ID: 999369877

View in Genome Browser
Species Human (GRCh38)
Location 5:151048205-151048227
Sequence GGGTGCACCACCCTAGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 114}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999369877_999369882 0 Left 999369877 5:151048205-151048227 CCAGGCTCTAGGGTGGTGCACCC 0: 1
1: 0
2: 0
3: 6
4: 114
Right 999369882 5:151048228-151048250 TGAACCTCCGCGAGGGAGAGAGG 0: 1
1: 0
2: 0
3: 6
4: 90
999369877_999369878 -8 Left 999369877 5:151048205-151048227 CCAGGCTCTAGGGTGGTGCACCC 0: 1
1: 0
2: 0
3: 6
4: 114
Right 999369878 5:151048220-151048242 GTGCACCCTGAACCTCCGCGAGG 0: 1
1: 0
2: 0
3: 3
4: 79
999369877_999369885 11 Left 999369877 5:151048205-151048227 CCAGGCTCTAGGGTGGTGCACCC 0: 1
1: 0
2: 0
3: 6
4: 114
Right 999369885 5:151048239-151048261 GAGGGAGAGAGGAGTCCACGTGG 0: 1
1: 0
2: 1
3: 38
4: 397
999369877_999369879 -7 Left 999369877 5:151048205-151048227 CCAGGCTCTAGGGTGGTGCACCC 0: 1
1: 0
2: 0
3: 6
4: 114
Right 999369879 5:151048221-151048243 TGCACCCTGAACCTCCGCGAGGG 0: 1
1: 0
2: 1
3: 5
4: 55
999369877_999369887 26 Left 999369877 5:151048205-151048227 CCAGGCTCTAGGGTGGTGCACCC 0: 1
1: 0
2: 0
3: 6
4: 114
Right 999369887 5:151048254-151048276 CCACGTGGAGTCAGCAGAGCTGG 0: 1
1: 0
2: 3
3: 22
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999369877 Original CRISPR GGGTGCACCACCCTAGAGCC TGG (reversed) Intronic
900492500 1:2959324-2959346 GGGTGCACCTCCCTAGAGTTGGG + Intergenic
901188543 1:7390078-7390100 GGGTGCAGGAGCCAAGAGCCCGG + Intronic
901855414 1:12041529-12041551 GGGTGGACCCCTCTAGAGACAGG - Intergenic
901924095 1:12554975-12554997 GGGTTCACCAGCCTCAAGCCAGG - Intergenic
902773828 1:18661706-18661728 GGCTGCAGCACACAAGAGCCTGG + Intronic
904907122 1:33906063-33906085 TGGTGCAACCCCCTCGAGCCTGG + Intronic
905312995 1:37063522-37063544 GGAGACACCTCCCTAGAGCCAGG + Intergenic
906511167 1:46411147-46411169 GGGTGCCCCACCCTTGGCCCAGG - Intronic
908413840 1:63893071-63893093 GTGTCCACCACTCTAGAGACAGG - Intronic
909917350 1:81336768-81336790 GAGGGCCCCACCCTCGAGCCTGG + Intronic
915023700 1:152806064-152806086 CAGTGCACCAGCCTAGAGCCAGG - Intronic
915328898 1:155097035-155097057 GGGTGTTCCACCTTAGACCCAGG - Intergenic
921384024 1:214551713-214551735 GGCTCCCCCACCCCAGAGCCGGG + Intronic
1063521919 10:6748883-6748905 GGGTGCACCACCCTCCAACATGG + Intergenic
1064128016 10:12681162-12681184 GGGAACACCACTCTAGAGCGTGG - Intronic
1064599690 10:16981045-16981067 GAGTGCTCCACCCTCAAGCCTGG + Intronic
1067851720 10:49759004-49759026 AGGCCCACCACCCTAGAACCAGG + Intronic
1072222193 10:93335826-93335848 ATGTGCCCCTCCCTAGAGCCTGG + Intronic
1075546829 10:123361468-123361490 TGCTGCTCCAGCCTAGAGCCCGG - Intergenic
1077143580 11:1035308-1035330 CGGGCCACCACCCTGGAGCCAGG - Intronic
1077797155 11:5504832-5504854 GGATTCACCACCTTGGAGCCAGG + Intronic
1081858083 11:46316500-46316522 GGGTACACCATCCTGGCGCCTGG + Intronic
1083779813 11:64912020-64912042 GGGTGCAGCAGCCTAGGGGCTGG - Intronic
1083877427 11:65531698-65531720 GGGTGGACCACCACAGAGTCTGG - Intronic
1084273856 11:68042186-68042208 GGGTACCCTACCCTAGATCCTGG - Intronic
1091406215 12:211095-211117 GGGTGCTCCCCTCTACAGCCTGG - Intronic
1094514299 12:31118559-31118581 GGAGGCACCACCCGAGAGACGGG + Intergenic
1096847161 12:54413603-54413625 GGCTGCACCGCCCTAGGGCTGGG + Intronic
1101167360 12:102052409-102052431 GGGTGATCCAGCCTAGTGCCAGG - Intronic
1101217395 12:102597569-102597591 AAGTGCACCACCCTAAAGCCTGG - Intergenic
1101237603 12:102805226-102805248 GGGTGCAGAACCCTAGAGACAGG - Intergenic
1112694060 13:101927811-101927833 GGCTCCACCTCCCCAGAGCCTGG + Intronic
1113857966 13:113459227-113459249 GGGGTCACCACTCTAGAGGCAGG + Intronic
1115127664 14:30015930-30015952 GGCTGCACAACACTAGATCCTGG - Intronic
1119677608 14:76567507-76567529 GGCTCCACCACACTATAGCCTGG - Intergenic
1122815499 14:104310154-104310176 GGGTGCAGCTCCCTGGGGCCTGG - Intergenic
1123499625 15:20867590-20867612 GGGTGAAGCAGCCTGGAGCCTGG - Intergenic
1123556877 15:21441320-21441342 GGGTGAAGCAGCCTGGAGCCTGG - Intergenic
1123593100 15:21878556-21878578 GGGTGAAGCAGCCTGGAGCCTGG - Intergenic
1124999120 15:34753262-34753284 GTGTGCAACACCCTGCAGCCCGG - Exonic
1130692437 15:86095165-86095187 GGGTGCACCACCCTACTAGCAGG + Intergenic
1202965220 15_KI270727v1_random:168509-168531 GGGTGAAGCAGCCTGGAGCCTGG - Intergenic
1133376386 16:5290924-5290946 GGGTGCATCACCTGAGATCCAGG - Intergenic
1134019667 16:10912794-10912816 GGGTGGAACAGCCTAGAGCCGGG + Intronic
1134804617 16:17113936-17113958 GGGTGCACCACCCTCCTGGCAGG - Intronic
1134804645 16:17114033-17114055 GGGTGCACCACCCTCCCGGCAGG - Intronic
1136073545 16:27803199-27803221 GTGTGCACCACCGTGGAGCTGGG - Intronic
1136458815 16:30397544-30397566 GGGTGAACCACGCTGGGGCCAGG + Exonic
1137618877 16:49862913-49862935 GTGTGCAGCACGCTCGAGCCTGG + Intergenic
1137835536 16:51588978-51589000 GGGTGCTCCAGCCTAGTGCCAGG - Intergenic
1138422675 16:56909757-56909779 CTGGGCTCCACCCTAGAGCCTGG - Intronic
1141962070 16:87415631-87415653 GGGTGCACCACCTCACAGGCTGG + Intronic
1143631210 17:8141303-8141325 GGGAGCAGCACCCAAGATCCTGG - Exonic
1147212321 17:38878927-38878949 GGGTCCCCCATCCCAGAGCCTGG + Intronic
1147989602 17:44324710-44324732 ACGAGCACCAGCCTAGAGCCAGG - Exonic
1148681492 17:49476439-49476461 GGGGGCCCCAGCCTAGACCCAGG - Intronic
1148770636 17:50064073-50064095 GGGGGCACCAGCCAGGAGCCTGG - Exonic
1150571824 17:66393548-66393570 GAGTGCAAGACCCCAGAGCCTGG + Intronic
1152288228 17:79424558-79424580 GTGGGCACCACCCTGGAGACAGG - Intronic
1154457682 18:14544465-14544487 GGGTGAAGCAGCCTGGAGCCTGG - Intergenic
1159551339 18:69898614-69898636 TGGTTCCCAACCCTAGAGCCAGG + Intronic
1160869615 19:1271274-1271296 GGGTGCCCCATCCTCGAGACGGG - Intronic
1161499360 19:4605030-4605052 GGGGGCAGCACCCAGGAGCCGGG + Intergenic
1162490196 19:10987011-10987033 GGGTGCACCACCATAGAAGAGGG - Intronic
1164732850 19:30519214-30519236 GGGAGCCCCACCCCAGAGCTGGG - Intronic
1165331479 19:35143112-35143134 GGGCGCCCCACCCTAGAGGAAGG + Intergenic
1167268187 19:48493628-48493650 GGGAGCAGGAGCCTAGAGCCGGG - Intronic
1167356463 19:49007168-49007190 GGGTGCCAGACCCCAGAGCCTGG + Intronic
926533007 2:14074981-14075003 GAGTTCACCACACTAGAGACAGG - Intergenic
927217420 2:20675892-20675914 GGGTTCAGCTCCCCAGAGCCAGG + Intergenic
927515113 2:23667731-23667753 GCGTGCTCCACCCTGGGGCCCGG + Intronic
929982651 2:46696489-46696511 GGGTGCAATACCCAAGGGCCTGG + Intergenic
932810639 2:74822849-74822871 TGATGCACCAGCCTGGAGCCTGG + Intergenic
935950227 2:108322022-108322044 GGCTGCACCTCCATAGTGCCAGG - Intergenic
938473876 2:131590272-131590294 GGGTGAAGCAGCCTGGAGCCTGG + Intergenic
942325321 2:174771666-174771688 GGGTGCAGCTCCCTGGGGCCTGG + Intergenic
947265320 2:228273293-228273315 GGGGGCACCAGCCTAGAACTCGG + Intergenic
947288259 2:228542619-228542641 GTGTGCTCCACCATAGAGGCTGG - Intergenic
1171130893 20:22652190-22652212 AGGTGCACCTCTCTAGAGTCTGG + Intergenic
1171457291 20:25279168-25279190 GGCGGCACCTCCCCAGAGCCTGG + Intronic
1174129895 20:48336239-48336261 AAGTTCACCACCCTTGAGCCAGG + Intergenic
1175171000 20:57081530-57081552 GGGTGCCTGACCCCAGAGCCTGG - Intergenic
1176816476 21:13608873-13608895 GGGTGAAGCAGCCTGGAGCCTGG + Intergenic
1178223633 21:30689428-30689450 GAGTGCCCCACCCTTAAGCCTGG + Intergenic
980626411 4:135380258-135380280 GGGAGCACCAACCTGAAGCCAGG + Intergenic
981429804 4:144645899-144645921 GGGTTCAGCACCCTCGAGGCTGG + Intergenic
985824382 5:2181762-2181784 GTGTCCACCACCCCAGGGCCTGG + Intergenic
986974475 5:13379521-13379543 GGGTGCACCACCCTCCAGGTAGG - Intergenic
994196612 5:96929526-96929548 GGGTGCACTACACTCCAGCCTGG - Intronic
997453410 5:134001309-134001331 GAGTTCACCACCCTATACCCTGG - Intronic
998464783 5:142334778-142334800 TGGTGCAGCACCCTGGAACCAGG - Intergenic
999369877 5:151048205-151048227 GGGTGCACCACCCTAGAGCCTGG - Intronic
1001728080 5:173924843-173924865 GGGTGTGCTACCCCAGAGCCTGG - Intronic
1002471695 5:179439384-179439406 GGGGGCAGCTCCCTGGAGCCTGG + Intergenic
1004906578 6:20242264-20242286 GGGTGCACCACCCTCCTGGCAGG + Intergenic
1007711576 6:43827719-43827741 ATGTGGACCTCCCTAGAGCCAGG - Intergenic
1010849866 6:80760264-80760286 TGGGGTACCAACCTAGAGCCAGG + Intergenic
1016422497 6:143899989-143900011 GGGTTCACCAGCCTAGAGTTGGG + Intronic
1022509362 7:30925399-30925421 GTGTGCAGCAGCCTAGAACCAGG - Exonic
1024232156 7:47370885-47370907 TGGTGCATCAACCTGGAGCCCGG - Intronic
1024295748 7:47840692-47840714 GAGTGCCACAGCCTAGAGCCAGG + Intronic
1027228095 7:76257388-76257410 GGGGCCACCCCCCTAGAGACAGG + Intronic
1027355647 7:77351874-77351896 GGTTACACCACCCCAGAGTCAGG - Intronic
1032080845 7:128857789-128857811 TGGTGCTCCACCCTAGGGCTGGG - Intronic
1032091408 7:128913371-128913393 TGGTGCTCCACCCTAGGGCTGGG + Intergenic
1035174725 7:157042159-157042181 GGGTGCACGACCCAGCAGCCAGG - Intergenic
1040453161 8:47568634-47568656 TGGTGCAGCACACTGGAGCCAGG + Intronic
1042521311 8:69714486-69714508 GGGTGCAGCAGCTTTGAGCCAGG - Intronic
1046756634 8:117979208-117979230 AGGTGCACCCCCCCAGTGCCCGG - Intronic
1047510910 8:125514636-125514658 GGATGCACCAGCAGAGAGCCTGG + Intergenic
1049575642 8:143388578-143388600 GGGGGCATCACCCCAGAGCACGG + Intergenic
1051546280 9:18279813-18279835 GGCTGGCCCACCCTAGTGCCAGG - Intergenic
1051546282 9:18279823-18279845 GGGTGGGCCAGCCTGGAGCCTGG + Intergenic
1060559025 9:124527691-124527713 GGGTACACCACCTTAGATACTGG - Intronic
1060947588 9:127579248-127579270 AGGTGCCCCACCCGGGAGCCCGG - Intergenic
1062483882 9:136764708-136764730 GGGTGCATCAGGCCAGAGCCTGG - Intronic
1062662608 9:137646521-137646543 GGCTGCCCAACCCTGGAGCCTGG + Intronic
1191957827 X:66665315-66665337 GGGGGCACCTTGCTAGAGCCTGG + Intergenic
1194434079 X:93848852-93848874 GGATGCACCACCTGCGAGCCTGG - Intergenic
1197822614 X:130556416-130556438 GTGTGTACCACTCTAGAGCTTGG + Intergenic
1201354481 Y:13082827-13082849 GGGTGCAACACCCAGGACCCTGG - Intergenic