ID: 999375272

View in Genome Browser
Species Human (GRCh38)
Location 5:151082066-151082088
Sequence CTCAAAAAGAATTAGGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 465
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 428}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999375263_999375272 26 Left 999375263 5:151082017-151082039 CCCATTTCACTGGTACTGTTGAA 0: 1
1: 0
2: 0
3: 10
4: 150
Right 999375272 5:151082066-151082088 CTCAAAAAGAATTAGGGGAAAGG 0: 1
1: 0
2: 2
3: 34
4: 428
999375264_999375272 25 Left 999375264 5:151082018-151082040 CCATTTCACTGGTACTGTTGAAA 0: 1
1: 0
2: 1
3: 12
4: 165
Right 999375272 5:151082066-151082088 CTCAAAAAGAATTAGGGGAAAGG 0: 1
1: 0
2: 2
3: 34
4: 428

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999375272 Original CRISPR CTCAAAAAGAATTAGGGGAA AGG Intronic
903038601 1:20511472-20511494 CTCAAAAAGCTTTACTGGAATGG - Intergenic
905485022 1:38289621-38289643 CTCAATAGGAGCTAGGGGAAGGG + Intergenic
905503941 1:38461616-38461638 CTCTAAAAGAATCGGGGGCATGG + Intergenic
907828331 1:58039604-58039626 CTGAAAAAGAATGTGGGGGACGG - Intronic
908796315 1:67833646-67833668 CTCCATGAGAATTAGAGGAAGGG - Intergenic
909031611 1:70548117-70548139 CTCCATAAAAATTAGGGGACTGG - Intergenic
909321997 1:74301397-74301419 CTCAAAAAAAATGATGGGGAGGG + Intronic
909763606 1:79325475-79325497 CCCAGAAATAATTAAGGGAAAGG + Intergenic
910097468 1:83539792-83539814 TTTAAAAAGAATCAGGTGAATGG - Intergenic
910263840 1:85317229-85317251 CTCTGAAAGAATAAGGGGAGAGG - Intergenic
910534490 1:88281201-88281223 ATGAAAGAGAATAAGGGGAAGGG - Intergenic
911022868 1:93406849-93406871 TTGAAAAAAAATTAGGCGAATGG - Intergenic
911074241 1:93856970-93856992 TTCAAAAAAAATTAGATGAATGG + Intergenic
911276571 1:95867210-95867232 ATCAAAAAGAATTATGGAAAAGG + Intergenic
911489061 1:98539917-98539939 GTTAAAAAAAATTAGGGGTAAGG + Intergenic
911598303 1:99821507-99821529 ATGAAAAAGAATTTGGGTAAGGG + Intergenic
912242501 1:107926355-107926377 TTCAAAAAGAATAATGGGTAGGG + Intronic
912628972 1:111230048-111230070 CTCAAAAAGAACTAGAACAAGGG - Intronic
913105137 1:115607326-115607348 CTCAAAAAGAAATAGGAAACTGG + Intergenic
913447130 1:118961465-118961487 CTCAAAGTGCATGAGGGGAAGGG + Intronic
913949410 1:143211316-143211338 CTCAAATGGAATTATCGGAAGGG - Intergenic
915893549 1:159793417-159793439 TTAGAAAAGAATTAGGGGAGAGG + Intergenic
916038274 1:160940769-160940791 TTGAAAAAGGATTAGGCGAATGG - Intergenic
916159582 1:161895519-161895541 CTTAAAAATATTTGGGGGAATGG - Intronic
917271392 1:173278689-173278711 TTCAAAATTAATTAGAGGAATGG + Intergenic
917816646 1:178717103-178717125 CTCAACAGGAATTTGGAGAAGGG + Intergenic
918507524 1:185273030-185273052 CTCAAAAAAAAAAAGGGGGAGGG + Intronic
918748908 1:188244909-188244931 TTTGAAAAGATTTAGGGGAAGGG + Intergenic
918792351 1:188845436-188845458 CTCAAGAAGAATTCGGAGACAGG + Intergenic
919156469 1:193772359-193772381 CACAAAGGGAATTAGGAGAAAGG + Intergenic
919558131 1:199086787-199086809 CTGAGAAAGAAGTAGGGAAAAGG - Intergenic
922632440 1:227130222-227130244 CTCATAAAGAATTATGGTAAGGG - Intronic
923934796 1:238748358-238748380 CTCATAAAGTATCAGGGAAAGGG + Intergenic
924575620 1:245278075-245278097 TTCTAAAAGGGTTAGGGGAAAGG + Intronic
924705719 1:246500354-246500376 CCCAGAAAGAATTAGAGCAATGG - Intronic
1063090292 10:2859629-2859651 CTCAAAAAGAATTAGGATATAGG - Intergenic
1064953948 10:20886220-20886242 CTTAAAAAGATTCTGGGGAAAGG + Intronic
1065265340 10:23969520-23969542 CTCAAAATGCATTATGGAAATGG - Intronic
1066105191 10:32150132-32150154 CACAAAAAGACTTAGTGGAATGG - Intergenic
1066406622 10:35125405-35125427 ATCAAAAAGAATCAAAGGAATGG - Intergenic
1067205420 10:44208218-44208240 CTGAGAAAGAGATAGGGGAAGGG - Intergenic
1067822590 10:49542715-49542737 CTTAGAAATAATTAAGGGAAAGG + Intergenic
1071114393 10:82200510-82200532 CTCACAAGGAATGAGGGGATAGG + Intronic
1071829237 10:89355322-89355344 CCCAGAAATAATTATGGGAAAGG + Intronic
1072029042 10:91499360-91499382 CTCTAAAAGACTTAGTAGAAGGG - Intronic
1073584095 10:104692136-104692158 CTCAACAAGGATCTGGGGAAGGG + Intronic
1073980644 10:109149717-109149739 CTCCCAAAAAATTAGGGGACTGG + Intergenic
1074071165 10:110071109-110071131 TTAAAAAAAAATTGGGGGAATGG + Intronic
1074549780 10:114431850-114431872 CTCAAAAAGAAGGGGGGAAATGG - Intronic
1074639138 10:115359602-115359624 CTCAATAAGAGTTATGAGAATGG - Intronic
1077808864 11:5617175-5617197 ATGAAAAACAATTAGGGAAATGG + Intronic
1078601475 11:12735315-12735337 CTGAATAAGCATTAGGGGAAGGG + Intronic
1078789273 11:14526488-14526510 CTCTAAAAGTATTAGGGCAGCGG - Intronic
1079523798 11:21360833-21360855 CACATAAAGACTTAAGGGAATGG - Intronic
1079951974 11:26817368-26817390 CTCACATAAAATTAAGGGAAAGG - Intergenic
1080011420 11:27463312-27463334 CTCAAAATGAACTTGGAGAACGG + Intronic
1080754195 11:35179776-35179798 CTGAGAAAGAAGTGGGGGAATGG + Intronic
1081159978 11:39738431-39738453 CTCTAAAAGTATTAGGGCGATGG - Intergenic
1081175991 11:39927088-39927110 CTCAAAAAGACTAGGTGGAAAGG - Intergenic
1082150298 11:48730505-48730527 TTCAAAAAAAATTAGAAGAATGG + Intergenic
1082598505 11:55116244-55116266 AGCAAAAGGAATTTGGGGAATGG - Intergenic
1082599280 11:55129094-55129116 TTCAAAAAAAATTAGACGAATGG + Intergenic
1083009793 11:59386541-59386563 TTGAAAAAAAATTAGGTGAATGG - Intergenic
1084623625 11:70291612-70291634 CACAAAAAGAAACAGAGGAAGGG - Intronic
1085673403 11:78491044-78491066 TTAATAAAGAATTAGGGGATGGG + Intronic
1086146002 11:83552499-83552521 CTCATAAAGAAGTTGGTGAATGG + Intronic
1087713266 11:101579208-101579230 CTTAAAAAAAATTAATGGAAGGG - Intronic
1088057451 11:105602514-105602536 CTAGAAAAGAAATGGGGGAAAGG + Intergenic
1090308787 11:125716397-125716419 TTGAAAAAAAATTAGGCGAATGG - Intergenic
1090365868 11:126205030-126205052 CTTTAAAAGAATTAAAGGAAGGG - Intronic
1090851948 11:130578626-130578648 CTTAAGAAATATTAGGGGAAGGG - Intergenic
1090948509 11:131452104-131452126 CTCGAAAAGAAGTGGGGGGAGGG + Intronic
1090986810 11:131774424-131774446 ACCAAAAAGAATTATGGCAAAGG - Intronic
1091183931 11:133630658-133630680 CTCTAAAAGTATTAGGGAAGTGG - Intergenic
1091987806 12:4926959-4926981 CACAAAAACACTTAGGGGCATGG - Intronic
1092267833 12:6996559-6996581 CTCAAAAAGTATTAGCTGAATGG + Intronic
1092368509 12:7897068-7897090 ATCAAAAAGAATTATGGGCCGGG + Intergenic
1092645662 12:10569040-10569062 CTAAAAGAGAATTAGAAGAATGG + Intergenic
1093321767 12:17722254-17722276 CTCTAAAAGTATTAGGGCAGCGG + Intergenic
1094216393 12:27947310-27947332 CTCAACAAGAATTTGTCGAACGG - Intergenic
1094293077 12:28873796-28873818 CTCGAGAAGAATTAGAGGATGGG + Intergenic
1094454857 12:30620808-30620830 CTCAAAAAGAATTATGGCTTTGG + Intergenic
1094523021 12:31213327-31213349 TTCAAAAAGAAACTGGGGAAAGG + Intergenic
1094774434 12:33707954-33707976 CTATAAAAGAGTTAGGTGAAAGG - Intergenic
1095628716 12:44348657-44348679 ATTAAAAAGAATAATGGGAAGGG + Intronic
1095998762 12:48111973-48111995 CTCTAAAAGTATTAGGGCAGCGG + Intronic
1096087253 12:48874056-48874078 CTAAAAAAAAATTAGGAGGAAGG + Intergenic
1097147254 12:56950406-56950428 CACAGAAAGCATTAGGGGAAAGG - Intergenic
1097732438 12:63144586-63144608 CTGAAAAAGTATTCCGGGAAGGG - Exonic
1097743615 12:63274141-63274163 CACAGAAAGAATGAGGGCAATGG + Intergenic
1098934489 12:76462692-76462714 CACAAAAAATATTAGGGAAAGGG + Intronic
1099748727 12:86743237-86743259 TTCACAAAGAACTAGGGAAATGG + Intronic
1099844488 12:88012545-88012567 CTCTTAAAGAATTAGTGAAAAGG - Intronic
1099873074 12:88371716-88371738 CTCTAAAAGTATTAGGGCAGTGG - Intergenic
1100189497 12:92175641-92175663 AGCAAAAAGAATTAGCGAAAAGG - Intergenic
1100342074 12:93688857-93688879 CTGAAGAAGAATTAGGGTGATGG - Intronic
1101565138 12:105897713-105897735 CTCAGGAACAATTAAGGGAAAGG + Intergenic
1102355630 12:112232592-112232614 CTCACAAATAATTAAAGGAAAGG - Intronic
1102355768 12:112234003-112234025 CTCACAAATAATTAAAGGAAAGG - Intronic
1102468614 12:113145762-113145784 CTCAAAAGGAAGGAGGGGGAGGG - Intergenic
1102537283 12:113590940-113590962 TTCAAAAAAAAGTAGGGGTACGG + Intergenic
1102604763 12:114059867-114059889 CTCTAAAAGTATTAGGGCAGTGG - Intergenic
1105007922 12:132734419-132734441 CTCAACAAGAAACAGGAGAACGG - Exonic
1106231438 13:27824041-27824063 CCCAAAAAAAGTGAGGGGAAAGG + Intergenic
1106617382 13:31341818-31341840 TTGAAAAAGAATTAGAAGAATGG + Intergenic
1108252312 13:48579417-48579439 CTCAAAAATAAGAAAGGGAAGGG - Intergenic
1108995095 13:56720991-56721013 CTCAACAAGACTTACAGGAAAGG + Intergenic
1109113349 13:58351450-58351472 CTGAAAAAAAATTAGACGAATGG - Intergenic
1109147127 13:58792934-58792956 ATCAAAAAGAATTAGAGCAAAGG - Intergenic
1109316154 13:60752487-60752509 ATCAAACAAAAATAGGGGAAAGG - Intergenic
1109353168 13:61208666-61208688 CTCTAAAAGTATTAGGGCAGCGG - Intergenic
1109691045 13:65889566-65889588 GTCACAAAGAATTTGGAGAAAGG - Intergenic
1109745278 13:66616570-66616592 CTCAGAAAGAACAAGAGGAATGG + Intronic
1110259029 13:73464546-73464568 CTTAAAAAAAATTAGGGGCCAGG - Intergenic
1111629562 13:90832719-90832741 CTCAAAATAATTTAGTGGAATGG + Intergenic
1112163762 13:96895967-96895989 CCCAAGAATAATTAAGGGAAGGG + Intergenic
1112336959 13:98523985-98524007 CTCAACAAGAATTGTGGGACAGG - Intronic
1112578569 13:100659167-100659189 ATGAAAAGGAATTAGGGGGATGG + Intronic
1113343964 13:109455483-109455505 TTCAAAAAAAATTAGAGCAATGG + Intergenic
1114659088 14:24333582-24333604 CTCAGAAACAAATAGGGGATGGG - Intronic
1115052885 14:29086132-29086154 TTCAGAAAGAATGTGGGGAAGGG - Intergenic
1117327827 14:54685037-54685059 CTGAAAAAGATTTAGGTGAATGG + Intronic
1119560013 14:75582511-75582533 CTCTAAAAGTATTAGGGCAGTGG + Intronic
1119759985 14:77143407-77143429 CTCACAAGGTATTTGGGGAATGG - Intronic
1120067897 14:80066126-80066148 CTAAAAAAGGATTAGGAGAGTGG + Intergenic
1120387208 14:83861843-83861865 CTGAAAGACAAATAGGGGAATGG + Intergenic
1122055614 14:99096255-99096277 CTGAAACCTAATTAGGGGAAAGG - Intergenic
1123832673 15:24157184-24157206 TTGAAAAAAAATTAGAGGAATGG - Intergenic
1123889637 15:24763933-24763955 CCCAGAAATAATTAAGGGAAAGG - Intergenic
1124784623 15:32668307-32668329 GTGAAAAAGAAGTAGAGGAATGG + Intronic
1125138529 15:36374058-36374080 CCCAAAAAGAAATAGTGCAATGG - Intergenic
1125404764 15:39340771-39340793 CTCAAAGCGAATTAGGAAAATGG + Intergenic
1125442434 15:39717411-39717433 ATGCAAAAGCATTAGGGGAAGGG - Intronic
1125530343 15:40409097-40409119 ATGTAAAAGCATTAGGGGAAAGG + Intronic
1125789404 15:42352190-42352212 CTCAAAAAAGGTGAGGGGAAAGG - Exonic
1126073756 15:44888319-44888341 CTCAAACACAATTATGGTAAGGG + Intergenic
1126084433 15:44998535-44998557 CTCAAACACAATTATGGTAAGGG - Intergenic
1126755746 15:51923383-51923405 CTCAAAAAGAAGCAGCAGAAGGG + Intronic
1127113926 15:55705456-55705478 CACAAAAAGAATAAGTAGAAAGG - Intronic
1127896507 15:63304390-63304412 TTCAAAAAGAATTATCCGAATGG - Intronic
1131322846 15:91412193-91412215 CTCAAAACTAATCTGGGGAATGG + Intergenic
1131684961 15:94758335-94758357 CTCTAAAAGAATTAGGGTGGTGG - Intergenic
1132295638 15:100732329-100732351 CCCAGAAAGAAAGAGGGGAAAGG - Intergenic
1133967091 16:10539395-10539417 CCCATAAGGAATTGGGGGAAAGG - Intronic
1134037642 16:11043517-11043539 CTCAAAATGAAAATGGGGAAAGG - Intronic
1136047793 16:27628870-27628892 ATCAAAATTAATTAGGGGCAGGG + Intronic
1136928514 16:34397101-34397123 CCCAAAAAAGATTTGGGGAAAGG - Intergenic
1136976060 16:35014703-35014725 CCCAAAAAAGATTTGGGGAAAGG + Intergenic
1137695671 16:50460607-50460629 CCCAAAAAGGCTTGGGGGAAGGG - Intergenic
1138137794 16:54538547-54538569 ATCAAAGAGATTTAAGGGAAGGG - Intergenic
1138278944 16:55758120-55758142 CTCTACAAGAATAAGGAGAAAGG - Intergenic
1138289590 16:55835554-55835576 CTCTACAAGAATAAGGAGAAAGG + Intergenic
1138874537 16:60933676-60933698 CTTAAAATGATTTATGGGAAAGG - Intergenic
1138914486 16:61446733-61446755 GTCAAAAGGAATATGGGGAAAGG + Intergenic
1139712973 16:68790557-68790579 CTCAAAAAGAATAAGGAGAATGG - Intronic
1145070459 17:19801276-19801298 CTCAAAAAGAAGTTGGGGCCGGG + Intronic
1146967148 17:37042004-37042026 CTCAAAAAGAAAATGGGCAAAGG - Intronic
1147269577 17:39258950-39258972 CTGAAAGAGAATAAGGGGAAAGG + Intergenic
1147682098 17:42256245-42256267 CTCAAAAAAAGTTGGGGGGATGG - Intronic
1147958527 17:44151717-44151739 CTCAAAAAGTCTTAGGGGTAGGG - Intronic
1148552114 17:48556576-48556598 CTCAAAAAGAAAAAGGGGGAGGG - Intronic
1149268381 17:54952243-54952265 CTCAAACAGAATTAGAAGTATGG + Intronic
1150615586 17:66768380-66768402 CTTAAAAATGAATAGGGGAAAGG - Intronic
1151085898 17:71380312-71380334 GTCAAAAAGAGGTTGGGGAAAGG - Intergenic
1151610758 17:75172914-75172936 CTCAAAAGGAATTACGGGCCAGG - Intergenic
1152131528 17:78479843-78479865 CTCAAGAAGAATTTTGGCAAAGG + Intronic
1152156441 17:78636767-78636789 CTCAAAAAGAATGAGGGGGCTGG + Intergenic
1153211971 18:2777069-2777091 CACAAAAAGTATTAGGGTATGGG - Intronic
1153241995 18:3039485-3039507 CTCAGAAGGACTTAGGGAAAGGG + Intergenic
1153572949 18:6491674-6491696 CACAACAGGAGTTAGGGGAATGG + Intergenic
1156580794 18:38372456-38372478 CTCAAAAGGAAATCAGGGAATGG - Intergenic
1156657223 18:39303048-39303070 CTAAAAAAAAATTAGGGGTAAGG + Intergenic
1156698608 18:39796853-39796875 CTCAAAAAGAACAAGAGGGATGG - Intergenic
1156740670 18:40323863-40323885 ATACAAAAGAATTGGGGGAAAGG + Intergenic
1157279939 18:46340231-46340253 TTCCAAGAGAATTGGGGGAAAGG + Intronic
1157930271 18:51814066-51814088 CTCAAAAATAAATAAGTGAAAGG - Intergenic
1161085616 19:2333607-2333629 CTCAAAATGAAGTAGGGGGCAGG - Intronic
1161374990 19:3934876-3934898 CTCGAAAAATATTAGGGGCAGGG - Intronic
1161452605 19:4354861-4354883 CTCAAAGAGAATGAGGGCACAGG + Intronic
1162306091 19:9874907-9874929 CTCAAAAGCCATTAGGGGACGGG - Intronic
1162413630 19:10520930-10520952 CCAAAGAAGAATTAGGGCAATGG + Intergenic
1162758931 19:12876821-12876843 CTCAAAAACAAATTTGGGAAGGG - Intronic
1162776148 19:12980869-12980891 ATAAAAAAAAATCAGGGGAATGG - Intergenic
1164037021 19:21464358-21464380 CTCAAAAAGAAATAAGAAAAAGG + Intronic
1165024569 19:32950261-32950283 CTTAAAAAGCATTAGGGGCCAGG + Intronic
925040736 2:731675-731697 CACAATAAGAATTTGGGGGACGG + Intergenic
925530369 2:4853164-4853186 CACAAAAGCAATTTGGGGAAAGG + Intergenic
928276140 2:29901869-29901891 TTTACAAAGAATTAGGGGTAGGG + Intronic
928795470 2:35013681-35013703 TTGAAAAAAAATTAGGCGAATGG + Intergenic
928817449 2:35316242-35316264 CTGATAAAGAATTAGGACAAAGG + Intergenic
928857389 2:35816743-35816765 CTCTAAAAGTATTAGGGCAGCGG - Intergenic
930487105 2:52023951-52023973 CTCTAAAAGTATTAGGGCAGCGG + Intergenic
930712488 2:54562018-54562040 CTGAAAAAGAAAAAGAGGAAGGG - Intronic
931793691 2:65689488-65689510 ATCAAAATGAATGAGGGCAATGG + Intergenic
932657299 2:73621134-73621156 CTCAATAAGAATTTGTTGAATGG + Intergenic
932843037 2:75102044-75102066 CTCAAAAAGCATTAGTGCCATGG + Intronic
933381508 2:81552642-81552664 CTGAAAAAGAATTAGTGAACTGG + Intergenic
933555388 2:83824299-83824321 CTTAAGAAGCATAAGGGGAAAGG - Intergenic
934033482 2:88068071-88068093 CTCAAAAATCATCAGGGGAAGGG + Intronic
934725539 2:96615534-96615556 GTCAAAATGACCTAGGGGAAAGG + Intronic
935566660 2:104615936-104615958 TTCAAAAATAATTATGGGCATGG - Intergenic
936376116 2:111942699-111942721 CTACAAAAGAACGAGGGGAAAGG + Intronic
936487550 2:112939245-112939267 CTGAAAAGGAATTTAGGGAAAGG + Intergenic
937448550 2:121979852-121979874 ATCAAAAAAAAGTAGGGGTAGGG - Intergenic
938719850 2:134056923-134056945 CTCAAGGAGATTTAGGGGAGAGG - Intergenic
939154066 2:138502779-138502801 CTCAAAAAGAATTAGGAAAAAGG - Intronic
939236075 2:139495231-139495253 GTCAAATAGAACTAGGGAAATGG + Intergenic
940107599 2:150116469-150116491 CTCTAAAAGCATTAGGGCAGTGG - Intergenic
940312393 2:152292261-152292283 CTCAATGAGAATGAGAGGAAAGG + Intergenic
940419847 2:153467456-153467478 CACCAAAAGAATTAGCAGAATGG + Intergenic
940608687 2:155962717-155962739 CTCAAAAATAAAGGGGGGAATGG - Intergenic
940919118 2:159287638-159287660 ATGAAAAAGATTAAGGGGAAAGG + Intergenic
941072365 2:160969384-160969406 ATTAAAAACAATTAGGGGAGAGG - Intergenic
943198426 2:184786607-184786629 ATAAAAAGGAATTAGGAGAAAGG - Intronic
943450389 2:188037095-188037117 CTCTAAAAGTATTAGGGCAGCGG - Intergenic
943865590 2:192921922-192921944 CTCTAAAAGTATTAGGGCAGCGG - Intergenic
945465279 2:210162312-210162334 CTTAACAGGAATTAAGGGAAAGG + Intronic
945845075 2:214934489-214934511 CTGGAAAAGAATTTGTGGAATGG + Intronic
946284681 2:218694038-218694060 CTCACAAAGAGTATGGGGAATGG + Intronic
946723813 2:222641017-222641039 TACAAAATGAATTAGGGCAATGG + Intronic
947009541 2:225550567-225550589 CATAAAAAGAAGTAGGGAAATGG + Intronic
1170695786 20:18657327-18657349 CTGAAAAAAAACAAGGGGAAAGG + Intronic
1171168223 20:22992467-22992489 TTGAAAAAGAATTAGATGAATGG - Intergenic
1172085014 20:32374588-32374610 TTCAAAAAGAATAAGGGGCCGGG - Intronic
1172642785 20:36451218-36451240 CTCAAAAACAATTATGGGTATGG - Intronic
1173626818 20:44479083-44479105 ATGAAAAAGAATTAGGGGGCCGG - Intronic
1174647598 20:52099229-52099251 ATAAACAAGAATTAGGGGAGAGG + Intronic
1174895285 20:54442676-54442698 CCCATAAAAAAGTAGGGGAAAGG - Intergenic
1176685868 21:9848061-9848083 CTCTAAAAGCATTAGGGTGATGG - Intergenic
1176725504 21:10428695-10428717 CTCTAAAAGATTGAGGGGGAGGG - Intergenic
1176911170 21:14566836-14566858 CTCAAAAAGAAATATGAGAAAGG - Intronic
1177030917 21:15981643-15981665 CTCTAAAAGTATTAGGGCAGCGG + Intergenic
1177840502 21:26229896-26229918 CTCTAAAAGTATTAGGGCAGTGG + Intergenic
1177874578 21:26615569-26615591 CTCAAAAAGAAAGAAAGGAAGGG + Intergenic
1178397807 21:32258151-32258173 CTCAGAAAGCATTGGGGGAGGGG + Intergenic
1178867854 21:36345246-36345268 CTCAAAAAAAAGGAAGGGAAAGG - Intronic
1179015004 21:37588782-37588804 CTCTAAAAGTATTAGGGCAGTGG + Intergenic
1179378952 21:40880763-40880785 ATGTAATAGAATTAGGGGAATGG + Intergenic
1181205518 22:21249067-21249089 CTCAAAAAATATTAGTTGAATGG + Intergenic
1182256165 22:29040178-29040200 CTCAAAAAAAAAAAGGGGGAGGG - Intronic
1182472607 22:30557613-30557635 CTCAAAGAGAGGTTGGGGAATGG + Intronic
1182832370 22:33314259-33314281 CTCCAAAAGAACTTGGAGAAAGG - Intronic
1183634210 22:39051236-39051258 CTCAAAAAGATAAAGAGGAACGG + Intronic
1184392884 22:44215362-44215384 CATAGAAAGAATTAGAGGAAGGG - Intronic
1184527556 22:45034476-45034498 GACAAAAAGAAATAGGGGGAAGG - Intergenic
949325986 3:2864878-2864900 CTTATAAATAATTAGGGGATAGG + Intronic
949758771 3:7444881-7444903 CTCAAAAAGAATTACAGCAAAGG - Intronic
950043036 3:9932682-9932704 CTCAAAAAGGATCACGCGAAAGG + Exonic
950422766 3:12908447-12908469 CTCAAAAAGGAGTCGGGCAACGG - Exonic
951060643 3:18202731-18202753 CTCAAAAAAATTTATGGAAAGGG + Intronic
951144154 3:19206383-19206405 CTGCAAAAGCATAAGGGGAAAGG + Intronic
951332112 3:21380620-21380642 CTCTAAAAGTATTAGGGCAGCGG + Intergenic
951368416 3:21813450-21813472 TTCAAAAAAGATTAGGTGAATGG + Intronic
951557076 3:23931666-23931688 CCCAATAAGTATTAGTGGAAGGG + Intronic
951836717 3:26991382-26991404 TTAAAAAAAAATTAGGCGAATGG - Intergenic
952343352 3:32463472-32463494 CTCTAAAAGTATTAGGGCAGTGG + Intronic
952737658 3:36706324-36706346 CACAAATAGAATTAGAGGGATGG - Intergenic
953669193 3:44948308-44948330 CTATAAAAGAATTCTGGGAAGGG + Intronic
954176488 3:48849332-48849354 CTCAAAAAAAAATAGGGGCCTGG - Intergenic
955487360 3:59448280-59448302 CTCAAAAAGAAAGAGGCCAAAGG - Intergenic
955870845 3:63436875-63436897 CTCAAAAAGAAACAAAGGAAAGG - Intronic
956000904 3:64729024-64729046 CTTAAAAAGAAATGGGGGGAAGG - Intergenic
956233253 3:67040535-67040557 CTCTAAAAGTATTAGGGCAGTGG + Intergenic
957348453 3:78992347-78992369 CTCAATAAGACTGATGGGAAGGG + Intronic
957496371 3:80996117-80996139 TTCACAAAGAATTATGGGAAAGG + Intergenic
957660086 3:83138795-83138817 CTTAAAAAGAAATAAGAGAATGG + Intergenic
957734670 3:84190011-84190033 CTCTAAAAGTATTAGGGCCACGG + Intergenic
957740782 3:84265663-84265685 CTCCCAAAGAATTTGGGGACTGG + Intergenic
958119887 3:89271906-89271928 CTGAAAAAGAGGAAGGGGAAGGG - Intronic
958739646 3:98053496-98053518 CTGAAAAAGAATTCTGAGAAGGG + Intergenic
959249024 3:103916539-103916561 ATCAAGAAGAGTTAGGGAAATGG - Intergenic
959308159 3:104695867-104695889 CTAAAAAAGGATTAGCTGAATGG - Intergenic
959483991 3:106907300-106907322 CTCAAATAGACTTACGGGTATGG + Intergenic
959613720 3:108323443-108323465 CTCAATAAAAATTTAGGGAAGGG - Intronic
959618123 3:108370575-108370597 TTGAAAAAAAATTAGGTGAATGG + Intronic
960501052 3:118438860-118438882 CTCAAAAAGACTTAGAAGTAAGG + Intergenic
962058955 3:131904836-131904858 CTTAATAAGAATTTTGGGAATGG - Intronic
962108742 3:132419655-132419677 CTCAATCAGAAGCAGGGGAAAGG - Intronic
962330267 3:134472035-134472057 CTCCAAAGGAAGTAGGGGAGAGG - Intergenic
962622024 3:137189802-137189824 CTCAGAATGAAGTAAGGGAAGGG + Intergenic
963320015 3:143801320-143801342 CTCTAAAAGTATTAGGGCAGTGG - Intronic
963723055 3:148886205-148886227 GTAAAAAATAATTAGGGAAAAGG - Intronic
964857436 3:161162027-161162049 ATTAAAAAGAATGAAGGGAAGGG + Intronic
965037231 3:163455225-163455247 CTAAAATAGAATGAGGGAAATGG - Intergenic
965825932 3:172729850-172729872 ATCCAAAAAATTTAGGGGAAAGG - Intergenic
966575738 3:181500718-181500740 CTCAAAAAGAAAAAGGAAAAAGG - Intergenic
966676607 3:182596754-182596776 CAAAAAAAAAATCAGGGGAAGGG + Intergenic
966794801 3:183702831-183702853 CTCAAAAAAAAAAAAGGGAATGG + Intronic
967245053 3:187478011-187478033 CCCAGAAATAATTAAGGGAAAGG + Intergenic
967386795 3:188920018-188920040 CTCAAAAAAAAAAATGGGAATGG - Intergenic
970472057 4:16388817-16388839 CTCAAAGAGAAATGGGGAAAGGG - Intergenic
971420976 4:26473927-26473949 CTCAAAAAGTAACAGGTGAAGGG + Intergenic
971575010 4:28262042-28262064 CTCAAAAGGAATTAGTTCAAAGG - Intergenic
973055468 4:45652418-45652440 CTGAAAAAAAATTAGATGAATGG + Intergenic
973225992 4:47785615-47785637 CTCAAAAGGAAATAGGGGGCTGG + Intronic
973337960 4:48975608-48975630 CTTAGAAAGGAGTAGGGGAAGGG - Intergenic
973873177 4:55187269-55187291 CTGACAAGGAATGAGGGGAAGGG + Intergenic
974110466 4:57519792-57519814 CAAAAAAAGAAATGGGGGAAAGG + Intergenic
975064690 4:70046001-70046023 CTGAAACAGAATTAGTGGCAGGG - Intergenic
975751912 4:77532930-77532952 CTAAAAAAAAATTAGATGAATGG - Intronic
976347195 4:84018034-84018056 GTCAAAGTGAATTAGGGGATTGG + Intergenic
976558821 4:86478448-86478470 CTCTAAAAGTATTAGGGCAGTGG - Intronic
977160974 4:93634761-93634783 CTACAAAAGAATTAGGAAAAGGG + Intronic
978066924 4:104416633-104416655 CTCATAAAGAGTTGGGGGCATGG + Intergenic
978102846 4:104863764-104863786 AAAAAAAAGAAATAGGGGAATGG + Intergenic
979171155 4:117602159-117602181 CTCTAAAAGTATTAGGGCAGCGG + Intergenic
979807204 4:124988820-124988842 CCCAGAAATAATTAAGGGAAAGG + Intergenic
980285194 4:130771229-130771251 CTCTAAAAGTATTAGGGCAGTGG - Intergenic
980528082 4:134015821-134015843 CTCTAAAAGTATTAGGGCAGTGG - Intergenic
981198605 4:141950411-141950433 TTCCAAAAAACTTAGGGGAAGGG + Intergenic
981756297 4:148144563-148144585 TTTAAAAAGAAGTAGGGGAAAGG + Intronic
981837895 4:149076751-149076773 CTCAAATAAAATGAGGGGATGGG - Intergenic
982459996 4:155657474-155657496 CTCAAAAAGAATAAAGCAAAGGG - Intergenic
982838744 4:160156066-160156088 TTGAAAAAAAATTAGGCGAATGG - Intergenic
983509428 4:168591229-168591251 CTCCAAAAGATTTACTGGAACGG + Intronic
983976711 4:173943774-173943796 CACACAAACAATTAGGGGCAGGG + Intergenic
984346818 4:178538849-178538871 CTCAAAAAGAATAAAAGAAATGG + Intergenic
986770185 5:10965954-10965976 CTCAAAAAAAAATGGGGGGAAGG - Intergenic
986971186 5:13339093-13339115 AACAAAAAAAAATAGGGGAAGGG - Intergenic
987552330 5:19399647-19399669 CTCCAAAGGAATTAGAGGCAGGG + Intergenic
989501101 5:42169225-42169247 CTTAAAAAGAAGCAGGGGAAGGG - Intergenic
990006784 5:50953628-50953650 CTCAAAAAGAAAGAAGAGAAGGG - Intergenic
990407217 5:55503774-55503796 CTCAAAACGAAGGAGAGGAAGGG + Intronic
990731901 5:58817929-58817951 ATTAAAAAGAATAAGGGAAATGG + Intronic
992178269 5:74172219-74172241 CACAAAATGGATCAGGGGAAAGG - Intergenic
992248394 5:74852613-74852635 CTCAAAAAGAATATGCTGAATGG + Intronic
992313255 5:75524800-75524822 GTCCAAAAGAACCAGGGGAAGGG + Intronic
992352128 5:75940682-75940704 ATGAAAGAGAATTAGGGGAAAGG + Intergenic
994777729 5:104056149-104056171 CTCAAAAAGAAATAGACAAATGG - Intergenic
995207222 5:109494684-109494706 CTCAAAAAAAAGTTGGGGAGAGG - Intergenic
995782031 5:115787328-115787350 CTCAACAAGAATTTGGGGGGGGG - Intergenic
996626749 5:125579461-125579483 GTAAATAAGAATTATGGGAAAGG + Intergenic
997444068 5:133928602-133928624 CTCAAAAAAAAAAAGGGGGAGGG + Intergenic
998656374 5:144184921-144184943 ATCAAAAAGAACAAGGGAAATGG - Intronic
998791290 5:145768238-145768260 AAAAAAAAGAATTAGGGGAAAGG + Intronic
999266233 5:150268757-150268779 CTCAAAAAAAATTATTAGAATGG - Intronic
999375272 5:151082066-151082088 CTCAAAAAGAATTAGGGGAAAGG + Intronic
999656827 5:153818720-153818742 CTCACAAAGATCTAGGTGAAGGG - Intergenic
1000688163 5:164279095-164279117 CTCAAAAATATATATGGGAATGG + Intergenic
1000760319 5:165215694-165215716 CTGAAACAGAATTAGTGGAATGG - Intergenic
1000885075 5:166740967-166740989 CTCTAAAAGTATTAGGGCAGCGG + Intergenic
1000967798 5:167680328-167680350 CTAAGAAAGAGTTGGGGGAAAGG + Intronic
1001170719 5:169416604-169416626 CTCAAAAAGACATGGGGGAAGGG + Intergenic
1001354025 5:171003070-171003092 CTCTGAAAGTATTAGGGCAATGG + Intronic
1001559282 5:172658846-172658868 CTGAAAAAGAATTGGGGGTAGGG - Intronic
1003315545 6:5008340-5008362 CTCATATAGAAGGAGGGGAAAGG - Intergenic
1003561599 6:7185206-7185228 CACAAAAAGAATTAAGGATATGG - Intronic
1004177921 6:13356544-13356566 CTGAAAGAAACTTAGGGGAATGG + Intergenic
1004470860 6:15928012-15928034 TTTCAAAAGAATTTGGGGAATGG - Intergenic
1005625843 6:27661667-27661689 CTCAAAATGAAGTTAGGGAAGGG + Intergenic
1005895649 6:30175241-30175263 TACAAAAAGCATTAGGGGCAAGG - Intergenic
1005913862 6:30334835-30334857 CTCAAAAAGAATCAAGAGGATGG - Intronic
1006002248 6:30974284-30974306 CTCAAAAAAAAAAAGAGGAAGGG + Intergenic
1006123555 6:31822384-31822406 CTCAAGCAGAAAGAGGGGAAAGG - Intergenic
1007794040 6:44333168-44333190 CTAAAACAGATTTAGGAGAAGGG - Intronic
1008201625 6:48598171-48598193 CTCAAAAAGATTTGTGGGTATGG - Intergenic
1009296334 6:61953821-61953843 CTCAGAAAGAGTGAGGGGAAGGG + Intronic
1009379339 6:63008828-63008850 CTCTAAAAGTATTAGGGCAGTGG - Intergenic
1009464602 6:63953909-63953931 CTCTAAAAGTATTAGGGCAGTGG - Intronic
1010800394 6:80168388-80168410 CTCAAAAAGAAAGAAGGGAAGGG + Intronic
1011367648 6:86600219-86600241 CTCTAAAAGTATTAGGGCAGTGG + Intergenic
1012520267 6:100112973-100112995 TTTAAATAAAATTAGGGGAAAGG + Intergenic
1014115074 6:117661396-117661418 CTCTAAAAGTATTAGGGCAGTGG + Intergenic
1014187916 6:118456948-118456970 CACCAAAAGGATTAGTGGAATGG + Intergenic
1014213191 6:118728211-118728233 CTCAAAAGCAATCAGGGAAAGGG - Intergenic
1016089753 6:139962562-139962584 CTCAAAAAGCAATAGAAGAACGG - Intergenic
1018718950 6:166557504-166557526 CTCAATTAGGATTATGGGAAGGG - Intronic
1020884498 7:13804659-13804681 TTGAAAAAAAATTAGAGGAATGG + Intergenic
1021172932 7:17417741-17417763 CTCTAAAAGTATTAGGGCAGTGG - Intergenic
1021559277 7:21953412-21953434 TTCAGAAAGAAATAGGGGGAAGG - Intergenic
1021850697 7:24805676-24805698 TTTAAAATAAATTAGGGGAATGG + Intronic
1023284914 7:38608863-38608885 CTACAGAAGAATTAGGGCAAAGG + Intronic
1023326484 7:39064030-39064052 ATCAAAATGAACTAAGGGAAAGG + Intronic
1024448371 7:49509081-49509103 CTAAAACAGAATTATGGAAATGG + Intergenic
1024791804 7:52973358-52973380 TTCAAGTAGAATTATGGGAAGGG + Intergenic
1026932323 7:74230355-74230377 CACAAAAAGCCTTAAGGGAATGG + Intergenic
1027662207 7:81000474-81000496 CTGAAAAATAATTACAGGAAAGG + Intergenic
1028241809 7:88430872-88430894 CTCAAGAAGAATTAAGATAATGG + Intergenic
1028292421 7:89081985-89082007 ATCAAAAATAATTATGAGAATGG - Intronic
1028545119 7:91989948-91989970 TTCAGAAAGAATCAGAGGAAAGG - Intronic
1028589623 7:92481462-92481484 CTCTAAAAGTATTAGGGCAGCGG + Intergenic
1028973671 7:96888439-96888461 TTCAAAAATAATTGGGGAAAGGG + Intergenic
1029487073 7:100849871-100849893 CTCAAAAAAAAAAAAGGGAAGGG - Intronic
1030728970 7:112961874-112961896 CACAAAATGAATTTGGGGAAGGG - Intergenic
1031369521 7:120947763-120947785 CTGACAAAGAAAGAGGGGAAAGG + Intergenic
1031429410 7:121648183-121648205 CACAAAAACAATGAGGGAAAGGG - Intergenic
1031500139 7:122504328-122504350 CTCAAAAAGAATAAAGTGAGAGG - Intronic
1031907251 7:127474428-127474450 CTCAAAGAGAAGTAGGGGGAAGG - Intergenic
1032961356 7:137038550-137038572 CACAGAAAGAAATAGGAGAAAGG + Intergenic
1033893369 7:146042612-146042634 CTGAAAAAAAATTAGACGAATGG - Intergenic
1034014253 7:147565290-147565312 CTCAAAATAAAGCAGGGGAAAGG + Intronic
1034372013 7:150606831-150606853 TTGAAAAAAAATTAGGTGAATGG + Intergenic
1034705028 7:153134000-153134022 CTCGAAAAAAAGTATGGGAATGG - Intergenic
1036004295 8:4644406-4644428 CTCAAAAAAAAATAGGGCAAAGG - Intronic
1036217245 8:6891022-6891044 CTCAAGGAGAATCGGGGGAAGGG - Intergenic
1036235285 8:7034705-7034727 CTCAAAAAAAATTGGGGTGAAGG - Intergenic
1036953248 8:13161078-13161100 CTCAAAAAGATTTAGGGAGGTGG + Intronic
1037056911 8:14454083-14454105 CGCAGCAAGAATTTGGGGAATGG + Intronic
1037512445 8:19597695-19597717 GTTAAAAGGAAGTAGGGGAAAGG + Intronic
1037546796 8:19931392-19931414 CTGAAAAAAAATTAGACGAATGG + Intronic
1037626917 8:20616143-20616165 TTCATAAAGCATTAGGGTAATGG - Intergenic
1038409218 8:27345158-27345180 CTCAAAAAGGGTTAGGGAGAGGG + Intronic
1039721976 8:40174133-40174155 CTCAACAAGCATTAAGGGGATGG + Intergenic
1040758297 8:50807735-50807757 CTCAAAAAGAACAAGATGAATGG + Intergenic
1041988530 8:63955908-63955930 CTCAAAAAGCAGTAGAGGGATGG - Intergenic
1042348872 8:67755928-67755950 CTGAAAAAAAATTAGATGAATGG - Intergenic
1042373706 8:68022718-68022740 CTAAAAATGAATTTGGGGGATGG - Intronic
1042837199 8:73089872-73089894 CTCAAAAAAAAGTAGGGGCAGGG - Intronic
1043072134 8:75651507-75651529 CTCAAAAAAAAATAAGGCAATGG + Intergenic
1043282724 8:78488585-78488607 CTCAGAAATAATCAGGGAAATGG + Intergenic
1043331310 8:79121469-79121491 CTCAAAAACCATAAGGGGGATGG - Intergenic
1043467077 8:80520188-80520210 GTCAAAAAGGAAGAGGGGAATGG - Exonic
1043707876 8:83376712-83376734 CTCAAAAAGAAGTACAGCAATGG - Intergenic
1043837953 8:85066625-85066647 CTCTAAAAGTATTAGGGCAGTGG - Intergenic
1044181437 8:89200419-89200441 CTCAATAAGTATTTGTGGAAGGG - Intergenic
1044516643 8:93146658-93146680 CTCCAAAAGAAAGAGGGCAAGGG - Intronic
1044738908 8:95305518-95305540 CTAAAAGGGAATGAGGGGAAGGG - Intergenic
1045210328 8:100091171-100091193 TTCAAAAAGAATCTGGGGACAGG - Intronic
1045499113 8:102731653-102731675 CTCAATAAGTATTTGTGGAAGGG + Intergenic
1045909762 8:107393506-107393528 TTTAAAAAAAATTAGGGGGATGG + Intronic
1046400138 8:113694561-113694583 CTCAAAAAGGGTTGGGGGAGAGG - Intergenic
1047187030 8:122642907-122642929 CTCAAACAGAATCCAGGGAAGGG + Intergenic
1048071944 8:131030393-131030415 CTCCAGAAGAAATAGTGGAAGGG - Intronic
1048474553 8:134731711-134731733 TTTAAAAAGAAATAGGGGCAGGG + Intergenic
1049601295 8:143508919-143508941 CTGGAAAAGAATTTGGGAAATGG - Intronic
1050556252 9:6792020-6792042 CTCAAAAAGAAAAAGAGAAAAGG + Intronic
1050842280 9:10167390-10167412 CTCAAGAAGAATAAGTGAAAGGG - Intronic
1052049826 9:23831859-23831881 CTTAAAAATTATTTGGGGAAGGG + Intergenic
1052685756 9:31753523-31753545 CTCAAGAAGAAGGAGGGGGAGGG - Intergenic
1053783443 9:41633536-41633558 CTCTAAAAGAATTAGGGTGATGG + Intergenic
1054171399 9:61843678-61843700 CTCTAAAAGCATTAGGGTGATGG + Intergenic
1054666135 9:67737134-67737156 CTCTAAAAGCATTAGGGTGATGG - Intergenic
1054921552 9:70547912-70547934 TTCAGAAAGAATTAGTGAAATGG + Intronic
1055996968 9:82170637-82170659 CTCAAATAGAGTTAGGGGTGGGG + Intergenic
1056615426 9:88161255-88161277 AGCAAAAAGGATTAGGGGAGAGG - Intergenic
1058508346 9:105689385-105689407 CTCAAAAAAAATAAAGAGAAAGG - Intergenic
1058829415 9:108802044-108802066 CCCAGGAATAATTAGGGGAAAGG - Intergenic
1186169454 X:6861416-6861438 TTTAGAAAGCATTAGGGGAAAGG - Intergenic
1187111576 X:16306792-16306814 CTCAAGAATATTTAAGGGAAAGG + Intergenic
1187314103 X:18176240-18176262 CTCAGAAAGAATAAGAGAAAAGG - Intronic
1187353117 X:18540687-18540709 CTCAAAAAAAAAGAAGGGAAGGG - Intronic
1188145165 X:26603144-26603166 CAAAAAAATAATTAGAGGAAAGG - Intergenic
1188337839 X:28960278-28960300 TTCAAAAAGCATTAGGAAAAGGG + Intronic
1188431280 X:30107209-30107231 CTCTAAAAGTATTAGGGCAGCGG - Intergenic
1190549998 X:51570282-51570304 ATCAATAAGAAAAAGGGGAAGGG - Intergenic
1190975662 X:55397773-55397795 TTGAAAAAAAATTAGAGGAATGG + Intergenic
1192401443 X:70839738-70839760 TTGAAAAAAAATTAGGCGAACGG + Intronic
1192854884 X:74998903-74998925 CTGAAAAAAAATTAGACGAATGG - Intergenic
1193610073 X:83620641-83620663 TTCAAAAAAATTTAGGAGAAGGG - Intergenic
1193668546 X:84354725-84354747 CTTAAGAATAATTTGGGGAAGGG + Intronic
1194027377 X:88769970-88769992 CTCAGAAAGAACAAGAGGAATGG + Intergenic
1194069765 X:89307264-89307286 TTGAAAAAGAGTTAGGAGAATGG + Intergenic
1194370165 X:93061416-93061438 TTGAAAAAGAATTAGACGAATGG + Intergenic
1195233581 X:102876072-102876094 CTGAAAAAAAATTAGACGAATGG - Intergenic
1195633196 X:107082053-107082075 GTCAAAAAGAAGTGGGGAAAGGG + Intronic
1195663254 X:107403316-107403338 GTGAAAAAGTATTTGGGGAAGGG - Intergenic
1196468507 X:115997168-115997190 TTCAAAAAAAATTAGGAGGAGGG - Intergenic
1197230886 X:124002622-124002644 CTCAAAAAAAATCAGGTGTATGG - Intronic
1198615792 X:138457075-138457097 CTGAAAAAAAATTAGATGAATGG + Intergenic
1199426240 X:147704088-147704110 CTCTAAAAAAATTGTGGGAATGG + Intergenic
1200723912 Y:6641400-6641422 TTGAAAAAGAGTTAGGAGAATGG + Intergenic
1200839051 Y:7761747-7761769 CCCAAAAAGCAATAGGGGATAGG + Intergenic
1201559788 Y:15303708-15303730 TTTAGAAAGCATTAGGGGAAAGG - Intergenic
1201748911 Y:17411529-17411551 CCCAAAAATAATTAAGGGAAAGG - Intergenic
1202085087 Y:21128395-21128417 CTTGAAAAAAATTAGGTGAATGG - Intergenic