGG - Intergenic
938181548 2:129189313-129189335 GCACCATCATCCTCCTTCCCTGG - Intergenic
938186865 2:129239874-129239896 GCAGCCTCTTCCTCCCTTCCCGG + Intergenic
938459584 2:131489003-131489025 CCACCTGCCTCCTCCTGCCCTGG + Intronic
938730642 2:134144337-134144359 CCTCTCTCTTCCTCCTGCTCTGG - Intronic
939688331 2:145227069-145227091 CCACTTTCTTCCTCTTTCCTGGG + Intergenic
939743493 2:145939279-145939301 CAATCCTCTTGCTCCATCCCTGG - Intergenic
939822165 2:146970530-146970552 TCACCCTCTTCCTCCTGTTCTGG - Intergenic
939909574 2:147963294-147963316 CAACCCTGCTCCTACTTCCCAGG + Intronic
940416544 2:153428966-153428988 ATACCCTCTTCTTCCTACCCTGG + Intergenic
941373989 2:164705079-164705101 CCTCACTCTTCCTGCTTCACAGG + Exonic
941432300 2:165427079-165427101 CCATCCCCCACCTCCTTCCCAGG - Intergenic
941784804 2:169485692-169485714 CCACCCTTTTCCCCTTGCCCTGG + Intronic
941844880 2:170122500-170122522 CCTCCCTCCCCCTCCTCCCCTGG + Intergenic
942344025 2:174982662-174982684 TCACTCTCTTCCTCCTTTGCTGG + Intronic
942565069 2:177257888-177257910 CCATCCTCTACCTCCTTCTATGG + Intronic
943476540 2:188364470-188364492 GCTCCCTCTTCATCCTTCCCTGG - Intronic
944257788 2:197641400-197641422 CCTCCCTCTTCTTCTCTCCCAGG - Intronic
945125720 2:206507418-206507440 GCATCCTCTTCCTCCTGCTCTGG + Intronic
945356423 2:208844376-208844398 TCACTCTCTTCCTCCTTGTCTGG + Intronic
945411713 2:209517130-209517152 CCTCCCTCTTCCGCCATACCTGG + Intronic
945469526 2:210211598-210211620 TCTCTCTCTTCCTCCTTCTCTGG + Intronic
945589777 2:211715682-211715704 CCTCTCTCTTCCTCCTGCTCTGG + Intronic
946072265 2:217044571-217044593 ACAGCCTCTTCATCATTCCCTGG + Intergenic
946340847 2:219067238-219067260 CCACCCACTTCCGCCTCCCTGGG - Intergenic
946371258 2:219282899-219282921 ACCTTCTCTTCCTCCTTCCCTGG + Exonic
946408993 2:219507225-219507247 CCTCCCTGTTCCTCCTCACCGGG + Intergenic
946508555 2:220328507-220328529 CAACCCTCATTCACCTTCCCAGG + Intergenic
946772103 2:223099590-223099612 TGACTCTCTTCTTCCTTCCCTGG + Intronic
947274356 2:228373430-228373452 CCCCTCTCTTCCTCCTGCTCTGG - Intergenic
947373766 2:229474790-229474812 CCACCACCTTGCTCCTTCTCAGG + Intronic
947978350 2:234386906-234386928 CCACTCTTTTCATCCTCCCCAGG - Intergenic
948528875 2:238590193-238590215 CCAACCTTTGCCTCCTTGCCTGG - Intergenic
948666122 2:239535874-239535896 ACCCCCTCTGCCTCCCTCCCCGG + Intergenic
948689707 2:239694170-239694192 GCCCCCACTTCCTCCCTCCCGGG - Intergenic
948705904 2:239792356-239792378 CCAGCCCCTTCTGCCTTCCCAGG + Intronic
948786196 2:240354211-240354233 GCACTGTCTTCCTTCTTCCCAGG + Intergenic
948893426 2:240917627-240917649 CCACCCAAGTCCTCCTTGCCTGG - Intergenic
949012665 2:241690106-241690128 TCACCCTCCTCCCCCGTCCCAGG - Intergenic
949061382 2:241959965-241959987 ACATCCTCCTCCTCCTTCTCTGG + Intergenic
1168746795 20:250132-250154 CCACTCTCTTGCTCCTGCTCTGG + Intergenic
1168830831 20:844511-844533 ACACCCCCTCCCTCCTGCCCCGG - Intronic
1168876159 20:1173698-1173720 CCACACCCTTCCCCCTGCCCAGG - Intronic
1169193503 20:3671779-3671801 CCCCCCTCTACTTCCTCCCCAGG - Exonic
1169255156 20:4091509-4091531 CCTCTCTCCTCCTCTTTCCCGGG - Intergenic
1169621703 20:7514204-7514226 CCATCCTCTTCTTCATTCCTCGG + Intergenic
1169643294 20:7779142-7779164 CCACTCTCTTGCTCCTGCTCTGG + Intergenic
1170605770 20:17874212-17874234 CCAAGCTCTCCCTCCTGCCCAGG - Intergenic
1170907168 20:20527078-20527100 GCACCCTCTGCTTCCCTCCCTGG + Intronic
1170941540 20:20852467-20852489 TCACACTCTTCCTCCTTCTCCGG - Intergenic
1171365159 20:24618044-24618066 CCCGGCTCTTCCTGCTTCCCGGG - Intronic
1172020630 20:31911354-31911376 CCACCCTCCTGCTCCCTCCCTGG - Intronic
1172028834 20:31967917-31967939 TCACCCTCTCCCTCCTTCCTCGG - Intergenic
1172199938 20:33118331-33118353 CCAGTCTCTTCCTCCTTCCCTGG - Intergenic
1172422037 20:34825665-34825687 CCTCCCTCCCCCTCCCTCCCCGG - Intergenic
1172511972 20:35507113-35507135 CCAAGCTCTTCCTCTCTCCCAGG + Intronic
1172906837 20:38376811-38376833 CCACCCTCCTCCTCTTCACCAGG + Exonic
1173135217 20:40433340-40433362 GCATCCTCCTCCTCCTCCCCAGG - Intergenic
1173310953 20:41895459-41895481 CCTCCCTCCTCCTCTGTCCCTGG + Intergenic
1174189752 20:48731913-48731935 CTGGCATCTTCCTCCTTCCCAGG + Intronic
1174903713 20:54527628-54527650 CTACTCACTTCCACCTTCCCAGG - Intronic
1175278807 20:57788906-57788928 TCCTTCTCTTCCTCCTTCCCTGG - Intergenic
1175327620 20:58140661-58140683 CCACCCTCTTCCAGCTTCTGGGG + Intergenic
1175337779 20:58207217-58207239 CCACCTTCTTCCTGCATCCCGGG + Intergenic
1175534076 20:59695362-59695384 TCATTCTCTTCCTCCTTCTCCGG + Intronic
1175713110 20:61236818-61236840 CCACCCTCTTCTTCCTGCTTTGG + Intergenic
1175972285 20:62692693-62692715 CCACCCTGTTCCTGCCTGCCCGG - Intergenic
1176027440 20:62993320-62993342 CCAGCCTCTGCCTGCCTCCCAGG - Intergenic
1176410084 21:6444952-6444974 CTCCCGTCTTCCTCCTCCCCTGG - Intergenic
1176980598 21:15376763-15376785 ACATCCTCCTCCTCCATCCCTGG + Intergenic
1177179921 21:17734119-17734141 CCTCTCTCTTCCTCCTGCTCTGG - Intergenic
1177645774 21:23898631-23898653 CCTCACTCTTCCTCCTGCTCTGG - Intergenic
1178343278 21:31804137-31804159 CCAGCCACTTCCTCCTTTCAGGG - Intergenic
1178883109 21:36464174-36464196 TCTCTCTCTTCCTCCTTCTCCGG + Intronic
1179388100 21:40961079-40961101 CCACCCCATTCCTCCATCTCAGG - Intergenic
1179523183 21:41958637-41958659 CCACCCTCTTGCTCCCTCCCGGG + Intergenic
1179580966 21:42343689-42343711 CCACCCCCTTCCTCCTCCTTTGG - Intergenic
1179685577 21:43053274-43053296 CTCCCGTCTTCCTCCTCCCCTGG - Exonic
1180038545 21:45263815-45263837 CTACCCTGTTCCTCCATGCCTGG + Intergenic
1180064110 21:45404523-45404545 CCAGGCTCCTCCTCCCTCCCAGG - Intergenic
1180608486 22:17079940-17079962 ACAACCTCTGCCTCCCTCCCAGG + Intergenic
1180700355 22:17778231-17778253 CAAACCTTTCCCTCCTTCCCAGG + Intergenic
1181000792 22:19987017-19987039 CCGCCCTCTGCCTCCGACCCCGG + Intronic
1181182499 22:21077963-21077985 CCACCTCCCTCCTCCTGCCCTGG + Intergenic
1181410218 22:22713254-22713276 TCACCCTCTTGCTCCAGCCCCGG + Intergenic
1181417768 22:22772637-22772659 TCACCCTCTTGCTCCAGCCCCGG + Intronic
1181437781 22:22920410-22920432 CCACCCTGTTCCTGACTCCCAGG + Intergenic
1181536539 22:23549234-23549256 CCACTCTCTGCCCCCTTGCCCGG + Intergenic
1181683440 22:24512236-24512258 TCACACTCTTCCTCCAGCCCTGG - Intronic
1181729045 22:24831420-24831442 CCAAGGTCTTGCTCCTTCCCGGG - Intronic
1181825539 22:25512523-25512545 CCACCCCCTTCCTCATTCAGTGG + Intergenic
1181963722 22:26642059-26642081 GCAACCTCCTCCTCCTTCACTGG - Intergenic
1182402069 22:30086150-30086172 TCCCTCTCTTCCTCCTTCTCTGG + Intronic
1182584323 22:31335239-31335261 CCAGACTCAACCTCCTTCCCTGG + Intronic
1183197466 22:36363308-36363330 CAACCCTCTTGCTCTTGCCCAGG + Intronic
1183250426 22:36726266-36726288 CCACCATCACCCTGCTTCCCAGG - Intergenic
1183310728 22:37108239-37108261 CCACACTCTTCCTTCTGCCTGGG + Intronic
1183382084 22:37495402-37495424 ACACTCCCTCCCTCCTTCCCTGG - Intronic
1183493451 22:38128630-38128652 CCTCCCATATCCTCCTTCCCTGG - Intronic
1183602183 22:38846208-38846230 CCAGCCTCTCCCTTCTTCCTTGG + Intergenic
1183637029 22:39070371-39070393 CCTTCCTCCTCCTCCTTCCCAGG + Intronic
1183964686 22:41434637-41434659 CCACCCACTCCATCCTACCCAGG - Exonic
1184039706 22:41935561-41935583 CCAGCCTCTTCCTTCTGCCCTGG + Intergenic
1184090120 22:42288626-42288648 GCAACCTCTGCCTCCCTCCCAGG - Intronic
1184157956 22:42681116-42681138 CTCCTCTCTTCCTCCTTCCCCGG + Intergenic
1184265118 22:43342610-43342632 CCGGCCTCCTCCTCCTTCCCCGG + Intronic
1184272015 22:43389708-43389730 CCTCCCTCTTCCCCCTTGTCAGG + Intergenic
1184520543 22:44991478-44991500 TGATCCTCTGCCTCCTTCCCTGG - Intronic
1184678104 22:46054293-46054315 CCCCCCTCCTCCTGCTTCGCGGG + Intronic
1184846193 22:47088955-47088977 CCATCCGTTTCCCCCTTCCCTGG - Intronic
1184958834 22:47914012-47914034 CCTCCCTGTTCCTCTTGCCCTGG + Intergenic
1185149154 22:49154255-49154277 CCACCCTCTTCACCCTCCCCAGG - Intergenic
1185197130 22:49478691-49478713 CCCCTCTCTTCCTCCTGCTCTGG - Intronic
949280801 3:2344353-2344375 GCAACCTCTACCTCCTTCCTGGG + Intronic
949360918 3:3231324-3231346 TCACTCTCTTCCTCCTGCTCTGG - Intergenic
949520943 3:4853532-4853554 CCTCCCTGATCCTCCTTGCCTGG + Intronic
949905074 3:8852425-8852447 CCGCCCTCCGCCACCTTCCCTGG + Intronic
949942726 3:9167147-9167169 CCTCCCCCTTTCTCCTGCCCAGG - Intronic
949991630 3:9584040-9584062 TCTCCCTCTTCCTTCTTCCCTGG + Intergenic
950342165 3:12257321-12257343 TCACTCTCTTCCTCCTGCCCTGG - Intergenic
950571788 3:13804915-13804937 CCCTCCTCTTCCTCCTCCTCAGG + Intergenic
950575942 3:13832123-13832145 TCCCCCTCTTCCTCCTCCTCAGG + Intronic
950699420 3:14730056-14730078 CCAATCTCACCCTCCTTCCCAGG + Intronic
950972330 3:17201713-17201735 CCCCTCACTTCCTCCTTCTCTGG + Intronic
951172277 3:19555742-19555764 CCACCATCTTGCTCTGTCCCAGG + Intergenic
951194136 3:19804704-19804726 CCTCCCCCTTCCCCCTTCCTAGG - Intergenic
951778729 3:26339733-26339755 TCTCCCTCTTCCTTCTTCTCTGG - Intergenic
952316991 3:32239684-32239706 CCATGCCCTGCCTCCTTCCCAGG - Intronic
952420196 3:33123452-33123474 CCGCTCTCTTCCTTCTTCTCTGG + Intronic
952459060 3:33505037-33505059 TCATCAGCTTCCTCCTTCCCAGG + Intronic
952904279 3:38129388-38129410 TCCTCCTCTTCCTCCTCCCCAGG - Exonic
953211374 3:40878019-40878041 CCAACCTCCTGCTCCTTGCCAGG + Intergenic
953315705 3:41924799-41924821 CCATCCTCTTCCCTCATCCCTGG + Intronic
953446525 3:42973396-42973418 CCAACCTCTTCCTGTTACCCAGG - Intronic
953913672 3:46905185-46905207 AGACCCTCATCCTCCTCCCCAGG + Intergenic
953925744 3:46981638-46981660 CTACCCTAGTCCTCCTTCCTCGG + Intronic
954100022 3:48364393-48364415 CCACCCTCTTGCTCCTACTTTGG + Intergenic
954367047 3:50151755-50151777 GCAGCCTCCTCCTCCTTCCCAGG - Intergenic
954539500 3:51384464-51384486 CCAGCCTCCTCCTGCCTCCCCGG - Intergenic
954759245 3:52862007-52862029 CCAGCCTCTCCCTCCAGCCCTGG + Intronic
954862537 3:53702768-53702790 CCTCCTTCTTCCTCATTCTCCGG - Exonic
954879242 3:53822692-53822714 CCAGCTCCTTCCTCCTGCCCAGG - Intronic
955547419 3:60045923-60045945 CCACCCTAACCCTCCTTCCTGGG - Intronic
956342961 3:68247120-68247142 TCCCTCTCTTCCTCCTTCCCTGG + Intronic
956685594 3:71824629-71824651 CCACCCCCTCCCTCCCTCCAGGG - Intergenic
957857648 3:85898460-85898482 CCACTCTCTACCTCAGTCCCAGG + Intronic
958572956 3:95911652-95911674 GCACACACTTCCTCCTTCCAAGG - Intergenic
958745545 3:98129345-98129367 TCTCTCTCTTCCTCCTTCTCTGG - Intergenic
959064473 3:101642661-101642683 CCACTCTCTTCCTCCTGCTCCGG + Intergenic
959369523 3:105505343-105505365 TCACTCTCTTCCTCCTTCTCTGG - Intronic
959529572 3:107417715-107417737 CCACTCTCTTCTTGCTTGCCTGG - Intergenic
959661144 3:108869319-108869341 CCTCCCTGTTCCTCTTTCCTAGG + Intergenic
960316156 3:116179613-116179635 TCACTCTCTTCCTCCTGCTCCGG - Intronic
960487679 3:118273004-118273026 CCACCCACTACCTCATTCCCTGG - Intergenic
960784627 3:121358456-121358478 GCTCTCTCTTCCTCCTTCTCTGG - Intronic
961315149 3:126029377-126029399 CCACTCTCTTGCTCATTCTCTGG + Intronic
961347990 3:126277190-126277212 CACCCCTCTTCCTCCTGCTCTGG - Intergenic
961401794 3:126652213-126652235 CCACTGTCTTGCTCCTGCCCTGG - Intronic
961879273 3:130049297-130049319 CCACCCACTTCATCCTTCAAAGG - Intergenic
962869307 3:139474336-139474358 CCACCCTCTTTCTCCTCCTGGGG - Intronic
962914075 3:139883092-139883114 CCACCCACTTCGAGCTTCCCTGG + Intergenic
963617427 3:147559424-147559446 CTCTCCTCTTCCTCCTTCTCTGG + Intergenic
963814475 3:149813781-149813803 CCACCCCCTTTTTCTTTCCCTGG + Intronic
964394313 3:156229300-156229322 CCACTCTCTTCCTCCTGCTCTGG - Intronic
964507173 3:157412051-157412073 CCTCTCTCTTCCTCCTGCTCTGG + Intronic
964544028 3:157812894-157812916 TCCTCCTCTTCCCCCTTCCCTGG - Intergenic
964824403 3:160809358-160809380 CCTCCCTCTTCCTCCCTACATGG + Intronic
965083262 3:164063487-164063509 ACACCCTCCTCCTACTTCCAGGG - Intergenic
965175060 3:165321034-165321056 TCACCCTCTTCCTCATTCTCTGG + Intergenic
966241195 3:177757031-177757053 CTACCCTCTTGCTCCTGCTCTGG - Intergenic
966870943 3:184290417-184290439 CCACCCTTTTCCCCCATCCCAGG - Intronic
966913423 3:184571670-184571692 CCACCATCTCCCTCCTCCCTGGG + Intronic
967043066 3:185711701-185711723 CCTACCTCTTTTTCCTTCCCTGG + Intronic
967078107 3:186023532-186023554 CCACCCACTTCCACCTTCTCAGG - Intergenic
967404439 3:189099988-189100010 CAAGCCTCATCCTCCTGCCCAGG - Intronic
967799384 3:193639359-193639381 GCACCCTCATTCTCCTTGCCTGG - Intronic
967891105 3:194365163-194365185 CCAGGCTATTCCCCCTTCCCAGG - Intronic
967894214 3:194383733-194383755 GCACCCTCTTCCACCTGCTCTGG + Intergenic
968446667 4:655571-655593 CTGCCTTCTTCCTCCTCCCCAGG - Intronic
968985201 4:3871266-3871288 CCACCCTAAACCTCCTTCCAGGG - Intergenic
969062715 4:4450730-4450752 CCACCCTCTCCTCCCTGCCCTGG + Intronic
969122200 4:4918921-4918943 CTGCCCTCTTCCTCCTTGTCTGG - Intergenic
969244727 4:5924928-5924950 CCACCCAAGTGCTCCTTCCCAGG - Intronic
969253936 4:5990101-5990123 CCACCCTTTCCCTCCTGCTCAGG + Intergenic
969309801 4:6346681-6346703 CCAGCTTCTGCCTCCTTCCTTGG - Intronic
969467437 4:7366140-7366162 CCACCCTCCTCCTCCTTGGCAGG + Intronic
969529495 4:7722932-7722954 CTTCCCTCTTCCTCCCTCGCCGG - Intronic
969563232 4:7962647-7962669 TCCCCCTCTTCCTCCTCTCCTGG + Intergenic
969636962 4:8374879-8374901 GCACCATCGTCCTCCTTCCACGG - Intronic
969707291 4:8818921-8818943 CCACCCTCTACCTTCTTACTGGG - Intergenic
970020940 4:11567947-11567969 CCTCTCTCTTCCTCCTGCTCAGG - Intergenic
970365356 4:15352773-15352795 CTAACTCCTTCCTCCTTCCCTGG + Intronic
970402747 4:15733662-15733684 TCACTCCCTTCCTCCTTCTCTGG - Intronic
970567790 4:17349503-17349525 ACTCTCTCTTCCTCCTTCTCTGG - Intergenic
970571350 4:17386257-17386279 GCTCTCTCTTCCTCCTTCTCTGG - Intergenic
971512619 4:27445931-27445953 CCAGCCTCATCCTCCCGCCCTGG - Intergenic
972722422 4:41713583-41713605 CCTCCCTCTTGCTCCCTCTCTGG - Intergenic
972859493 4:43150077-43150099 CCACTTTCTTCCTCCTGCTCTGG - Intergenic
973601777 4:52549434-52549456 CCATCCTCTTCCTGGTTCCCTGG - Intergenic
973716051 4:53677335-53677357 CTCCTCTCTTCCTCCTTCTCTGG + Intronic
973794709 4:54412888-54412910 CCACCCTCTTTCTCCTCCCCTGG + Intergenic
973859785 4:55051760-55051782 CCCCTCTCTTCCTCACTCCCTGG + Intergenic
974102907 4:57437279-57437301 CCACCCTCTTCGGCCTCCCAAGG - Intergenic
974437605 4:61876627-61876649 CTACTCTCTTCTTCCCTCCCAGG - Intronic
974506144 4:62774734-62774756 CCACCCCTTTGCTCCATCCCAGG - Intergenic
974625813 4:64428170-64428192 TCACGCTCTTCCTCCTTCTTTGG + Intergenic
975489087 4:74969135-74969157 GCACCCTCTCCCTCATTGCCAGG - Intronic
975729044 4:77319866-77319888 ACAGCCTCCTCCTCCTCCCCGGG - Intronic
976301612 4:83520983-83521005 CCACCCTCTTCGGCCTCCCAAGG + Intronic
976448190 4:85156097-85156119 CTTCCTTCTTCCTCCTTTCCTGG - Intergenic
976487734 4:85627714-85627736 CCACCCAGTTCCAGCTTCCCCGG + Intronic
976550471 4:86389171-86389193 CCACCCTCTTGCTCCTGCCCTGG + Intronic
976984861 4:91280875-91280897 CCACCAACTGCATCCTTCCCTGG - Intronic
978160152 4:105537077-105537099 CCACTCTCTTCCTCCTGCTCTGG + Intergenic
978238860 4:106492026-106492048 CCATCCTGTTCCTCCTCCCTGGG - Intergenic
978331715 4:107620648-107620670 CCATCCTCTTCCCCCTCCCCAGG + Intronic
978344737 4:107755422-107755444 TCACTCTCTTCCTCCTGCTCTGG + Intergenic
978405129 4:108371111-108371133 CCTCCCTCTCCCTCCTCCCTAGG + Intergenic
979130911 4:117043938-117043960 GCAACCTCTGCCTCCCTCCCGGG + Intergenic
979209551 4:118082911-118082933 CCTCTCTCTTACTCCTTCTCTGG - Intronic
979351442 4:119648530-119648552 CCACCCTCCTCCTACTCCCCTGG - Intergenic
979420894 4:120503630-120503652 TCACTCTCTTCCTCCTTCTCTGG - Intergenic
979568985 4:122193381-122193403 TCACCCTCCTCTTCTTTCCCTGG - Intronic
979662135 4:123269260-123269282 CATGCCTCTTCCTCCTGCCCGGG + Intronic
979969407 4:127115227-127115249 CCACTCTCTTCCTTCTGCTCTGG + Intergenic
979999446 4:127470937-127470959 CAACCATTTTCCTCCTCCCCAGG + Intergenic
980129315 4:128803603-128803625 CCATCCTCCTCCTCCTCACCTGG + Intergenic
980406905 4:132365694-132365716 TCACTCTCTTCCTCCTGCTCTGG - Intergenic
980877475 4:138676597-138676619 CGCCCCTCTTCCCCCTTCTCTGG + Intergenic
980944156 4:139302296-139302318 CCTCCCTCTTCCTCCTCTCTTGG + Intronic
981103965 4:140859317-140859339 CCTTCCTTTTCCACCTTCCCAGG + Intergenic
981583560 4:146274699-146274721 TCACCTTCTTCCTCATTCCATGG - Intronic
981938225 4:150256184-150256206 CCACCCTCCTCCCGCTGCCCCGG + Exonic
983296439 4:165873892-165873914 CCAACCCCATCCTCCTCCCCCGG - Exonic
984355766 4:178655209-178655231 TCTCCCTCTTCCTCCTGCTCTGG + Intergenic
984670718 4:182483828-182483850 TCACTCTCTTCCTCCTGCTCTGG - Intronic
985028351 4:185762248-185762270 CCACCCTGCTCTTCCTTCCCAGG - Intronic
985441460 4:189984684-189984706 CCACCCGGTTCCACCGTCCCCGG + Intergenic
985948046 5:3201921-3201943 TTACCCTTTTCCTCCTTCCTTGG - Intergenic
985949215 5:3210633-3210655 CCACCCTCGACCCCCTTCCATGG - Intergenic
985995450 5:3595006-3595028 ACACCGTCTTCCCCCTTCGCGGG + Intergenic
986028414 5:3872305-3872327 ACACCATCTTCCCCCATCCCTGG - Intergenic
986107054 5:4670022-4670044 TCAACCTCTTCCTCCTGCTCTGG - Intergenic
986221993 5:5776354-5776376 CCTCCCTCCTCCTGCATCCCAGG - Intergenic
986281697 5:6328516-6328538 CCACTCTCTGACTCCTTCACTGG + Intergenic
986773500 5:10994339-10994361 CCGCCCCCCTCCTCCTTCCCCGG - Intronic
986773518 5:10994377-10994399 CCGCCCCCCTCCTCTTTCCCCGG - Intronic
986797304 5:11224468-11224490 CTCTCTTCTTCCTCCTTCCCTGG + Intronic
987214027 5:15714284-15714306 TCTCTCTCTTCCTCCTTCTCTGG + Intronic
987925147 5:24331376-24331398 TCACTGTCTTCCTCCTTCTCTGG - Intergenic
988078763 5:26388704-26388726 TCACTCTCTTCCTCCTGCTCTGG - Intergenic
988539201 5:32094080-32094102 CCAACCCCTCCCTCCTTCTCAGG - Intronic
988599883 5:32630271-32630293 CTGCCCCCTACCTCCTTCCCGGG + Intergenic
989008322 5:36840511-36840533 TCTCCCTCTTCCTCCTGCTCCGG - Intergenic
989666452 5:43859680-43859702 CCAGCCCCTTTATCCTTCCCAGG - Intergenic
990124698 5:52499812-52499834 TCTCTCTCTTCCTCCTTCTCTGG + Intergenic
990845009 5:60127501-60127523 CCTCTCTCTTCATCTTTCCCGGG - Intronic
991631002 5:68656323-68656345 CCTCCGTCTTCCCCTTTCCCTGG + Intergenic
991938719 5:71829430-71829452 CATCTCTCTTCCTCCTTCTCGGG - Intergenic
991952997 5:71965071-71965093 ACACCTTCTTCCTTCTTCCCAGG - Intergenic
992027454 5:72684659-72684681 CCTCTCTCTCCCTCCTTCTCTGG + Intergenic
992172733 5:74120573-74120595 CCACCCTCTTCTCCCTTGTCTGG + Intergenic
992267492 5:75033357-75033379 CCTCCCACCTCTTCCTTCCCTGG - Intergenic
992452258 5:76885413-76885435 CCACCCTGTTCCCACTTTCCTGG - Intronic
992883712 5:81136463-81136485 CCACTCTCTTCTTGCTTGCCTGG + Intronic
992944957 5:81801000-81801022 CCACATTCCTCCTCCTTCCTTGG + Intergenic
993084897 5:83351136-83351158 CCCCCCGCTTCCTCCTTCTCCGG + Intronic
993095070 5:83471900-83471922 GCACCCTCCGCATCCTTCCCCGG + Exonic
994052899 5:95382396-95382418 TCAGCCTCTTCCTCCTTCTCAGG + Intergenic
994473697 5:100240681-100240703 TCACTCTCTTCCTCCTTCTCTGG + Intergenic
994647849 5:102492020-102492042 TCACTCTCTTCCTCCTTCTCTGG - Intronic
994935923 5:106254116-106254138 CCCCTCTCTTCCTCCTGCTCTGG + Intergenic
995224916 5:109690624-109690646 CCAACCTCTTCCTCCCGCCGCGG + Intronic
996042975 5:118837166-118837188 ACACTTTCTTCCTCCTTCCCAGG - Intergenic
996305012 5:122036972-122036994 GCAACCTCTGCCTCCCTCCCGGG + Intronic
997296032 5:132769007-132769029 CCACACTGTCCCTCCTTTCCTGG - Intronic
997337902 5:133120727-133120749 CCACTGTCTTCCTTCTCCCCTGG + Intergenic
997584105 5:135034471-135034493 CGCGCCTCTCCCTCCTTCCCCGG + Intronic
997603595 5:135156956-135156978 CCACCCTCCACCTTCTTCCTGGG - Intronic
997691680 5:135831611-135831633 ACACCCTCTCCCTCCTCCCCTGG - Intergenic
997763092 5:136469411-136469433 CCCCCTTCTTGCTCCCTCCCAGG - Intergenic
997836095 5:137194640-137194662 CCAACATCCTCCTCTTTCCCGGG + Intronic
997856391 5:137376528-137376550 CCCCCCTCTGCCCCCATCCCTGG - Intronic
998199603 5:140108602-140108624 CCTTCCTCTCCCTCCTTCCAGGG - Intronic
998675217 5:144400325-144400347 CCACCTCCTTCCTCCCTCTCAGG - Intronic
999083526 5:148866618-148866640 CCACCCTCATCCCTGTTCCCTGG - Intergenic
999244917 5:150148981-150149003 CCTCCTGCTGCCTCCTTCCCAGG - Intronic
999264422 5:150257030-150257052 CCCCTCTCCTCCTCCATCCCCGG + Intronic
999295697 5:150458333-150458355 CCACCCTCTTCTTCCTGTCCTGG - Intergenic
999369871 5:151048179-151048201 CCACCCTCTTCCTCCTTCCCCGG - Intronic
999454398 5:151702795-151702817 CCTCCCTCCTGCCCCTTCCCTGG - Intergenic
1000815199 5:165912636-165912658 TCTCTCTCTTCCTCCTTCTCTGG - Intergenic
1001422129 5:171596223-171596245 CCATCTCATTCCTCCTTCCCAGG + Intergenic
1001426476 5:171625864-171625886 TCAGCCGCTTCCTCATTCCCAGG - Intergenic
1001437787 5:171714084-171714106 TTACCCTCTTCCTTCTTCCCAGG - Intergenic
1001471535 5:172016843-172016865 CCTCTCTCTTCCTCCTGCTCTGG + Intergenic
1001562869 5:172681058-172681080 TCACACTCTTCCTCCCTCTCTGG - Intronic
1001591590 5:172869190-172869212 CCTCCTCCTTCCTCCTCCCCAGG - Intronic
1001920624 5:175596727-175596749 CCACCCTCTGCTCCCCTCCCTGG - Intergenic
1002065908 5:176651545-176651567 CCTCCCCCCTCATCCTTCCCCGG - Intronic
1002846339 6:948508-948530 CCCCCTTCTTCCTCCTCTCCTGG - Intergenic
1002859767 6:1070486-1070508 CCTCCCTGTTGCTGCTTCCCTGG + Intergenic
1002918226 6:1546160-1546182 CCTCCTTCTTCCTCCTGCTCTGG - Intergenic
1003247879 6:4399688-4399710 CCAGCCTCTTCCCCCTTCATAGG + Intergenic
1003427448 6:6007213-6007235 CCTGCCTCTTCCTCGTTCCGGGG + Intronic
1003692650 6:8369692-8369714 CCTTTCTCTTCCTCCTGCCCTGG - Intergenic
1003744891 6:8989715-8989737 TCACTCTCTTCTTCCTTCTCTGG - Intergenic
1004156765 6:13175954-13175976 CCATCCTTTCCCTCCTGCCCTGG - Intronic
1004929163 6:20445182-20445204 CCAACATCATCTTCCTTCCCAGG + Intronic
1006421707 6:33938610-33938632 TCGCTGTCTTCCTCCTTCCCTGG - Intergenic
1006426577 6:33967067-33967089 TCACTCTCTTCCTCCTCTCCCGG + Intergenic
1006524889 6:34595869-34595891 CCCTCCTCTTCCTCATTTCCTGG + Intronic
1006716306 6:36122953-36122975 CCACCCGCTTCCCCCTCCACAGG - Intergenic
1006906492 6:37536779-37536801 CTACCCTCTTCCTCGGGCCCTGG + Intergenic
1006992910 6:38230660-38230682 CCAACCTCTGCTTCCTTCACCGG + Intronic
1007070993 6:39037981-39038003 CCATTCTCTTCCTCCTGTCCTGG + Intergenic
1007322952 6:41040466-41040488 CTCCCCTCTGCTTCCTTCCCTGG + Intronic
1007341293 6:41192901-41192923 CCACCCTGTCCCTTCTTCTCAGG - Exonic
1007371520 6:41429260-41429282 ACTCCCTCCTCCTCCTTTCCAGG - Intergenic
1007382126 6:41497172-41497194 ACACCCTCTCTCTCCCTCCCTGG - Intergenic
1007419776 6:41712606-41712628 CCTCCCTCTTCCTCCTCACCAGG + Intronic
1007440261 6:41853361-41853383 CCATCCTCTTCCCCAGTCCCTGG - Intronic
1007615309 6:43176336-43176358 CATCCCTCCTCCTCCTGCCCTGG - Intronic
1007664028 6:43503953-43503975 CTACCCTCTCCTTCCTGCCCAGG - Intronic
1007902176 6:45422527-45422549 CCACCCTCCTCCCCCTCCCCCGG + Intronic
1008272552 6:49507065-49507087 CCACCCTCTGCCTCCTATCTTGG - Intronic
1008750957 6:54733371-54733393 TCACTCTCTTCCTCCTTCTCAGG - Intergenic
1009776245 6:68209356-68209378 TCTCTCTCTTCCTCCTTCTCTGG + Intergenic
1010466920 6:76178670-76178692 CCTCTCTCTTCCTCCTGCTCTGG - Intergenic
1010517535 6:76791074-76791096 CTCCCCTCTTACTCCTTCTCTGG - Intergenic
1010772916 6:79853124-79853146 TCTCTCTCTTCCTCCTTCTCTGG - Intergenic
1011587763 6:88945082-88945104 CCAACCCCTGCCTCCTTCTCAGG + Intronic
1011645673 6:89455685-89455707 CCTCTCTCTTCCTCCTGCTCTGG + Intronic
1011682568 6:89797292-89797314 GCAACCTCTGCCTCCTTCCCAGG - Intronic
1012092946 6:94922244-94922266 CCTCCCTCTTCCTGCTTCGGGGG + Intergenic
1012249457 6:96963631-96963653 CAAATCCCTTCCTCCTTCCCGGG + Intronic
1013105750 6:107025494-107025516 CCACCTTCCTCCTCCCTCTCTGG - Intergenic
1013231340 6:108164667-108164689 CCCCCATCTTGCTCTTTCCCCGG + Intronic
1013370854 6:109470020-109470042 CCACCCTCCTCATCATTCCCAGG - Intronic
1014075671 6:117231473-117231495 CCTCTCTCTTCCTCCTGCTCCGG - Intergenic
1014116754 6:117675490-117675512 CCGCCATCTTCCTCCTCCCTTGG - Exonic
1014493057 6:122086522-122086544 CCCACCTCTTCCTCCTGCTCTGG - Intergenic
1014557572 6:122852784-122852806 TCGCTCTCTTCCTCCTTCTCTGG - Intergenic
1015379557 6:132551286-132551308 ACACCTTGTTCCTTCTTCCCTGG + Intergenic
1015748281 6:136534324-136534346 CCTCCTTCTTCTTCTTTCCCAGG + Intronic
1015889511 6:137955485-137955507 CCGCCCTCTTCTTCTTGCCCTGG - Intergenic
1016706574 6:147115556-147115578 ACACCCTCTGCCTCCTTTTCTGG + Intergenic
1017379351 6:153810456-153810478 TCACCCTCTTCCTCCTTCTCTGG + Intergenic
1017589988 6:155968413-155968435 GCTCTCTCTTCCTCCTTCTCTGG + Intergenic
1017763503 6:157589167-157589189 GCACCCTCTTCCTCCTGCTCTGG - Intronic
1017847654 6:158273391-158273413 CCATCCTCATCCTCCCTCACTGG + Intronic
1018035744 6:159879599-159879621 CCACTCTCTTCCTCCTGCTCTGG - Intergenic
1018152968 6:160957080-160957102 CCACCCCCTACCTTCTTCCCTGG - Intergenic
1018181607 6:161228073-161228095 CCTGACTCTTCCTCCTCCCCTGG + Intronic
1018425233 6:163673942-163673964 CCTCGCTCTTCCTCCTGCTCTGG - Intergenic
1018674208 6:166205195-166205217 CCATCCTCTTCCTCACTACCAGG + Intergenic
1018798107 6:167202804-167202826 CACCCCTGTCCCTCCTTCCCGGG - Intergenic
1018814605 6:167321372-167321394 CACCCCTGTCCCTCCTTCCCGGG + Intergenic
1018940945 6:168308585-168308607 CCTCCCTCGTCCTCCCTCCCTGG + Exonic
1019084782 6:169465856-169465878 CCATCCCCTTCCTCAGTCCCTGG - Intronic
1019611741 7:1940191-1940213 CCCCTCCCCTCCTCCTTCCCAGG - Intronic
1020047142 7:5048842-5048864 CCTCCCTCTTCCTCCTGCTCTGG - Intronic
1020214359 7:6178338-6178360 CCACCCGCTTGCTGCGTCCCTGG - Intronic
1020292503 7:6732700-6732722 TCTCCCTCTTCCTCCTGCTCTGG - Intergenic
1020978694 7:15040356-15040378 GCATGATCTTCCTCCTTCCCAGG - Intergenic
1021693901 7:23257426-23257448 CCACCCGCCTCCGCCTTCCAAGG - Intronic
1022732356 7:33041302-33041324 CCATCCTCCTCCTCCAGCCCTGG - Intronic
1023058746 7:36310093-36310115 TCTATCTCTTCCTCCTTCCCCGG + Intergenic
1023301801 7:38780926-38780948 CCTGCCTCTTGCTCCTGCCCTGG + Intronic
1023930026 7:44699861-44699883 CCACTCTCTTACTCCTGCTCTGG - Intronic
1024134827 7:46395874-46395896 ACTCCCTCTTTCTCATTCCCTGG - Intergenic
1024246176 7:47472034-47472056 CCTGCCTCTTCCACCTTCTCAGG + Intronic
1024304247 7:47913600-47913622 CCCCCCTCTTGCTCCTACTCCGG + Intronic
1024363495 7:48494147-48494169 CCACCCTTCTCCTTCCTCCCTGG - Intronic
1024373429 7:48611580-48611602 TCACTCTCTTCCTCCTGCTCTGG - Intronic
1024658262 7:51470657-51470679 CCAACCCCATCCTCCTTCTCGGG - Intergenic
1024731412 7:52257626-52257648 TCACTCTCTTCCTCCTGCTCCGG + Intergenic
1025724655 7:64045646-64045668 ACAGCCTCTTCCCCCTTCTCGGG - Intronic
1026121119 7:67538621-67538643 CCACTTTCTTCCTCCTGCTCAGG + Intergenic
1026305568 7:69137621-69137643 TCTCGCTCTTCCTCCTTCTCTGG - Intergenic
1026388937 7:69880152-69880174 CCACTTTCTTCCTCCTGCCCAGG - Intronic
1026898768 7:74025954-74025976 CCCCTGCCTTCCTCCTTCCCAGG + Intergenic
1027543040 7:79492357-79492379 CTGCTCTCTTCCTCCTTCTCTGG + Intergenic
1027614145 7:80400386-80400408 TCACCCTCCTCCACCTCCCCAGG - Intronic
1028121301 7:87059327-87059349 CCGCCCGCTTCCTCCTTGCCAGG - Exonic
1028405102 7:90466010-90466032 CCTTCCTCTTCCTCCTGCCTAGG + Intronic
1028792292 7:94866691-94866713 CCTCTCTCTTCCTCCTGCTCTGG + Intergenic
1028888579 7:95961651-95961673 CCAACCTCATCCTCTGTCCCTGG - Intronic
1029118725 7:98252198-98252220 CCACCCTCTTGCCCGGTCCCCGG - Exonic
1029327406 7:99822205-99822227 CCTCCCTTTTCCTCATGCCCTGG + Intergenic
1029439139 7:100577674-100577696 CCTCGCTCTTCATCCTCCCCGGG + Exonic
1029465286 7:100721112-100721134 CCACCCCCCTCCCCCTTCCGGGG - Intronic
1029543156 7:101196389-101196411 CTTCTCTCTTGCTCCTTCCCAGG - Exonic
1029867340 7:103648291-103648313 ACTCTCTCTTCCTCCTTCTCTGG + Intronic
1030150887 7:106403877-106403899 CCACCCTCTTGCTCTTCCTCTGG - Intergenic
1030362592 7:108610622-108610644 CCCCCCCCTTCATCCTGCCCTGG + Intergenic
1030895704 7:115057438-115057460 CCACACTCTTCATCGTTCTCTGG - Intergenic
1031208350 7:118791731-118791753 CCTCTCTCTTCCTCCTACTCTGG - Intergenic
1031441912 7:121805079-121805101 CCAACCCCTTCCCCCTGCCCAGG + Intergenic
1031841881 7:126752042-126752064 TCAACCTCTTCCTCCTTGCATGG + Intronic
1032173809 7:129607891-129607913 CCACCCTCTTCCTTCCCCCAAGG - Intergenic
1032442814 7:131955082-131955104 GGACCCTCTTTCTCCTTCCCAGG - Intergenic
1032535329 7:132658214-132658236 GCTCTCTCTTCCTCCTTCTCTGG - Intronic
1032619117 7:133509522-133509544 CCTTCCTCTTCCTCTCTCCCTGG + Intronic
1033043139 7:137936904-137936926 ACACCCTCTTTCTGCCTCCCGGG + Intronic
1033537291 7:142323860-142323882 CCACCCTCCTACCCCTCCCCAGG - Intergenic
1033658884 7:143390556-143390578 CCTCACCCTTCCTTCTTCCCAGG + Exonic
1033705460 7:143882065-143882087 CCACTCTCTTCTTTCCTCCCAGG + Intronic
1034076232 7:148233938-148233960 TTGCCCTCTTCCTCCTTCTCAGG + Intronic
1034165454 7:149021839-149021861 CCACCCTCTGCGGTCTTCCCGGG + Intronic
1034212030 7:149372425-149372447 TCACTCTCTTCCTCCTGCTCTGG - Intergenic
1034313128 7:150107689-150107711 CCCCCTACCTCCTCCTTCCCCGG - Intergenic
1034356187 7:150452061-150452083 GCAGCCTCTGCCTCCTTCTCAGG - Intronic
1034778296 7:153852409-153852431 CCACTCTCTTGCTCCTGCTCCGG - Intergenic
1034781668 7:153887372-153887394 GCAGCCTCTTCCTCCCTCCCTGG + Intronic
1034793734 7:153992978-153993000 CCCCCTACCTCCTCCTTCCCCGG + Intronic
1034859482 7:154583376-154583398 CCTCCCTCTTCCTCAGTCCTTGG + Intronic
1035219933 7:157400465-157400487 CCATCCTGGTCATCCTTCCCTGG + Intronic
1035261388 7:157663641-157663663 CCTCCCTCTCCACCCTTCCCTGG + Intronic
1035427228 7:158787132-158787154 CAAACTCCTTCCTCCTTCCCTGG - Intronic
1035485880 7:159225742-159225764 CAACTCTCAGCCTCCTTCCCAGG - Intergenic
1035587826 8:789342-789364 TCACTCTCTTCCTCCTGCTCCGG - Intergenic
1036120022 8:6006210-6006232 CCTCTCTCTTCCTCCTGCTCTGG - Intergenic
1036383131 8:8252462-8252484 TCGCCCTCTTCCTCCTGCTCTGG + Intergenic
1036387347 8:8294051-8294073 CCCTCCTCTTCTTCTTTCCCAGG - Intergenic
1036961051 8:13244886-13244908 CAACCGTCTTCCTTCTTGCCTGG - Intronic
1037076502 8:14726181-14726203 GCAACCTCTGCCTCCCTCCCAGG - Intronic
1037596278 8:20357092-20357114 TCTCTCTCTTCCTCCTTCTCTGG - Intergenic
1037621307 8:20565924-20565946 CCACCCTGTTGCTCCTGCTCTGG + Intergenic
1037755404 8:21706914-21706936 CCTTCCTCTTCCTCCTGCCCTGG + Intronic
1037765683 8:21770896-21770918 CCACCCTCTCCTGCCTCCCCAGG + Intronic
1037787869 8:21913066-21913088 CCATCCTCTTTCCCCTTCCCTGG - Intronic
1037948481 8:23004053-23004075 CTGCTCTCCTCCTCCTTCCCCGG - Intronic
1037988106 8:23302217-23302239 GCACCCTCTTCCTGCTTCCAAGG + Intronic
1038247353 8:25871165-25871187 CCTCCCCCTCCCTACTTCCCTGG + Intronic
1038477740 8:27879849-27879871 GCCCTCTCTTCCTCCTACCCAGG - Intronic
1038646026 8:29363125-29363147 CCAACCTCTCCCTCTATCCCTGG + Intergenic
1039402992 8:37287431-37287453 CCTCTCTCTTCCTCCTGCTCTGG + Intergenic
1039476047 8:37839934-37839956 CCACCCTCTGCCTTCACCCCAGG - Intronic
1039671199 8:39601064-39601086 CCTCTCTCTTCCTCCTGCTCTGG - Intronic
1040564420 8:48553079-48553101 CCACCTTCCTCCACCTTCCAGGG - Intergenic
1040843459 8:51809297-51809319 CCACTCTCTTTCTCCTGGCCGGG - Exonic
1041392678 8:57360624-57360646 GCTCCCTCTTCCTCCTTCTCTGG + Intergenic
1041613173 8:59875325-59875347 CCACCCAGTTCCAGCTTCCCGGG + Intergenic
1041645070 8:60243276-60243298 CCTCCCTCCTCCTCTTTTCCAGG + Intronic
1042102628 8:65290025-65290047 CCATACTTTTCCTCCTCCCCTGG - Intergenic
1042453035 8:68971993-68972015 TCACTCTTTTCCTCCTTCTCTGG - Intergenic
1042498990 8:69488767-69488789 CTTCCCTGATCCTCCTTCCCTGG - Intronic
1042657865 8:71120113-71120135 CCCCCCACTTCCTCCTACTCTGG - Intergenic
1043138963 8:76564038-76564060 CCACCCAGTCCATCCTTCCCAGG + Intergenic
1043145536 8:76648867-76648889 GCACACTCTTCCTCCTGCTCTGG + Intergenic
1043158335 8:76814956-76814978 CCACCCTCTTTCTCCATTACAGG - Intronic
1043383714 8:79728730-79728752 TCACTCTCTTCCTCCTGCTCTGG + Intergenic
1043400142 8:79876525-79876547 GCAACCTCTGCCTCCCTCCCGGG - Intergenic
1044625778 8:94234328-94234350 CCTCCCTCTCCCTGCATCCCTGG + Intergenic
1045129860 8:99139220-99139242 CCACACTCTGCCTCCTTTACTGG + Intronic
1045305393 8:100952634-100952656 CCACCCTTGTCATCCTGCCCGGG - Intronic
1046046093 8:108966654-108966676 CCTCTCTCTTCCTCCTGTCCTGG + Intergenic
1046095344 8:109552441-109552463 CCATTCTCTTCCTCATTCTCTGG - Intronic
1046104514 8:109649566-109649588 CCAACCTCTGCCTCTTCCCCTGG - Intronic
1046388265 8:113532306-113532328 TCGCTCTCTTCCTCCTTCTCAGG + Intergenic
1046681612 8:117176935-117176957 CCACCATCTTCTTCCTCCACTGG - Intergenic
1046927971 8:119813599-119813621 CCATCCTCTTTGTCCTTCTCTGG - Intronic
1047147414 8:122218831-122218853 CCAGCCTCAGCCTCCTTACCTGG - Intergenic
1047484951 8:125320967-125320989 CCTCTCTCTTCCTCCTGCTCTGG - Intronic
1047706372 8:127503662-127503684 CCACTCCCTTCCTCCTTCTTAGG - Intergenic
1048373747 8:133803560-133803582 TCTCCCTATTTCTCCTTCCCTGG + Intergenic
1048449786 8:134523290-134523312 TCAGGCTCTTCCTCCTGCCCAGG + Intronic
1048794599 8:138138186-138138208 CCTCCCTCCTCCTCCTCCACAGG + Intronic
1049009183 8:139875910-139875932 CGGCCCTCTGCCTCCTTCCCAGG - Intronic
1049130550 8:140836347-140836369 CCCATCTCTTCCTCCTTCCTGGG + Intronic
1049174057 8:141180558-141180580 GCACCCTCGGCCTCCTTTCCTGG - Intronic
1049205565 8:141361930-141361952 TCACCCTCTGCCCCCTCCCCTGG - Intronic
1049360518 8:142210585-142210607 CCAGCCTGGTCCTCCCTCCCTGG + Intergenic
1049427449 8:142543756-142543778 CCACCGTCTCCCTTCTTCCCTGG + Intronic
1049430698 8:142562750-142562772 CCACCCTCTTCTGGCTTCCATGG + Intergenic
1049433067 8:142574214-142574236 CCACCCTCTGCCTTCTGCCCTGG + Intergenic
1049434317 8:142579433-142579455 CCTCCTCCTCCCTCCTTCCCAGG - Intergenic
1049586589 8:143435268-143435290 CCACCCTGCTCCTGCTGCCCGGG + Intergenic
1049738033 8:144220484-144220506 GCTCCCTCTTCCTCCTACACGGG + Intronic
1049951064 9:644532-644554 CCTCTCTCTTCCTCCTGCTCTGG - Intronic
1051040389 9:12802441-12802463 CCACTCTCTTCCTTCTGCTCTGG + Intronic
1051189116 9:14492558-14492580 CCTCCCTCTTCTTCCTGCTCTGG - Intergenic
1051369762 9:16348453-16348475 CCTCCATCTTCCTCCTTCAATGG + Intergenic
1051414587 9:16825611-16825633 CTCCCCTCCTCCTCCTCCCCAGG - Intronic
1051515558 9:17926501-17926523 GCACTCTCCTCCTCCTTCCTGGG - Intergenic
1051582869 9:18695996-18696018 TTGCCCTCTTCCTCCTTCTCTGG - Intronic
1052874038 9:33539382-33539404 CATCCCTCTGCCTCCTTACCTGG - Intronic
1052874206 9:33541080-33541102 CATCCCTCTGCCTCCTTACCTGG - Intronic
1053056932 9:34998479-34998501 CCACTGTCATCCTCCCTCCCGGG + Intronic
1053501837 9:38603257-38603279 CATCCCTCTGCCTCCTTACCTGG + Intergenic
1053502009 9:38604961-38604983 CATCCCTCTGCCTCCTTACCTGG + Intergenic
1053566089 9:39253660-39253682 CCACCTTCCTCCTGCTTCCCTGG + Intronic
1053653127 9:40189337-40189359 CAACACGCTTCATCCTTCCCAGG - Intergenic
1053831856 9:42091475-42091497 CCACCTTCCTCCTGCTTCCCTGG + Intronic
1053903530 9:42818640-42818662 CAACACGCTTCATCCTTCCCAGG - Intergenic
1054131059 9:61365380-61365402 CCACCTTCCTCCTGCTTCCCTGG - Intergenic
1054531457 9:66186886-66186908 CAACACGCTTCATCCTTCCCAGG + Intergenic
1054598688 9:67095951-67095973 CCACCTTCCTCCTGCTTCCCTGG - Intergenic
1054690416 9:68317888-68317910 CCACCCCCTTCCCCCCCCCCCGG - Intergenic
1054771699 9:69089732-69089754 CCTCCCTATTCCTCCTTTCAGGG - Intronic
1054785592 9:69207037-69207059 CCATACTCTGCCTCCTGCCCAGG + Intronic
1054837442 9:69692724-69692746 CCTCTCTCTTCCTCCTGCTCTGG - Intergenic
1056581068 9:87888314-87888336 CCACCGTGTGCCTCCTTTCCTGG - Exonic
1056708517 9:88971535-88971557 CCACAGTCTGCCTCCGTCCCTGG + Intergenic
1056781344 9:89553516-89553538 CCACCATCTCCTTCCCTCCCAGG + Intergenic
1057154077 9:92824734-92824756 CATCCCTCTGCCTCCTTACCTGG - Intergenic
1057460102 9:95253477-95253499 CCACTCTCTTCTTCCTTACATGG + Intronic
1057489675 9:95511224-95511246 CCGCCCCCTTCCTTCCTCCCCGG + Intronic
1057681217 9:97187552-97187574 CATCCCTCTGCCTCCTTACCTGG + Intergenic
1057681389 9:97189272-97189294 CATCCCTCTGCCTCCTTACCTGG + Intergenic
1057709688 9:97428151-97428173 CCACCCTCTTCCTCCTTGTTAGG + Intronic
1057907784 9:98995512-98995534 CCTCCCTCTGCCTGCCTCCCTGG + Intronic
1058115629 9:101081293-101081315 GCAACCTCTGCCTCCCTCCCAGG + Intronic
1058333162 9:103790365-103790387 GCTCTCTCTTCCTCCTTCTCTGG + Intergenic
1058892240 9:109371042-109371064 CAACCCTCTTCCTTCCTCTCAGG - Intergenic
1059315479 9:113422085-113422107 CTGACCTCTTCCTCCTTGCCTGG - Intronic
1059347238 9:113637313-113637335 ACTCCCTCTTCCTTCTGCCCTGG + Intergenic
1059442076 9:114313926-114313948 TCAGCTTATTCCTCCTTCCCTGG + Intergenic
1060527751 9:124330053-124330075 CCTCCCACTTCCCCCCTCCCTGG + Intronic
1060680063 9:125554362-125554384 CCAACCCCTTCCTCCATCCTAGG - Intronic
1060702854 9:125774168-125774190 CCACACTCTTCCTCCTGCTCCGG - Intronic
1060877888 9:127096250-127096272 CCATTCTCTGCCTCCATCCCTGG - Intronic
1060926320 9:127457684-127457706 CCCTCCTCTTCCTTCTTGCCTGG - Intronic
1061081768 9:128375134-128375156 CTACCTCCTTCCTTCTTCCCTGG + Intronic
1061390443 9:130314748-130314770 CCAGCCTCTGCCTCCCACCCAGG - Intronic
1061517532 9:131098279-131098301 CCACCCTCACCCTGCTTCCTGGG + Intronic
1061542131 9:131283079-131283101 CCGCCCCCTCCGTCCTTCCCCGG - Intergenic
1061545592 9:131302421-131302443 CCTCCCTCTCCCGCCTGCCCTGG + Intronic
1061777811 9:132977663-132977685 CCACCTTCTCCCTCCTCCTCTGG - Intronic
1061785000 9:133022577-133022599 CTACACTCTTCCTCCTGCTCAGG + Intergenic
1061961399 9:133991030-133991052 ACTCACTCTCCCTCCTTCCCAGG + Intronic
1062028544 9:134351594-134351616 GCACCCTCCTCCACCCTCCCGGG - Intronic
1062348758 9:136128540-136128562 CCACCCTCACCCGCCCTCCCTGG + Intergenic
1062383535 9:136299108-136299130 CCTCCCTCCTCCGCCTTCCAGGG - Intronic
1062435995 9:136546775-136546797 TCACCGTCCTCCTCCTGCCCGGG + Intergenic
1062735694 9:138136167-138136189 CCACCCTTGTCCACCTTCCTGGG + Intergenic
1062740961 9:138175208-138175230 CCACCCAGTTCCACCGTCCCCGG - Intergenic
1203778905 EBV:89721-89743 CCGCCCTCCTCCTCTTACCCTGG + Intergenic
1185652211 X:1656163-1656185 CCTCCATCTTCCTCCTTTGCTGG + Intergenic
1185920174 X:4082943-4082965 CATCTCTTTTCCTCCTTCCCTGG - Intergenic
1186029766 X:5354921-5354943 CTCTCCTCTTCCTCCTTCTCTGG - Intergenic
1186257236 X:7735826-7735848 CCTCTCTCTTCCTCCTGCTCTGG - Intergenic
1186427115 X:9471383-9471405 CAAGCCTTTTCCTCCCTCCCAGG + Intronic
1186428496 X:9484422-9484444 CCTCCCTCTACCCCTTTCCCAGG + Intronic
1186638768 X:11432976-11432998 CCACCCTCTTAACCCTTCCAGGG + Intronic
1187312445 X:18158211-18158233 TCTCCCTCTTCCTCCTGCTCAGG + Intergenic
1187325001 X:18278465-18278487 CCTGTCTCTGCCTCCTTCCCGGG - Intronic
1187467988 X:19543206-19543228 CCACCCTCTGCATCCTGTCCAGG - Intronic
1187592974 X:20739272-20739294 CCACTCTCTCCCTCCTTCACTGG + Intergenic
1187736912 X:22314145-22314167 CCTCCCTCCTCCTCCTCCTCTGG - Intergenic
1187928931 X:24276214-24276236 GCTCTCTCTTCCTCCTCCCCCGG + Intergenic
1188160490 X:26795180-26795202 CCACCCTATTCCTTCATGCCTGG + Intergenic
1188348097 X:29093322-29093344 CCACCCCCCTCCTCCTGCTCTGG - Intronic
1188657740 X:32718350-32718372 GCTCTCTCTTCCTCCTTCTCTGG + Intronic
1188927372 X:36061155-36061177 GCCCTCTCTTCCTCCTTCTCCGG + Intronic
1189224482 X:39401290-39401312 TCTCTCTCTTCTTCCTTCCCTGG + Intergenic
1189583508 X:42432826-42432848 TCAGCCTCCTCCTCCTTCCCTGG + Intergenic
1189737605 X:44087445-44087467 CTGACCTCTACCTCCTTCCCAGG - Intergenic
1189850574 X:45172572-45172594 CCACCATCTTCCTCCATTCCAGG + Intronic
1190098190 X:47499590-47499612 CTTCCCTCTTCTTCCCTCCCAGG - Intergenic
1190759492 X:53427814-53427836 CTAGCCTCTGCCTCCTTCTCTGG - Intronic
1190897985 X:54639910-54639932 CCTCCCTCTCCCTCCTTCTGGGG - Intergenic
1191857564 X:65639534-65639556 CCACACCCTTCCCACTTCCCTGG - Intronic
1192066752 X:67892602-67892624 TCACTCTCTTCCTCCTGCTCTGG + Intergenic
1192213494 X:69142438-69142460 CCACCTTCTTGATGCTTCCCTGG + Intergenic
1192359925 X:70433012-70433034 CCACCCTCCCCCTCCTCCCCAGG + Exonic
1193547429 X:82846921-82846943 CCTCCCACTTCCTCCTGCTCTGG + Intergenic
1194023730 X:88725771-88725793 CCTCTCTCTTGCTCCTTCTCTGG - Intergenic
1194211901 X:91080960-91080982 CTACTCTCTTCCTCCTGCACTGG - Intergenic
1195215979 X:102702933-102702955 CCACTCTCTTCCTGCTTCTACGG - Intergenic
1195239235 X:102934765-102934787 CCTCCCTCTTCCTGAGTCCCTGG + Intergenic
1195342375 X:103918498-103918520 CCACCCCCATATTCCTTCCCAGG + Intergenic
1195364449 X:104113135-104113157 CCACCCTCATATTCCTTCCCAGG - Intronic
1195650444 X:107278069-107278091 CCCCCCACTTCCTCCTGCTCTGG + Intergenic
1195657943 X:107350389-107350411 TCACCCTCTTTTTCCCTCCCTGG - Intergenic
1197134536 X:123045670-123045692 TCTTTCTCTTCCTCCTTCCCAGG + Intergenic
1197573108 X:128174505-128174527 CCTCCCTCTCCCTAATTCCCTGG - Intergenic
1197841342 X:130750526-130750548 TCACCCTCTTCCTCTCTCTCGGG + Intronic
1197930419 X:131689329-131689351 CTGCTCTCTTCCTCCTTCTCTGG - Intergenic
1198111369 X:133505331-133505353 CCACTCTCTTGCTTCTGCCCTGG - Intergenic
1199330156 X:146549999-146550021 TCACTCTCTTCCTCCTTTTCTGG - Intergenic
1199506155 X:148563437-148563459 CCAACCTCTCTCTCCTTCCATGG - Intronic
1199559839 X:149150950-149150972 CCACCCTCTTGCTCTTCACCAGG - Intergenic
1199591045 X:149468876-149468898 GCACCATCTGCCTCATTCCCTGG - Intergenic
1199606999 X:149585763-149585785 CCTCCGTCTTGTTCCTTCCCTGG + Intronic
1199632124 X:149783605-149783627 CCTCCGTCTTGTTCCTTCCCTGG - Intronic
1199670644 X:150145553-150145575 CCACCATCTTCACTCTTCCCAGG - Intergenic
1199695755 X:150341779-150341801 TCCCTCCCTTCCTCCTTCCCAGG + Intergenic
1199860930 X:151800006-151800028 CCTTCCTCTTCCACCTTCACTGG + Intergenic
1199864099 X:151827587-151827609 CCTCCCCTTGCCTCCTTCCCTGG + Intergenic
1200216838 X:154371784-154371806 CCGCCGTCATCCCCCTTCCCCGG + Intronic
1200218311 X:154378531-154378553 CCGCCGTCGTCCCCCTTCCCAGG - Intergenic
1200257707 X:154593440-154593462 CCACCCCCTTGCTCCTGCCCTGG + Intergenic
1200279064 X:154761640-154761662 CCACCCTGTGGCTCTTTCCCCGG - Intergenic
1200397908 X:156001980-156002002 CCACCCTCGTCCACCTTTCTGGG + Intronic
1200761499 Y:7043164-7043186 CCAACCTCTTGCACCTTCCCAGG - Intronic
1201929053 Y:19321116-19321138 CCACCCACTTCAACCTTCCAAGG + Intergenic
1201963611 Y:19708124-19708146 ACACCCTCTCCTTCCTACCCAGG + Intronic