ID: 999369879

View in Genome Browser
Species Human (GRCh38)
Location 5:151048221-151048243
Sequence TGCACCCTGAACCTCCGCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 55}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999369871_999369879 19 Left 999369871 5:151048179-151048201 CCGGGGAAGGAGGAAGAGGGTGG 0: 1
1: 0
2: 13
3: 146
4: 1024
Right 999369879 5:151048221-151048243 TGCACCCTGAACCTCCGCGAGGG 0: 1
1: 0
2: 1
3: 5
4: 55
999369877_999369879 -7 Left 999369877 5:151048205-151048227 CCAGGCTCTAGGGTGGTGCACCC 0: 1
1: 0
2: 0
3: 6
4: 114
Right 999369879 5:151048221-151048243 TGCACCCTGAACCTCCGCGAGGG 0: 1
1: 0
2: 1
3: 5
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999369879 Original CRISPR TGCACCCTGAACCTCCGCGA GGG Intronic
900211046 1:1456030-1456052 AGCACCCTGAGCCTACACGAGGG - Intronic
900216872 1:1486349-1486371 AGCACCCTGAGCCTACACGAGGG - Intronic
900223953 1:1524078-1524100 AGCACCCTGAGCCTACACGAGGG - Intronic
901757446 1:11449888-11449910 ATCACCCTGATCCTCTGCGACGG + Intergenic
908301158 1:62761832-62761854 TGCAGCCTGAGCCTCCCCAACGG + Intergenic
915604122 1:156940113-156940135 TGCACCCTCCACCTTCCCGAAGG - Intronic
919070660 1:192751392-192751414 TGCAGCCCGAGCCTCCCCGACGG + Intergenic
920117215 1:203629374-203629396 TGCACTCTGAGCCTCCACGATGG - Intronic
1070581205 10:77721112-77721134 TGAACCCTGAACATCTGAGATGG + Intergenic
1075693704 10:124418631-124418653 TGCCCCCTGAAGCTGCGCGCCGG + Intronic
1078643184 11:13114804-13114826 TGCACCCTGACCCTCTGGCAAGG - Intergenic
1089321045 11:117626903-117626925 AGCACCCTGATCCTCCAGGAAGG + Intronic
1090586149 11:128215335-128215357 TGCAGCCTGAGCCTCCCTGACGG - Intergenic
1091335772 11:134764687-134764709 TGCACCTTGAACCTGCCCAAAGG - Intergenic
1099265620 12:80443083-80443105 TGCTGCCTGTACCTCCTCGAAGG - Intronic
1115427558 14:33277953-33277975 TGCAACCCGAACCTCTGCAACGG - Intronic
1120813345 14:88826897-88826919 TGCATCCTGAATCTCCAAGAAGG - Intronic
1129235544 15:74221797-74221819 AGCACCCTGAGCCTCTGGGAAGG - Intergenic
1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG + Intronic
1130000127 15:80039045-80039067 TCCACCCTGACCCTCCCCTATGG + Intergenic
1130975261 15:88769011-88769033 TGCACCGTGAATCTCCGAGAGGG + Intergenic
1142230388 16:88897469-88897491 TGCTCCCTGAACGCCCGCCATGG + Intronic
1142363103 16:89636511-89636533 TGCACCCTGACTCTCCCCGCAGG + Exonic
1145303654 17:21657287-21657309 GGCCGCCTGAACCTCCGCCAGGG + Intergenic
1145346390 17:22044562-22044584 GGCCGCCTGAACCTCCGCCAGGG - Intergenic
1151777306 17:76214162-76214184 TGCACCCTCAACCTGTGGGATGG + Intronic
1153868755 18:9297241-9297263 CGCAGCCTGAGCCTCCCCGACGG + Intergenic
1156405173 18:36776314-36776336 TACACCCTGAGCCTCTGCGATGG - Intronic
1161501663 19:4619614-4619636 TGCACCCAGAGCCTGCGAGACGG - Intergenic
1163300089 19:16439728-16439750 TGCACCATGAACCTCAAAGAAGG + Intronic
925636679 2:5947842-5947864 TCCATCCAGAACCTCCGTGAGGG - Intergenic
935708553 2:105877361-105877383 TGCACCCTGATCCTGCCCAATGG - Intronic
938583929 2:132670746-132670768 TGCCCCCTCTTCCTCCGCGAAGG + Intronic
946366936 2:219254178-219254200 AGCACCCTGCATCTCCGCGGAGG - Intronic
948152881 2:235758406-235758428 TGCACCATGTACCTCTGGGAAGG - Intronic
1171521174 20:25774972-25774994 GGCCGCCTGAACCTCCGCCAGGG + Exonic
1171555750 20:26081506-26081528 GGCCGCCTGAACCTCCGCCAGGG - Intergenic
1182292408 22:29291151-29291173 TGCACCCTCAACCTCTCCCAAGG - Intronic
955900979 3:63754091-63754113 TTCACCCTGAACTGCCACGACGG - Intergenic
956593516 3:70942298-70942320 TGCACCCAGACCCTCGGAGAAGG + Intergenic
960559996 3:119073466-119073488 TGCGGCCTGAGCCTCCCCGATGG - Intronic
962398712 3:135039487-135039509 TGCAGCCCGAGCCTCCCCGACGG - Intronic
969381804 4:6804954-6804976 TGCACCCGGAACCTCCAAGAAGG - Intronic
974838194 4:67275308-67275330 TGCAGCCTGAACCTCCCTGATGG - Intergenic
978351436 4:107824659-107824681 TGCACCTTAAACAGCCGCGAGGG + Exonic
983834197 4:172369531-172369553 TGCAGCCTGAACCTCCCCGACGG - Intronic
992050400 5:72935540-72935562 TGCAGCCAGAGCCTCCCCGACGG + Intergenic
999369879 5:151048221-151048243 TGCACCCTGAACCTCCGCGAGGG + Intronic
1002077561 5:176717980-176718002 TGCACCTGGAACCTCCCCAAAGG + Intergenic
1013703771 6:112807416-112807438 TGCACTCTGAATCTCCCAGAGGG - Intergenic
1016159605 6:140861977-140861999 TGCAGCCTCAACCTCCTCGGTGG - Intergenic
1018265421 6:162019419-162019441 TGCACCCTCAAGCTCAGAGATGG + Intronic
1019479459 7:1259931-1259953 TGCACCCAGGACCACCACGAGGG - Intergenic
1028913032 7:96229010-96229032 TGCAGCCTGAGCCTCCCCAACGG + Intronic
1035288075 7:157818997-157819019 TGCACCCTGAGCCTCCTCTCAGG + Intronic
1035557981 8:580479-580501 CCCACCCAGAACCTCCGCAAAGG + Intergenic
1035563674 8:627629-627651 GGCACCCCGGACCTCCGTGAAGG - Intronic
1062658062 9:137614342-137614364 CGCACCCTCCACCTCCGCAATGG - Exonic
1203770313 EBV:46738-46760 TGCACCGTGAAGCTGCGCCACGG + Intergenic
1190372653 X:49757881-49757903 GGGACCCTGAAACTCAGCGAGGG - Intergenic
1194672172 X:96747265-96747287 TGCAACCTGAACCTCCACTTGGG - Intronic
1201416495 Y:13752932-13752954 CGCACCCAGAGCCTCCGCGCAGG - Intergenic