ID: 999370541

View in Genome Browser
Species Human (GRCh38)
Location 5:151052441-151052463
Sequence TTCTCCGTAGTTGGCTCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 60}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999370541_999370545 1 Left 999370541 5:151052441-151052463 CCTTGGGAGCCAACTACGGAGAA 0: 1
1: 0
2: 0
3: 4
4: 60
Right 999370545 5:151052465-151052487 CCTGACCAAGTATCAGCCATGGG 0: 1
1: 0
2: 1
3: 6
4: 76
999370541_999370543 0 Left 999370541 5:151052441-151052463 CCTTGGGAGCCAACTACGGAGAA 0: 1
1: 0
2: 0
3: 4
4: 60
Right 999370543 5:151052464-151052486 GCCTGACCAAGTATCAGCCATGG 0: 1
1: 0
2: 1
3: 7
4: 77
999370541_999370546 2 Left 999370541 5:151052441-151052463 CCTTGGGAGCCAACTACGGAGAA 0: 1
1: 0
2: 0
3: 4
4: 60
Right 999370546 5:151052466-151052488 CTGACCAAGTATCAGCCATGGGG 0: 1
1: 0
2: 0
3: 6
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999370541 Original CRISPR TTCTCCGTAGTTGGCTCCCA AGG (reversed) Intronic