ID: 999373143

View in Genome Browser
Species Human (GRCh38)
Location 5:151068407-151068429
Sequence GCGAATCCTGCATTATCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 69}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999373141_999373143 -9 Left 999373141 5:151068393-151068415 CCAAGGGCAATGAGGCGAATCCT 0: 1
1: 0
2: 0
3: 7
4: 77
Right 999373143 5:151068407-151068429 GCGAATCCTGCATTATCAGGTGG 0: 1
1: 0
2: 0
3: 1
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999373143 Original CRISPR GCGAATCCTGCATTATCAGG TGG Intronic
900886825 1:5421149-5421171 GGGAATCCTCCATGATAAGGAGG - Intergenic
904901308 1:33859471-33859493 GATGATCCTGGATTATCAGGTGG - Intronic
906400520 1:45500911-45500933 ACGAATCCGGCATTATATGGTGG - Intronic
906951070 1:50334823-50334845 GCGATTCCTGCCTTAGAAGGGGG - Intergenic
906993915 1:50769585-50769607 GCTAATCCTTCATGATCAAGTGG + Intronic
907805121 1:57811111-57811133 GATTATCCTGGATTATCAGGTGG - Intronic
913203052 1:116511759-116511781 GTGTATCCTGGATTAACAGGAGG + Intergenic
1066315722 10:34244473-34244495 TTGAATCCAGCAGTATCAGGAGG + Intronic
1075476632 10:122740973-122740995 GATTATCCTGCATTATCAGGTGG - Intergenic
1081925622 11:46826035-46826057 GAGTATTCTGCATTACCAGGCGG + Intronic
1083022127 11:59517942-59517964 GCTAATCCTGCTATATAAGGGGG - Intergenic
1088536148 11:110863832-110863854 GCTCATCCTGGATTATCTGGTGG - Intergenic
1092516381 12:9218663-9218685 GCTAATCCACCATTATCAAGTGG + Intergenic
1093713350 12:22353231-22353253 GGCAATCCTGCATTATGAGAAGG + Intronic
1097886439 12:64733661-64733683 GTTAAGCCTCCATTATCAGGTGG - Intronic
1101732810 12:107440595-107440617 GGGAAGCATGCATTCTCAGGGGG - Intronic
1103335134 12:120183750-120183772 GAGGGTCCTGCATTACCAGGCGG - Intronic
1110698093 13:78515557-78515579 GCTTATCCAGCATGATCAGGTGG - Intergenic
1112143596 13:96673245-96673267 GATTATCCTGGATTATCAGGCGG - Intronic
1113785408 13:112999808-112999830 ACAACTCCTACATTATCAGGCGG - Intronic
1113874614 13:113586189-113586211 GCGAATCCTGCATTTCTTGGGGG + Intronic
1118571255 14:67197707-67197729 GAGAATCCTGCATGATGAAGAGG + Intronic
1124176172 15:27426257-27426279 ACGAGGCCTGCTTTATCAGGTGG - Intronic
1132756041 16:1485985-1486007 GCCAATGCTGCACTAGCAGGCGG - Exonic
1136748205 16:32610877-32610899 GTGACTCATGCATTATGAGGTGG + Intergenic
1140743914 16:77964536-77964558 GATTATCCTGCATTATCTGGGGG - Intronic
1203050340 16_KI270728v1_random:870084-870106 GTGACTCATGCATTATGAGGTGG + Intergenic
1143659502 17:8315866-8315888 GCGGAACCAGCAGTATCAGGAGG + Exonic
1146583701 17:34063160-34063182 GAGAATCCACCATTATCAAGTGG + Intronic
1168619987 19:57870495-57870517 GTCATTCCTGCATTAACAGGAGG - Intronic
1168626726 19:57924362-57924384 GCAATTCCTGCATTGGCAGGAGG - Intronic
925463139 2:4082473-4082495 GAGAATCCTGCATGCCCAGGCGG - Intergenic
928623207 2:33112154-33112176 GAGAATTCTGAATTATCTGGAGG + Intronic
934052582 2:88222990-88223012 GAGAATCCAGCATGACCAGGTGG + Intergenic
948295260 2:236855807-236855829 GCTGAGCCTGGATTATCAGGTGG - Intergenic
1171857438 20:30360170-30360192 GAAAATCCTGTATTATCTGGAGG - Intergenic
1172747180 20:37220665-37220687 ACGAATCCTGCATTGTTAGTTGG + Intronic
1175068643 20:56312598-56312620 GGAAATTGTGCATTATCAGGGGG - Intergenic
1177956699 21:27606745-27606767 GCGAATCCTGCATCGTCAACTGG - Intergenic
1181323095 22:22023717-22023739 GCGTATCCTGTCTTATCAGCAGG + Intergenic
1183644664 22:39117610-39117632 CCGCATCCTGTTTTATCAGGGGG - Intergenic
1184225117 22:43125224-43125246 CCGAATCCTGTTTTATCAGCAGG + Intronic
964239041 3:154569983-154570005 GATTATCCTGGATTATCAGGTGG - Intergenic
968755193 4:2412069-2412091 GCGCATCCTTCATCCTCAGGGGG + Intronic
971447098 4:26762693-26762715 GATTATCCTGGATTATCAGGTGG + Intergenic
974232703 4:59137374-59137396 GATTATCCTGCATTATTAGGGGG - Intergenic
975604168 4:76136606-76136628 GGTTATCCTGGATTATCAGGAGG + Intronic
984682237 4:182623797-182623819 GCGACCCCCGCAATATCAGGAGG - Intronic
985483381 5:133585-133607 GCCATTCCTGCATGATAAGGTGG - Intergenic
990512239 5:56499282-56499304 GCCAACCCTGTATTATCATGTGG - Intergenic
993007219 5:82441620-82441642 GCAAATGATGCATTATCATGAGG + Intergenic
997486646 5:134236616-134236638 GCCAGTCCTGCATTGTCTGGTGG + Intergenic
999244802 5:150148394-150148416 GTGAATCCTGTGTTATTAGGAGG - Intronic
999373143 5:151068407-151068429 GCGAATCCTGCATTATCAGGTGG + Intronic
999515615 5:152298846-152298868 GCTAATCCTGGGTTCTCAGGTGG + Intergenic
1003410877 6:5862036-5862058 GATAATCCTGGATTATCTGGGGG + Intergenic
1005996184 6:30932782-30932804 ACGCATCCTGGATTGTCAGGGGG + Intergenic
1007280248 6:40706927-40706949 GCGATTCCTGCCTTATGAGCAGG + Intergenic
1008470868 6:51883010-51883032 GCATATCCTGGATCATCAGGGGG + Intronic
1016892066 6:149016697-149016719 CAGAGTCCTGCATTAACAGGAGG - Intronic
1017770772 6:157642901-157642923 GCGAATCCTGGAGAAGCAGGGGG + Intronic
1032198192 7:129801326-129801348 GGTCATCCTGGATTATCAGGTGG + Intergenic
1039030942 8:33308970-33308992 GCGAATCCTCCATAGTCTGGTGG + Intergenic
1044574025 8:93749249-93749271 CTGAATCCTGCATTAACAGTGGG + Intergenic
1045643960 8:104282081-104282103 CCGCATCCTGCTTTATCAGTGGG + Intergenic
1050283733 9:4079388-4079410 GCAAATCCTGCAGTTTAAGGAGG - Intronic
1052051965 9:23859216-23859238 GCCAATCCTGCATCACCAGAGGG - Intergenic
1186131419 X:6470111-6470133 GATCATCCTGAATTATCAGGTGG + Intergenic
1187044385 X:15632021-15632043 GCTATTCCTGCAATGTCAGGGGG + Intronic
1190969391 X:55334157-55334179 GCCAATCCTGTATTATGAGTTGG + Intergenic
1193001099 X:76563333-76563355 GCGTATCCAGCATGATCAAGTGG + Intergenic