ID: 999373060

View in Genome Browser
Species Human (GRCh38)
Location 5:151067972-151067994
Sequence CTGAGTGTTGCGTGTTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 145}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999373060_999373066 4 Left 999373060 5:151067972-151067994 CCTCCAAAACACGCAACACTCAG 0: 1
1: 0
2: 1
3: 14
4: 145
Right 999373066 5:151067999-151068021 TCTTGGCGCTGGGGAGTCAACGG 0: 1
1: 1
2: 1
3: 17
4: 193
999373060_999373065 -5 Left 999373060 5:151067972-151067994 CCTCCAAAACACGCAACACTCAG 0: 1
1: 0
2: 1
3: 14
4: 145
Right 999373065 5:151067990-151068012 CTCAGTTTCTCTTGGCGCTGGGG No data
999373060_999373064 -6 Left 999373060 5:151067972-151067994 CCTCCAAAACACGCAACACTCAG 0: 1
1: 0
2: 1
3: 14
4: 145
Right 999373064 5:151067989-151068011 ACTCAGTTTCTCTTGGCGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 133
999373060_999373068 10 Left 999373060 5:151067972-151067994 CCTCCAAAACACGCAACACTCAG 0: 1
1: 0
2: 1
3: 14
4: 145
Right 999373068 5:151068005-151068027 CGCTGGGGAGTCAACGGGAAAGG 0: 1
1: 0
2: 0
3: 10
4: 156
999373060_999373072 20 Left 999373060 5:151067972-151067994 CCTCCAAAACACGCAACACTCAG 0: 1
1: 0
2: 1
3: 14
4: 145
Right 999373072 5:151068015-151068037 TCAACGGGAAAGGGGTTCATGGG No data
999373060_999373071 19 Left 999373060 5:151067972-151067994 CCTCCAAAACACGCAACACTCAG 0: 1
1: 0
2: 1
3: 14
4: 145
Right 999373071 5:151068014-151068036 GTCAACGGGAAAGGGGTTCATGG 0: 1
1: 0
2: 1
3: 7
4: 109
999373060_999373070 12 Left 999373060 5:151067972-151067994 CCTCCAAAACACGCAACACTCAG 0: 1
1: 0
2: 1
3: 14
4: 145
Right 999373070 5:151068007-151068029 CTGGGGAGTCAACGGGAAAGGGG 0: 1
1: 0
2: 0
3: 25
4: 191
999373060_999373069 11 Left 999373060 5:151067972-151067994 CCTCCAAAACACGCAACACTCAG 0: 1
1: 0
2: 1
3: 14
4: 145
Right 999373069 5:151068006-151068028 GCTGGGGAGTCAACGGGAAAGGG 0: 1
1: 0
2: 0
3: 13
4: 248
999373060_999373063 -7 Left 999373060 5:151067972-151067994 CCTCCAAAACACGCAACACTCAG 0: 1
1: 0
2: 1
3: 14
4: 145
Right 999373063 5:151067988-151068010 CACTCAGTTTCTCTTGGCGCTGG 0: 1
1: 0
2: 0
3: 8
4: 101
999373060_999373067 5 Left 999373060 5:151067972-151067994 CCTCCAAAACACGCAACACTCAG 0: 1
1: 0
2: 1
3: 14
4: 145
Right 999373067 5:151068000-151068022 CTTGGCGCTGGGGAGTCAACGGG 0: 1
1: 0
2: 1
3: 17
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999373060 Original CRISPR CTGAGTGTTGCGTGTTTTGG AGG (reversed) Intronic
900075093 1:808061-808083 CTCCCTGTGGCGTGTTTTGGAGG - Intergenic
900679813 1:3910596-3910618 CTGAGGGCTGCATGTTTTGAGGG + Intergenic
900898281 1:5498880-5498902 CTGAGTCTTCCTTGTTTTGGGGG - Intergenic
901594591 1:10374770-10374792 CTAAGTGTGGCGTATTTTGATGG + Intronic
911018812 1:93365518-93365540 CTGGGTGTTGCGAGTATAGGAGG + Exonic
913024804 1:114827047-114827069 CTGAGGGATGAGTGTTTTAGTGG - Intergenic
914948351 1:152086870-152086892 CTTTGTGTTGCTTCTTTTGGTGG + Exonic
915036609 1:152932878-152932900 CTAAGTGTTCCTTGATTTGGGGG - Intergenic
916006348 1:160664756-160664778 CTGATTGTGGCCTTTTTTGGTGG + Intergenic
918539710 1:185617320-185617342 CAGAGTGTGGTGTGTCTTGGTGG - Intergenic
922270933 1:224032960-224032982 CTCCCTGTGGCGTGTTTTGGAGG - Intergenic
923230333 1:231980477-231980499 ATGACTGTTGTTTGTTTTGGGGG - Intronic
923765239 1:236887263-236887285 CTGAGTTCAGCGTGGTTTGGTGG + Intronic
923801177 1:237210712-237210734 CTGGGTGCTGTGTGTTGTGGGGG + Intronic
924328423 1:242918971-242918993 CTGAGTGTGGTGTGTGGTGGTGG + Intergenic
1064797263 10:19026844-19026866 ATGAGCGTTGAGTGTTTTAGAGG + Intergenic
1067796811 10:49326910-49326932 GTGTGTGTTGCTTGTTTTGGGGG - Exonic
1068271732 10:54736405-54736427 CTGAGGGCTGCGTTTGTTGGGGG - Intronic
1069662442 10:70132527-70132549 CTCCCTGTTGCGTTTTTTGGGGG + Intronic
1071309908 10:84333306-84333328 TTGAGTGCTGGGTGTTTTGCTGG + Intronic
1074688842 10:115985136-115985158 CTAAGTGTTTCATGTTTTGATGG - Intergenic
1076006764 10:126953962-126953984 CTGTGTGTTGGGTGTCATGGTGG + Intronic
1076400514 10:130181436-130181458 ATGAGTGTTGAGAGTTTTTGGGG + Exonic
1077289828 11:1783872-1783894 CTGAGTGTGGGGTGCTGTGGGGG - Intergenic
1079091145 11:17481084-17481106 CTGGGTGTTGGCTGTTTTAGAGG - Intergenic
1079701287 11:23551768-23551790 CTGATTGTTGCTTCCTTTGGAGG - Intergenic
1082170309 11:48996490-48996512 CTTAGTGTCACTTGTTTTGGGGG - Intergenic
1084258119 11:67956101-67956123 CTGTGTCTTGCATGATTTGGAGG + Intergenic
1084477981 11:69399767-69399789 ATGAGTGGTGCGTGTGTTTGAGG + Intergenic
1084814631 11:71639113-71639135 CTGTGTCTTGCATGATTTGGAGG - Intergenic
1090992533 11:131832119-131832141 GTGTGTGTGGCGTGTTTTGAAGG - Intronic
1096255794 12:50061564-50061586 TTGTGTGTTGGGTGTGTTGGAGG - Intronic
1098426760 12:70372993-70373015 GTGAGTGTGGGGTGTGTTGGGGG + Intronic
1100618555 12:96250138-96250160 CTTAGTTTTGCGTGGTTTAGAGG - Intronic
1103275999 12:119712432-119712454 CTGGGATTTGCGTGGTTTGGTGG - Intronic
1111315395 13:86551419-86551441 CTGAATGTTGTTTGTTTTGCTGG - Intergenic
1119077134 14:71652255-71652277 CTGGCTGTTGCCTATTTTGGTGG - Intronic
1119423053 14:74519166-74519188 CTTATTTTTGTGTGTTTTGGGGG - Intronic
1119427719 14:74546652-74546674 CTGAGCGTTGGGTGTGTTGGGGG + Intronic
1121116702 14:91348504-91348526 CGGAGTGTTGTTTGTTTTTGTGG - Intronic
1127051229 15:55086233-55086255 CTGAGTGAGGAGTGCTTTGGGGG + Intergenic
1128282410 15:66407238-66407260 CAGAGTGGTGCTGGTTTTGGGGG + Intronic
1128315892 15:66659240-66659262 GTGTGTGTTGTGTGTGTTGGAGG + Intronic
1128664903 15:69530947-69530969 CGGTGTGTTGAGTGTTGTGGGGG + Intergenic
1128791305 15:70436057-70436079 CTGTGTCTTGTGTGTTGTGGAGG + Intergenic
1129343263 15:74900137-74900159 CTGAGTGCTGTGTGTTCTGCAGG - Exonic
1129711284 15:77821380-77821402 TGGAGTGATGGGTGTTTTGGAGG + Intergenic
1129751642 15:78069352-78069374 CTGAGTGGTGGGTGTTGTGATGG - Intronic
1131156420 15:90078805-90078827 CTGAGATGTGCGTGTTTTGGGGG - Intronic
1132659747 16:1056000-1056022 CTGAGGGTTGCCTGCTTTGGGGG + Intergenic
1133237370 16:4393572-4393594 CTGAGTCTTGTGTGTGTAGGGGG + Intronic
1133369855 16:5239450-5239472 CTGTGTCTTGCATGATTTGGAGG - Intergenic
1140550035 16:75855820-75855842 CTGTGTTTTGTGTATTTTGGTGG + Intergenic
1144661837 17:17076008-17076030 GTGGGTGTTGCCTGTTTTGTGGG + Intronic
1146054419 17:29574048-29574070 CTGCGTGTTGAGTGTGTGGGCGG - Exonic
1148216770 17:45837615-45837637 CTGAGCTTTGTGTTTTTTGGGGG - Intergenic
1148854034 17:50569008-50569030 GTGTGTGTTGTGTGTGTTGGGGG + Intronic
1151428450 17:74046712-74046734 CTGTGTCTTGCCTGTCTTGGTGG - Intergenic
1152322323 17:79614545-79614567 CGCTCTGTTGCGTGTTTTGGCGG - Intergenic
1160028308 18:75237152-75237174 CTGAGAGTTGCGTGTCAGGGCGG + Intronic
1160177463 18:76607595-76607617 GTGAATGTTGAGTGTTTTAGGGG - Intergenic
1163462288 19:17446290-17446312 CTGAGTGTTGAGTGTTTGAGTGG - Intronic
1164533509 19:29065997-29066019 CTGAGTTTTGAGTGATTTGGTGG - Intergenic
1164779993 19:30884451-30884473 CTCAGGGTTCCGTGTTTTGGGGG + Intergenic
1165652387 19:37502711-37502733 CTGAGTGTTGTTTGTTGTGGGGG - Intergenic
925404034 2:3594488-3594510 CCGAATCTTGCATGTTTTGGGGG - Intergenic
926677730 2:15640273-15640295 CTGAGTATTCAGTGTTATGGTGG + Intergenic
932287933 2:70552966-70552988 CGGAGCGGTGCGTTTTTTGGCGG - Intronic
932680236 2:73818473-73818495 CTGCGTCTTGCGGCTTTTGGAGG - Intergenic
939384788 2:141482272-141482294 CTCAATGTTTTGTGTTTTGGGGG + Intronic
940579508 2:155559754-155559776 CTAAGTGTTTCATGTTTTGGTGG - Intergenic
943349389 2:186779474-186779496 CTGAATGGTGTGTGTTTTGGGGG - Intergenic
947880698 2:233508572-233508594 CTGAGTGTTGCTCTTTTTTGGGG + Intronic
1169897709 20:10522248-10522270 CTTAATGTTGCCTTTTTTGGGGG + Intronic
1170100146 20:12690056-12690078 CTATGTGGTGGGTGTTTTGGGGG - Intergenic
1171348407 20:24484185-24484207 CTGAGGGTTGGGAATTTTGGAGG + Intronic
1171841644 20:30220337-30220359 GTGTGTGTTGTGTGTTTTGAGGG + Intergenic
1172533564 20:35653002-35653024 CTGGATGTTCCGGGTTTTGGAGG - Exonic
1173667039 20:44770455-44770477 CTGAGGGCTGTGTGTATTGGGGG + Intronic
1175661976 20:60821252-60821274 CTGAGGGATGCGGGTTTAGGAGG + Intergenic
1180639707 22:17288494-17288516 CTGAGTGCTGTGTGTTGTGCTGG - Intergenic
1185111110 22:48900863-48900885 CTCAGGGCTGGGTGTTTTGGGGG - Intergenic
1185111120 22:48900897-48900919 CTCAGGGCTGGGTGTTTTGGGGG - Intergenic
1185111138 22:48900965-48900987 CTCAGGGCTGGGTGTTTTGGGGG - Intergenic
1185111148 22:48900999-48901021 CTCAGGGCTGGGTGTTTTGGGGG - Intergenic
1185111157 22:48901033-48901055 CTCAGAGCTGGGTGTTTTGGGGG - Intergenic
1185111165 22:48901067-48901089 CTCAGGGCTGGGTGTTTTGGGGG - Intergenic
1185111180 22:48901137-48901159 CTCAGGGCTGGGTGTTTTGGGGG - Intergenic
1185111189 22:48901171-48901193 CTCAGGGCTGGGTGTTTTGGGGG - Intergenic
1185111198 22:48901205-48901227 CTCAGGGCTGGGTGTTTTGGGGG - Intergenic
949322753 3:2829350-2829372 TGGAGTGTTTCGTGTTTAGGAGG + Intronic
949755759 3:7409171-7409193 CTGAGTGTTTGGTAGTTTGGGGG - Intronic
951105240 3:18734607-18734629 CTGAGTGATGAGAGTTGTGGAGG - Intergenic
951376216 3:21921296-21921318 CCAAGTGTTACGTGATTTGGGGG - Intronic
952749991 3:36817307-36817329 GTGTGTGTGGTGTGTTTTGGGGG - Intergenic
953831061 3:46297830-46297852 CTGAGTGCTGGGTGTGTTTGAGG + Intergenic
954369222 3:50161514-50161536 CTGGGTGTTGCCGGTTGTGGCGG + Intronic
955075828 3:55612166-55612188 ATGAGTTGTGCGTTTTTTGGTGG + Intronic
957073065 3:75580614-75580636 CTGTGTCTTGCATGGTTTGGAGG + Intergenic
957560562 3:81815502-81815524 ATGACTGTTGCGGGTTTTGCTGG + Intergenic
959028486 3:101270359-101270381 CTGGGTGTTGAGTGTGTTTGTGG - Intronic
959145040 3:102534043-102534065 TTGAGTCTTGCCAGTTTTGGGGG - Intergenic
961004931 3:123398493-123398515 CTGCGTGCTGCATGGTTTGGAGG - Intronic
962149820 3:132880952-132880974 ATGAGTGTTGGCTGTTCTGGGGG + Intergenic
963076723 3:141354202-141354224 CTGAGTGTTAAGGGTTTTGTAGG - Intronic
967930353 3:194686334-194686356 CTGAGGGTTGTGTGTGTTAGGGG + Intergenic
968515036 4:1012187-1012209 CTGAGTGTTGTGTGTCCTGCGGG + Intronic
969016666 4:4107911-4107933 CTGTGTCTTGCATGATTTGGAGG + Intergenic
969737291 4:9000404-9000426 CTGTGTCTTGCATGATTTGGAGG - Intergenic
969796494 4:9531992-9532014 CTGTGTCTTGCATGATTTGGAGG - Intergenic
971293290 4:25365224-25365246 CTGAATGTTGCATGCTTTTGTGG - Intronic
971391453 4:26189933-26189955 GTGTGTGTTGGGTGTGTTGGGGG - Intronic
979821446 4:125177725-125177747 CTTATTATTGCTTGTTTTGGAGG - Intergenic
981236483 4:142421981-142422003 CTGAGTTTTGTCTGATTTGGAGG - Intronic
982067843 4:151670390-151670412 CTGAGGGTTGGGGGATTTGGGGG + Intergenic
982308792 4:153962404-153962426 CTCTGTGTTGCGTGTGTTAGAGG + Intergenic
983219573 4:165031647-165031669 CTGATTGTTGTATTTTTTGGTGG - Intergenic
985063857 4:186103547-186103569 CTAAGTTTTGCGTTATTTGGAGG - Intergenic
987233510 5:15919818-15919840 CTGGGTTTTGCATGATTTGGAGG + Intronic
987283259 5:16431722-16431744 CTGAGTGTTGCCTGCTTTCAAGG - Intergenic
989235009 5:39136980-39137002 CTGAGTGTAGCGTTTACTGGTGG + Intronic
992249618 5:74864857-74864879 TTTAGTTTTGCTTGTTTTGGAGG - Intronic
992892094 5:81213135-81213157 CTGGGTGTTGGGTGCCTTGGAGG + Intronic
995500849 5:112805126-112805148 CTGAGTGTTGGGATTTTTGTGGG + Intronic
996114839 5:119606552-119606574 CTGAGTGTTTTGTGTTGTGTTGG + Intronic
997629332 5:135354860-135354882 CTGTGTGGGGTGTGTTTTGGTGG - Intronic
997869057 5:137490738-137490760 ATGAGAGTTGCCAGTTTTGGGGG + Intronic
998786216 5:145711722-145711744 CTGTGTGTTGGGTGGGTTGGGGG + Intronic
999373060 5:151067972-151067994 CTGAGTGTTGCGTGTTTTGGAGG - Intronic
1001507130 5:172288492-172288514 CTGGGTATTGTGTGTGTTGGCGG - Intergenic
1002907273 6:1459793-1459815 TTGTGTGTTACGTGTTGTGGGGG + Intergenic
1006843649 6:37048122-37048144 CTGGATGTTGGGTGGTTTGGAGG - Intergenic
1007311641 6:40951165-40951187 GTGAGTGTTGAGAGTTTTGTGGG - Intergenic
1010749757 6:79604682-79604704 TTGTGTGTTGAGTGTGTTGGGGG + Intergenic
1012978785 6:105808551-105808573 TTGAATGTTGCTTGGTTTGGAGG + Intergenic
1013836690 6:114342761-114342783 CTGAGTGTTGCTCTTTTGGGCGG - Exonic
1013987414 6:116211887-116211909 CAGTGTGTTGTGTGTGTTGGGGG - Intronic
1017681153 6:156865204-156865226 CTGTGTCTTTCTTGTTTTGGTGG + Intronic
1020224099 7:6266170-6266192 CTGAGTGGAGAGTGGTTTGGAGG - Intronic
1023364484 7:39450226-39450248 CAGACTGGTGCCTGTTTTGGGGG + Intronic
1025710390 7:63902365-63902387 CTGAGTGTTCCGTCTTTAGGTGG + Intergenic
1025818745 7:64944192-64944214 TTGCGTGTTGCCTGTTTTGGGGG + Intergenic
1026428414 7:70319582-70319604 CTGTGTGTTTAGTGTTGTGGGGG + Intronic
1029075141 7:97928711-97928733 CTGTGTCTTGCATGATTTGGAGG + Intergenic
1030909887 7:115233853-115233875 ATGTGTGTTGTGTGTGTTGGGGG + Intergenic
1031620553 7:123929528-123929550 CTGAAAGGTGTGTGTTTTGGGGG + Intronic
1032598739 7:133270398-133270420 GTGAGTGTTACCTGTTTTTGAGG + Intronic
1032890393 7:136189161-136189183 CTGCTTCTTGCTTGTTTTGGGGG - Intergenic
1034312425 7:150100399-150100421 CTGAGTTTTACAGGTTTTGGGGG + Intergenic
1034794427 7:154000265-154000287 CTGAGTTTTACAGGTTTTGGGGG - Intronic
1035540554 8:433426-433448 CTCCCTGTGGCGTGTTTTGGAGG + Intronic
1036567637 8:9951203-9951225 CTGAGTGATGTGTGATTTGGAGG - Intergenic
1042170332 8:65985102-65985124 ATGATTGTTGTTTGTTTTGGAGG - Intergenic
1043770786 8:84197502-84197524 ATAAGTGTTGGTTGTTTTGGTGG - Intronic
1046825323 8:118684478-118684500 CTTAGTTTTATGTGTTTTGGTGG - Intergenic
1046921952 8:119740073-119740095 TTGAGAGTTGCGGGTTTAGGAGG - Intronic
1060796935 9:126518690-126518712 CTGAGTGTTACGTTTGCTGGGGG - Intergenic
1061625319 9:131837887-131837909 CAGAGGGCTGTGTGTTTTGGGGG - Intergenic
1190423356 X:50308594-50308616 CTCAGTGTTGGGTGTTTTGGAGG - Exonic
1195897628 X:109763127-109763149 CTGAGTCTTGTGTGGTTAGGGGG - Intergenic
1197972550 X:132130389-132130411 CTGATTGTTCCGTGTTGTGATGG + Intergenic