ID: 999376614

View in Genome Browser
Species Human (GRCh38)
Location 5:151091170-151091192
Sequence AAGAAGAAGCAGAAAGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1714
Summary {0: 1, 1: 2, 2: 17, 3: 225, 4: 1469}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999376614_999376617 30 Left 999376614 5:151091170-151091192 CCAGCTCCTTTCTGCTTCTTCTT 0: 1
1: 2
2: 17
3: 225
4: 1469
Right 999376617 5:151091223-151091245 TCTCACCCTGTCGCCCAGGCTGG 0: 429
1: 18193
2: 107903
3: 191331
4: 322966
999376614_999376616 26 Left 999376614 5:151091170-151091192 CCAGCTCCTTTCTGCTTCTTCTT 0: 1
1: 2
2: 17
3: 225
4: 1469
Right 999376616 5:151091219-151091241 AGAGTCTCACCCTGTCGCCCAGG 0: 125
1: 6130
2: 43143
3: 126344
4: 185241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999376614 Original CRISPR AAGAAGAAGCAGAAAGGAGC TGG (reversed) Intronic
900700309 1:4044209-4044231 AAGAGGAAGAAGAAAGAGGCTGG - Intergenic
900752969 1:4410894-4410916 AAGAAGAACCAGGAAGATGCGGG - Intergenic
900848770 1:5125453-5125475 CAGAGTAAGCAGAAAGGAACAGG + Intergenic
901105392 1:6751879-6751901 AAAAAGAAGAAGAAAGGAGTAGG - Intergenic
901228367 1:7628163-7628185 ATGGAGAAGGAGAAGGGAGCTGG - Intronic
901284551 1:8066701-8066723 AAGAAGAAGAAAGAAGGAGGAGG - Intergenic
901284552 1:8066704-8066726 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
901353943 1:8626350-8626372 AGGAAGCAACAGAAAGGAGAGGG - Intronic
901385926 1:8909183-8909205 AAGAAAAAGCAGGAGAGAGCGGG - Intergenic
901757499 1:11450251-11450273 AAGAAGAAGGAGACAGGGACAGG + Intergenic
901773044 1:11540483-11540505 AAGAGGAAGGAGAGAGAAGCGGG - Intergenic
902229858 1:15021188-15021210 AGGAAGAGGCAGCATGGAGCAGG - Intronic
902542107 1:17162922-17162944 AAGAAGAAGCAGGGATGAGAAGG + Intergenic
902558955 1:17265057-17265079 AAGAAGAAGCAGTGAGGGGCAGG - Intronic
902599912 1:17533945-17533967 AAGAAGAAGAAGAAAGTGGGTGG - Intergenic
903296206 1:22344693-22344715 AATAAGAAGCAAAAAGAAGTGGG + Intergenic
903296560 1:22347065-22347087 AAGAAGAAGAAAGAAGGAGAAGG + Intergenic
903458033 1:23502095-23502117 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
903977784 1:27162478-27162500 ACAAAGAAGAAAAAAGGAGCAGG - Intronic
904101112 1:28028562-28028584 AAGAAGAAGAAGAAATCATCTGG - Intronic
904295769 1:29518898-29518920 AAGAAGAAGGAGAAGGAAGAAGG - Intergenic
904496823 1:30891868-30891890 AGGAAGAAGAAGAAGGGAGGAGG + Intronic
904600206 1:31668777-31668799 AAGAAGAAGCTGGCAGGGGCTGG - Intronic
904840445 1:33368789-33368811 CAGTAGAAGCAGAAAGGAAGGGG + Intronic
905448404 1:38042434-38042456 GAGGAGAAGAAAAAAGGAGCAGG + Intergenic
905575917 1:39044540-39044562 AAGAAGGAGAAGAAAGAAGGAGG + Intergenic
905847698 1:41246505-41246527 AAGGAGCAGCTGAAAGGAGTTGG + Intergenic
906174249 1:43756117-43756139 AAGAAGAAGAAGAAAAGAAAAGG + Intronic
906180817 1:43817339-43817361 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
906180828 1:43817431-43817453 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
906180865 1:43817675-43817697 GAGAAGAAGAAGGAAGGAGAAGG - Intronic
906518249 1:46452244-46452266 AAGAGGAAGCAGAGTGGGGCTGG + Intergenic
906647591 1:47486866-47486888 AAGAAAAAGCAGGAAGGAATTGG - Intergenic
907138532 1:52162469-52162491 AAGGGCAAACAGAAAGGAGCTGG - Intronic
907163660 1:52390914-52390936 AAAAAGAAGAAGAAAGAAACTGG + Intronic
907349046 1:53811098-53811120 AGGAAGCAGCAGAAAGGCCCTGG + Intronic
907449320 1:54533193-54533215 AAGAAGAAGAAAAAAGAAACAGG + Intergenic
907659745 1:56381055-56381077 TAGAAGAAGGAGAAAGGAATGGG + Intergenic
908688264 1:66748125-66748147 AAAAAAAAGCCTAAAGGAGCAGG - Exonic
908930760 1:69313949-69313971 CAGAAGAAAGAGAAAGGAGAAGG + Intergenic
908962658 1:69718024-69718046 AAGAAAAAGAAGAAAGGAGAGGG + Intronic
909238937 1:73187668-73187690 AAGAACAATCAGAAAGGAGAAGG - Intergenic
909253649 1:73390487-73390509 AAGAGGAAGAAGAAAGAAGTAGG - Intergenic
909349056 1:74627293-74627315 AAAAAGAATCACAAAGGAGTAGG + Intronic
909359838 1:74747264-74747286 ATGAAGAAGTAGAAAGCATCGGG + Intronic
909591262 1:77351807-77351829 AAGACAAAGGAGAAAGGAGCTGG + Intronic
909642971 1:77887904-77887926 AAGAAGAAGAAGAAAGTTGAAGG - Intergenic
909660004 1:78071528-78071550 AAGAAGGAGAAGGAAGGAGGAGG - Intronic
909660005 1:78071531-78071553 AAGAAGAAGGAGAAGGAAGGAGG - Intronic
909673482 1:78214043-78214065 AGGAAGCAGCAGAAAGGCCCTGG + Intergenic
909804292 1:79855883-79855905 AGGAAGAAGAAGAAAGCACCAGG + Intergenic
909991035 1:82222716-82222738 AATGAGGAGCAGAATGGAGCTGG - Intergenic
910110967 1:83683072-83683094 CAGAGAAAGCATAAAGGAGCTGG + Intergenic
910157461 1:84235016-84235038 TAGAAGAAGCAGCAAGCAGTAGG - Intronic
910275695 1:85446811-85446833 AAGGAGAAGAAGAAAGGAGGAGG - Intronic
910774851 1:90864513-90864535 AAGAAGAAGAAGAAAGAAGGTGG - Intergenic
910936638 1:92488343-92488365 AGGGACACGCAGAAAGGAGCAGG + Intergenic
911386347 1:97179917-97179939 AAGAAGAAAAGGAAAGGAGATGG + Intronic
911558354 1:99373900-99373922 TACATGAAGCAGAAAGGAACTGG + Intergenic
911663246 1:100527150-100527172 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
911682430 1:100732647-100732669 TGGAAGAAGCAGAAAGGAAGTGG + Exonic
911710804 1:101070497-101070519 GAGAAGAAAGAGAAAGGAGGTGG - Intergenic
911818796 1:102389368-102389390 AAGGAGAAGTAGAAATTAGCAGG + Intergenic
911880094 1:103225841-103225863 AAGAAGAAGCAAGAAGGTGGGGG - Intergenic
912164564 1:107028117-107028139 AAAAAGAAAAAGAAAGGAGGGGG - Intergenic
912616252 1:111102581-111102603 AGGAAGCAGCAGAAAGGCCCTGG - Intergenic
912710805 1:111948508-111948530 AAGAAGAAAGAGAAAGTAGAAGG - Intronic
912710879 1:111948861-111948883 AAGGAGGAGCAGCAAGCAGCAGG + Intronic
912918023 1:113837149-113837171 AAGAAGAAAGAGAAGGAAGCAGG + Intronic
913112204 1:115666673-115666695 AAAAAGAAGCCGAAAGGATGAGG - Intronic
913163884 1:116168158-116168180 AAGATGAAGCGGCAAGGAGGAGG + Intergenic
913370469 1:118093483-118093505 AAGAAGAAGAAGAAAGGTTCAGG - Intronic
913404432 1:118473867-118473889 AAGAAGGACCAGAAAGAACCAGG - Intergenic
913999317 1:143679395-143679417 ATGAAGAAAAAAAAAGGAGCGGG + Intergenic
914519647 1:148404101-148404123 AAGAGGAAGAAAAAAGGAGGAGG - Intergenic
914576828 1:148979499-148979521 AAGAAAAAGCAGAGAGAAGCTGG - Intronic
914808252 1:151007509-151007531 AAGAAGAAGAAGAAAAGAACTGG + Intronic
914960099 1:152197470-152197492 AAAAAGAAGAAGAAAGAAGAAGG - Intergenic
915119494 1:153619994-153620016 AAGAAGAAGCAGGAAGGGTGCGG + Intronic
915438978 1:155932254-155932276 AAGAAGAATTACAGAGGAGCTGG + Intronic
915602906 1:156933447-156933469 ACGGGGAAGCAGAAGGGAGCGGG - Intergenic
915732349 1:158062748-158062770 GAGAAGAATCAGAAAGGAAGAGG - Intronic
915816827 1:158976414-158976436 AATAAGATAGAGAAAGGAGCTGG - Intronic
915819668 1:159008745-159008767 AAGAAAAAGCAAAGAGGATCTGG - Intronic
915923474 1:159996741-159996763 AAGAAGAACTAGAAAGAAGGTGG - Intergenic
916066424 1:161139631-161139653 AAGAAAAAGAAAAAAGGAGTAGG + Intergenic
916307148 1:163349890-163349912 AACAAAAAACAGAAAAGAGCAGG - Intronic
916367437 1:164047861-164047883 AAGATGAAGCATGAAAGAGCTGG - Intergenic
916555180 1:165888625-165888647 AAAAAGAAGAAGAAAGAAACTGG - Intronic
916579821 1:166097192-166097214 AGGAAGCAGCAGAAAGGCCCTGG + Intronic
916882336 1:169032026-169032048 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
917318886 1:173758699-173758721 AGGAAGCAGCAGAAAGGCCCTGG + Intronic
917409380 1:174742214-174742236 AAGAAGAAGAAGAAAGAAAAGGG + Intronic
917539403 1:175898514-175898536 AAGAAGAAGCAGCCAGGTGTCGG + Intergenic
917965687 1:180177102-180177124 AAATAGAAGCAGCAAGGACCAGG - Intronic
918669829 1:187201144-187201166 AAAAAGAAGCAAAAATTAGCTGG + Intergenic
918800334 1:188962191-188962213 AAGAAGAAGCTGAATGGATTTGG - Intergenic
919016777 1:192048585-192048607 AAGAGGAAGAAGAAAGGAGAAGG + Intergenic
919303409 1:195799359-195799381 AAGGAGAAGCACAAAGCAGCAGG - Intergenic
919362617 1:196613468-196613490 AAAAAGAAGGAGAAATGAGAAGG - Intergenic
919450706 1:197769543-197769565 AATGAGAAGCAGAAAGCACCTGG + Intronic
919563379 1:199152842-199152864 AGAAAGAAGAAGAAAGGAGAAGG + Intergenic
919621652 1:199870375-199870397 GAGAACAAACAGAAAGGAGTGGG + Intergenic
919728579 1:200899158-200899180 AAGAGGAAGAAGAAGGGAGGAGG + Intronic
919824208 1:201492322-201492344 AAGGCAAAGCAGAAAGGAGCAGG - Intronic
919835871 1:201572930-201572952 AAGATGGAGTAGGAAGGAGCAGG - Intergenic
920025620 1:202992694-202992716 AAGAAAAAGTAGAAAGGGGTAGG - Intergenic
920320108 1:205114016-205114038 AAAAAGAAACAGAAAGGCGGTGG + Intronic
920645770 1:207803223-207803245 AAGATGATGCAGTAAGGAGATGG - Intergenic
920819522 1:209367355-209367377 AATTACAGGCAGAAAGGAGCTGG - Intergenic
921253943 1:213322723-213322745 AAGAAGAAGGAGAAAGAAAATGG - Intergenic
921408701 1:214811341-214811363 AAGAAGAAGCAGGAGAGATCTGG - Intergenic
921409906 1:214824036-214824058 AGGAAGCAGCAGAAAGGCCCCGG - Intergenic
921418583 1:214919802-214919824 AAGGAGAATCAGGAAGGAACTGG - Intergenic
921866102 1:220089124-220089146 AAGAAGGAGGAGGAAGGAGGAGG + Intronic
922018366 1:221676158-221676180 ATGCAGCAGCAGATAGGAGCAGG + Intergenic
922323854 1:224510710-224510732 AAGAGGAAACACAGAGGAGCCGG + Intronic
922464375 1:225836743-225836765 CAGCAGAAGCAGAGAGGAGAAGG + Intronic
922546239 1:226459364-226459386 AAGAAGAAGGTGAGATGAGCTGG + Intergenic
922561293 1:226571621-226571643 AAGAAGAAGAAGAAGGGAGAAGG - Intronic
922609185 1:226911800-226911822 AAGAAGAAGAAGAAGACAGCTGG - Intronic
922673503 1:227532900-227532922 AAGAAGCAGCAGAAAGATCCTGG - Intergenic
922681705 1:227603631-227603653 ATGAAGCAGCAGAAGGGGGCTGG - Intronic
922779634 1:228241139-228241161 AGGAAGAGGCCCAAAGGAGCAGG + Intronic
923085297 1:230698593-230698615 AAGAATCCCCAGAAAGGAGCAGG + Intergenic
923098503 1:230794069-230794091 AGGAAGAAGCAGAAAGACCCTGG + Intronic
923272321 1:232368907-232368929 AAGAGGAAGGGGAAAGGAGAGGG - Intergenic
923329267 1:232907481-232907503 AAGAAGAAGAAGTAAGGGGCTGG + Intergenic
923378668 1:233392609-233392631 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
923432482 1:233936649-233936671 AAGAAGGGGAAGAAAGGAGGAGG - Intronic
923495584 1:234521719-234521741 ATGGAGAAGCAGCAAGGGGCAGG - Intergenic
923595979 1:235361173-235361195 AAGAAGAGGAAGCAGGGAGCCGG - Intergenic
923629956 1:235643142-235643164 AGGCAGAAGCAGGAAGCAGCAGG - Intronic
923714243 1:236411512-236411534 AAGAAGAAGAAGAAAGAAGAAGG - Intronic
923808759 1:237288968-237288990 AGGAAGCAGCAGAAAGGCCCTGG - Intronic
923869304 1:237973692-237973714 AAGAACAAGGAGAAAGGAAGGGG - Intergenic
923990276 1:239428217-239428239 AGGGAGCTGCAGAAAGGAGCAGG - Intronic
924217836 1:241842817-241842839 AAGCGGAAGCAGAGAGAAGCAGG - Intergenic
924253976 1:242163737-242163759 AAGAAAAAGGTGAAAGGAGATGG + Intronic
924371823 1:243359126-243359148 AAGAGGAAGGAGGAAGGTGCTGG - Intronic
924699328 1:246435162-246435184 AAGGAGAAGAGGAAAGGAGGAGG + Intronic
1062878950 10:963074-963096 AAGGAGAAGGAGAAAGGAAATGG - Intergenic
1062970506 10:1644464-1644486 AAGGAGAAGGACAAAGGAGAGGG + Intronic
1063057224 10:2518964-2518986 AAGAAGAAGAAGAAGGGGGGGGG + Intergenic
1063476026 10:6329913-6329935 AAGAAGAAGAAGAAAAGATTAGG - Intergenic
1063590237 10:7388292-7388314 AAAATGAAGCAGAAAAGATCAGG + Intronic
1063850077 10:10177870-10177892 AAGAAGGAGAAGGAAGGAGAAGG - Intergenic
1063998670 10:11644305-11644327 AAGAATAACCAGAAAGAGGCCGG - Intergenic
1064121755 10:12625015-12625037 AAGAAGAAGAAGAAAGGAGGAGG - Intronic
1064201758 10:13290512-13290534 AAGAAAAGGCAGAAAGGATAGGG + Intronic
1064686512 10:17867312-17867334 AAGAAGAAGAAGAAGGAAGGAGG - Intronic
1064850840 10:19707055-19707077 GAGAAGTAGAAGAAAGGAGGAGG - Intronic
1064850852 10:19707116-19707138 AGGAAGAAGAAGAAAGGAGGAGG - Intronic
1064860000 10:19816363-19816385 AAGAGGAAGAAGAAAGGAAAAGG - Exonic
1064906081 10:20347544-20347566 AGGCAGAAGCAGAGAGGAGAGGG - Intergenic
1065021028 10:21501539-21501561 AAGAAGAAGCAGGGAAGAGGAGG + Intergenic
1065066096 10:21966667-21966689 AAGAAGAAGAAGAAAGAGGTGGG - Intronic
1065167089 10:22990989-22991011 CAGAGGAAGCAGAGAGGAGGAGG - Intronic
1065347311 10:24760800-24760822 AAGAATAAGAAGAAAGAATCAGG + Intergenic
1065623821 10:27610641-27610663 AAGAAGGAGAAGAAAGAAGGAGG - Intergenic
1065723197 10:28645510-28645532 GAGCGGAAGGAGAAAGGAGCAGG - Intergenic
1066123763 10:32318691-32318713 AATAAGAAGCAAAAGGGAGCTGG - Intronic
1066145609 10:32554481-32554503 AAGAAGCAGCAGAAAAGCCCTGG - Intronic
1067150656 10:43730045-43730067 AAGAAGAAGAAGACAGGCGAGGG + Intergenic
1067312611 10:45128354-45128376 AGGAAGAGGATGAAAGGAGCAGG - Intergenic
1067723633 10:48749828-48749850 AGGCAGAAGCAAGAAGGAGCAGG - Intronic
1067744324 10:48923998-48924020 ATGAGGAAGCAGCACGGAGCTGG + Intronic
1067768254 10:49105443-49105465 AAGACGAAGAAGAAAAGAGGCGG + Intronic
1067843859 10:49702970-49702992 AAAAAGAAAAAGAAGGGAGCAGG - Intronic
1067902330 10:50255238-50255260 AAGAAGAAGTAGGAAGGGGGAGG + Intergenic
1067989577 10:51196086-51196108 GTCAAGAAGTAGAAAGGAGCAGG + Intronic
1068480683 10:57585250-57585272 AGGAAGCAGCAGAAAGGCCCTGG + Intergenic
1068594080 10:58883608-58883630 AAGAAGAAAGAGAAGGGAGAAGG + Intergenic
1069150610 10:64954389-64954411 AAGAAATAGCAGAAAGGCACTGG - Intergenic
1069200545 10:65609684-65609706 GAAAAGAAGAAGAAAAGAGCAGG + Intergenic
1069219081 10:65860709-65860731 CAGAAGAAGAAGAAAGAAACAGG + Intergenic
1069240406 10:66131081-66131103 AAGAAGAAGAAGAAAAGCCCTGG + Intronic
1069362293 10:67656575-67656597 AAGAAAAAGCAGAATAGAGTAGG + Intronic
1069444291 10:68458550-68458572 AAAAAGAAGAAGAAAGAGGCTGG + Intronic
1069473066 10:68710317-68710339 AAAAAGAAGAAGAAAGAAGAAGG - Intergenic
1069473114 10:68710632-68710654 AAGAAGAAGAAGAAAGGGCCAGG - Intergenic
1069619494 10:69827910-69827932 AAGAAGGACCACAAAGAAGCGGG - Intronic
1069718537 10:70535667-70535689 AAAAAGGAGAAGAAAGGAGAAGG - Intronic
1069987326 10:72293308-72293330 AAGAGGAAGCAGAATGGGGAGGG - Intergenic
1070177406 10:73983697-73983719 AAGAACCATCTGAAAGGAGCAGG - Intergenic
1071025570 10:81108759-81108781 ATGATGCAGCAGAAAGGAGGTGG - Intergenic
1071300227 10:84250932-84250954 AAGAAGAAGAAGAAAAGAAAAGG + Intronic
1071866417 10:89738581-89738603 AAGAAGAAGAAGAAACCAACAGG + Exonic
1072546591 10:96444669-96444691 AAAAAGAACCTGAAAGGAGGTGG + Intronic
1072561522 10:96580242-96580264 AAGATGAAGCAGAAAAGGGGAGG - Intronic
1073073023 10:100806626-100806648 TTGCAGAAGTAGAAAGGAGCCGG + Intronic
1073094953 10:100973630-100973652 AAGAAGGGGAGGAAAGGAGCTGG - Intronic
1073109710 10:101054269-101054291 AAGAAGAAGAAGAAAAAAGTGGG + Intergenic
1073215834 10:101835634-101835656 AAGAAGAAGCAGGGAAGAGGAGG - Intronic
1073258229 10:102169209-102169231 AAGAAGAAGAAGAAAAGACTTGG + Intergenic
1073340775 10:102742906-102742928 CAGAAGAAGCAGCAAGGAGATGG + Exonic
1073598336 10:104822093-104822115 AATAAGAATCACAGAGGAGCTGG - Intronic
1073615556 10:104991401-104991423 ATGAAGATGCAGAGAGAAGCTGG - Intronic
1074033854 10:109717964-109717986 CATAAGCAGCAGGAAGGAGCAGG + Intergenic
1074263074 10:111873398-111873420 AAAAAGAAACAGAAAGCGGCAGG + Intergenic
1074406519 10:113184305-113184327 AAGAAAAAGCAGAGACGAGAAGG + Intergenic
1074491238 10:113941532-113941554 AAGAAGCAGGAGAAATGGGCTGG - Intergenic
1074877019 10:117621633-117621655 ATGAGGAAGCTGTAAGGAGCGGG - Intergenic
1074877149 10:117622339-117622361 ATGAGGAAGCAGTAAGGAGCAGG - Intergenic
1075081443 10:119386631-119386653 ATGAAAACGCAGAAGGGAGCGGG - Intronic
1075291978 10:121238489-121238511 AAGGAGAAGCATAAAGGAGATGG - Intergenic
1075449594 10:122540638-122540660 AAGAATAGGCAGAAAGGAAGCGG - Intergenic
1075660724 10:124193725-124193747 AGGAAGCAGCAGAAAGGCCCTGG - Intergenic
1076205339 10:128594971-128594993 AAAAGAAGGCAGAAAGGAGCAGG - Intergenic
1076211414 10:128648730-128648752 AAGAAGAAGAAGACAAGAGTTGG - Intergenic
1076584942 10:131540341-131540363 AAAAAGAAAAAGAAAGAAGCTGG - Intergenic
1076870883 10:133193575-133193597 AAGAAGAAGGAAAAAGGAGAAGG + Intronic
1077262011 11:1627443-1627465 CAGAAGAAGCAACAAGGAGAAGG - Intergenic
1077519515 11:3023829-3023851 AAGAAGAAGTAGAAAGAAATAGG - Intronic
1077651353 11:3975624-3975646 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1077723803 11:4653179-4653201 AAGAATAAGCAGATATGAGAAGG - Exonic
1077904088 11:6515596-6515618 AAAAAAAAGCAGAAAAGAGAAGG - Intronic
1078203761 11:9209807-9209829 AAGAATAAACAGTAAGGGGCTGG + Intronic
1078308003 11:10210343-10210365 GAGAAGAGGAAGAAAGGAGGAGG + Intronic
1078612937 11:12837701-12837723 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1078837441 11:15044533-15044555 AAGAAGAAGCAGAAATGCCCTGG - Intronic
1079078639 11:17398598-17398620 TTGAATAAGCAGAAAGGAGTGGG - Intronic
1079273771 11:19013874-19013896 AGGAAGCAGCAGAAAGGCCCTGG - Intergenic
1079645156 11:22853703-22853725 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1079795918 11:24802895-24802917 TAGAAGAAGGAGAAAGGATGAGG - Intronic
1079923407 11:26460405-26460427 AAAAAGAAGAAGAAAGGGGGGGG + Intronic
1080237903 11:30092878-30092900 AAGGAGAAGGAGGAAGGAGGAGG - Intergenic
1080273291 11:30473717-30473739 CAGAAGGAGCAGAAAGATGCAGG - Intronic
1080278785 11:30532443-30532465 AAGCAGAAGTTAAAAGGAGCTGG - Intronic
1080324036 11:31049829-31049851 AGGAAGCAGCAGAAAGGCCCTGG + Intronic
1080325019 11:31061565-31061587 AAGAAGAAGAAGAAGGCACCTGG + Intronic
1080451497 11:32382101-32382123 AGGAAGAAGGCGAGAGGAGCTGG - Intergenic
1080672654 11:34395255-34395277 AGGAAGCAGCAGAAAGGCCCTGG - Intergenic
1080913681 11:36631943-36631965 AAAAAGGAGCAGAAAGGTGGGGG - Intronic
1081061580 11:38484967-38484989 AAGAACAAGAAGAAAGCAGCAGG + Intergenic
1081255059 11:40882523-40882545 AGAAAGATGCAGAAATGAGCAGG - Intronic
1081552362 11:44125653-44125675 AAGGAGAAACACAAAGGAGCTGG + Intronic
1081558716 11:44192214-44192236 AAGAAGAAGCAGGAGAGGGCTGG - Intronic
1081837397 11:46167295-46167317 AGGTAAAAGCAGGAAGGAGCAGG + Intergenic
1082004870 11:47413930-47413952 AGGAAGAAGCATCTAGGAGCAGG - Intronic
1082274462 11:50206713-50206735 AAGAAGAAGCAGAGCAGAGCAGG + Intergenic
1082669780 11:56020783-56020805 AAGAAGAAGAAGAAAAGAAGAGG + Intergenic
1083076397 11:60043198-60043220 AAGAAAAAGCATAAATGGGCCGG - Intronic
1083367205 11:62148546-62148568 AAGAAGAAGGTGAGGGGAGCTGG + Exonic
1083516857 11:63267941-63267963 AAGAAGAAGAAAAAAGAAGAAGG - Intronic
1083544325 11:63537768-63537790 AAGAGGGAGGAGAAAGGAGCAGG - Intronic
1083553203 11:63606522-63606544 AACAAAAAGCAGAGCGGAGCAGG + Intronic
1083683328 11:64361282-64361304 AGGAAGAGGCAGGAAGGAGAAGG - Intronic
1083784506 11:64936050-64936072 AGAAAGAAGCAGAAAGCAGCAGG - Intergenic
1084062304 11:66684311-66684333 ATGAAGTATTAGAAAGGAGCGGG - Intergenic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084363088 11:68681785-68681807 AAGGAGAAGAAGAAAAGAGAAGG - Intergenic
1084452653 11:69249244-69249266 AGGAATAAGAAGAAATGAGCCGG - Intergenic
1084507276 11:69576113-69576135 GATAAGAAGCACAGAGGAGCTGG - Intergenic
1084840469 11:71842516-71842538 AGGAAGTAGCAGAAAGGCACTGG + Intergenic
1085071146 11:73547121-73547143 AAGAAGAAAGAAAAAGGAGGAGG + Intronic
1085335416 11:75690053-75690075 AAGAAGAAGTAGAAGGAAGAAGG - Intergenic
1085592241 11:77774753-77774775 AAGAAAAAAAAGAAAGAAGCAGG - Intronic
1085747701 11:79129192-79129214 AGGAAGCAGCAGAAAGGCCCTGG + Intronic
1085789847 11:79487598-79487620 AAGAAGAAGAAGAAAGAAAGAGG + Intergenic
1085807654 11:79651029-79651051 AAGAAGAAGAAGGAAGGAGGAGG - Intergenic
1085807667 11:79651106-79651128 AAGAAGAAGAAAGAAGGAGGAGG - Intergenic
1085807668 11:79651109-79651131 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
1086056115 11:82649062-82649084 AAGGAGCAGAAGAAAGGAGGAGG - Intergenic
1086283157 11:85214190-85214212 AAGTAGCAGCTGAAAGGAGAGGG - Intronic
1086302510 11:85442922-85442944 AAGAAGAAGGAGGAAGAAGGAGG + Intronic
1086457073 11:86969531-86969553 AGGAAGAAGGAGAAAGGGGATGG - Intergenic
1086473453 11:87142827-87142849 GAAAAGAAGAAGAAAGGAGAAGG - Intronic
1086614065 11:88793755-88793777 AAGAAGGATCTGAAAGAAGCAGG + Intronic
1087204244 11:95377399-95377421 GAGAAGGAGTAGAAAGGGGCAGG - Intergenic
1087358728 11:97129859-97129881 AAGAAGACGTATAAATGAGCTGG - Intergenic
1087625594 11:100592518-100592540 AAGAACATGCAGAAGGCAGCCGG + Intergenic
1087781416 11:102304726-102304748 AAGAGGAAGAAGAAAGAAGTTGG + Intergenic
1087932258 11:103991327-103991349 AAGAAGATGGAGAAGGGAGGAGG - Intronic
1088206319 11:107396990-107397012 AGGAAGGAGCAGAAAGGCCCTGG + Intronic
1088319247 11:108538151-108538173 AACAAGAGGCAGCAAGCAGCTGG - Intronic
1088548392 11:110985196-110985218 AAGGAGAAGAATAAAGGAGCAGG + Intergenic
1088558715 11:111090385-111090407 CAGAAGAAGAAGGCAGGAGCAGG - Intergenic
1088591957 11:111411226-111411248 GAGTAGAAGGAGAAAGGAGCAGG - Intronic
1088591962 11:111411262-111411284 GAGTAGAAGGAGACAGGAGCAGG - Intronic
1088992834 11:114969626-114969648 AGAAACAAGCAGAAAGAAGCTGG + Intergenic
1089034583 11:115373613-115373635 AAGAAGAAGAAGAAAGAATGTGG + Intronic
1089276153 11:117337298-117337320 AAGGAGAGGAAGAAAGGACCAGG - Intronic
1089798376 11:121002379-121002401 GAGAAGAAGAAGAAGGGAGGGGG + Intergenic
1090017803 11:123101516-123101538 GAGATGAAGAAGAATGGAGCAGG + Intronic
1090378702 11:126309909-126309931 AAAAAGAAGAAGGAAGGAGAAGG - Intronic
1090439803 11:126716081-126716103 AGGAAAAAGAAGAAAGGAGATGG + Intronic
1090464630 11:126923306-126923328 AAGAAGAAGGAAGAAGGAGAAGG - Intronic
1090464638 11:126923363-126923385 AAGAAGAAGGAAGAAGGAGAAGG - Intronic
1090636271 11:128692383-128692405 ATTGAGAAGCAGACAGGAGCGGG + Intronic
1090651232 11:128807931-128807953 AAGAAGATAGAGAGAGGAGCTGG - Intronic
1090757225 11:129803322-129803344 AGGAAGCACCAGAAAGGCGCTGG + Intergenic
1090807011 11:130209172-130209194 AACAAGAAGCAGAGAGGCGGAGG - Intronic
1090876597 11:130794456-130794478 AAGAACTACCTGAAAGGAGCAGG + Intergenic
1090940627 11:131385024-131385046 AAGAAGAAGCAGGAGGTACCCGG + Intronic
1090981966 11:131730736-131730758 AAGAAGACGAAGAAAAGAGCAGG + Intronic
1091282809 11:134391558-134391580 AAGAATCAGCACAAAGGTGCAGG + Exonic
1091363974 11:135001661-135001683 ACGGAGAAGCAGGAAGGAGAGGG + Intergenic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1091440702 12:510234-510256 AAGATGTAGCAGCAAGGGGCGGG + Intronic
1091520587 12:1236915-1236937 AAGGAGAATCTGAAAGGATCGGG + Intronic
1091642466 12:2247807-2247829 GAGAATAAAGAGAAAGGAGCAGG - Intronic
1091720647 12:2810870-2810892 AAGAAAAAGAAAAAAGGGGCCGG + Intergenic
1091724314 12:2834881-2834903 AGGAAGAAGCAGAGAGGACTCGG - Exonic
1092708726 12:11311484-11311506 AAGAAGAACCAGAAAGAAGGTGG - Intergenic
1092758625 12:11788943-11788965 AAGAAGAACCATAAAAGAGTAGG - Intronic
1092838383 12:12514443-12514465 AAAAAGGATCAGAAAAGAGCAGG - Intronic
1093016145 12:14156528-14156550 GAGAAGGAGCACCAAGGAGCAGG + Intergenic
1093096086 12:14973737-14973759 AGAAAGAGGCAGGAAGGAGCTGG - Intronic
1093202400 12:16204622-16204644 AAGAGGCAGCTGAAAGGAACAGG + Intronic
1093269138 12:17037167-17037189 AAGAGGAAGGGGAAAGAAGCAGG - Intergenic
1093482802 12:19622681-19622703 AAGAAGAAAAAGAAAGAAGTGGG - Intronic
1093508403 12:19896782-19896804 AAGAAGGAGAAGGAAGGAGGAGG - Intergenic
1093508406 12:19896792-19896814 AAGAAGAAGGAAGAAGGAGAAGG - Intergenic
1093508408 12:19896805-19896827 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1093521650 12:20057976-20057998 AGGATAAAGCAGAAAGGAGTAGG + Intergenic
1094070294 12:26405149-26405171 AAGAAGAAGAAGAAAGAAGGAGG + Intronic
1094070295 12:26405152-26405174 AAGAAGAAGAAAGAAGGAGGAGG + Intronic
1094244977 12:28279534-28279556 ATTCAGAACCAGAAAGGAGCTGG - Intronic
1094337139 12:29372382-29372404 AAGAAGAAGAAGAAAGAAGGTGG + Intronic
1094362013 12:29640605-29640627 AGGAAGCAGCAGAAAGGCCCTGG + Intronic
1094371584 12:29744245-29744267 AAGATGAAGCAGAATGAACCAGG + Intronic
1094460156 12:30687874-30687896 AAAAAGAAACAACAAGGAGCAGG + Intronic
1094474959 12:30833723-30833745 AAGAAGATGAACAAAAGAGCAGG + Intergenic
1094501259 12:31023093-31023115 AGGAAGCAGCAGAAAGGCGCTGG + Intergenic
1095248276 12:39947021-39947043 AGGAAGCAGCAGAAAGGCCCTGG - Intronic
1095347694 12:41170926-41170948 AAGAAGAGTCAGAGAGGAGGAGG + Intergenic
1095732550 12:45521604-45521626 AGGAAGTAGCAGAAAGGCACTGG + Intergenic
1095818856 12:46454973-46454995 AAGAAGAAGCTCAAAGGACCTGG - Intergenic
1096181126 12:49550982-49551004 GAGACAAAGCAGTAAGGAGCTGG - Intronic
1096628569 12:52910711-52910733 AAGAACAAACAGGAAGGACCTGG + Intronic
1096674078 12:53217200-53217222 AAGAAAAAGGAGAGAGGAGAGGG + Intronic
1096692977 12:53332597-53332619 AAAAAGAAGCAGAAATAGGCAGG + Intronic
1096747713 12:53739244-53739266 ATGAAGACTCAGAAACGAGCAGG + Intergenic
1096809427 12:54160174-54160196 AAGAAGAAAGAGAAAAGAGGAGG + Intergenic
1096831522 12:54318167-54318189 AAGAAGTAACAGAAAGAGGCTGG - Intronic
1096837803 12:54362222-54362244 AAGCAGGAGCAGGAAGCAGCTGG - Intergenic
1096886140 12:54721267-54721289 AAGAAAAAGAAGAGAGGAGAAGG - Intergenic
1097623480 12:61971050-61971072 AAGAAGAAGTGGAAAGAAGCTGG + Intronic
1097860499 12:64514039-64514061 AAAAAAAAGCAAAAAGTAGCTGG - Intergenic
1097892241 12:64789161-64789183 AAGAAGAAGAAGGAAGAAGAAGG - Intronic
1098031005 12:66253827-66253849 AAAATGAAGCATAAAGGAGTTGG + Exonic
1098221761 12:68277406-68277428 AAGAAGAAGAAGAATCTAGCTGG + Intronic
1098307349 12:69115360-69115382 AGGAGGAAGAAGAAAGGAGAAGG + Intergenic
1098772971 12:74577985-74578007 AAGAAAAAGAACAAAGAAGCAGG + Intergenic
1098860050 12:75698786-75698808 AGGAATAAGCAGACAGAAGCTGG + Intergenic
1098961024 12:76739654-76739676 AGGAAGCAGCAGAAAGGCCCTGG - Intergenic
1099158333 12:79208104-79208126 AAGAAGTAGCAAATAGGACCAGG - Intronic
1099163839 12:79276937-79276959 AAGAAGAAGAAGGAAGAAGGAGG + Intronic
1099163840 12:79276940-79276962 AAGAAGAAGGAAGAAGGAGGAGG + Intronic
1099473132 12:83075040-83075062 AGGAAGCAGCAGAAAGGCCCTGG - Intronic
1099491366 12:83292516-83292538 AATAATCAGCAGCAAGGAGCAGG + Intergenic
1099777514 12:87151835-87151857 AAGAAGCAGCAGAAAGGCCCTGG - Intergenic
1100088228 12:90937105-90937127 AAGAAGCAGCAGAAAGGCCCTGG - Intronic
1100297402 12:93275604-93275626 AGGAAGAAAGAGAAGGGAGCTGG + Intergenic
1100438462 12:94593412-94593434 AAGAAGAAGAAGGAAGAAGAAGG + Intronic
1101046323 12:100810103-100810125 ATGATGAAGCAGAATGCAGCAGG + Intronic
1101324845 12:103706510-103706532 AAGAAAAATGAGAAAGGAGGAGG - Intronic
1101472861 12:105015077-105015099 AAGAAAGATCAGAAAGGACCTGG - Intronic
1101635377 12:106535940-106535962 AGGAAGCAGCAGAAAGGCCCTGG - Intronic
1101917753 12:108909128-108909150 AAGAAAAGGCAAAAAGAAGCTGG + Intergenic
1101994457 12:109514898-109514920 AAAAAGAAGAAGAAAGGGGATGG - Intronic
1102031558 12:109742988-109743010 AAAAAGAAGAAGAAAGCAGAGGG - Intronic
1102167964 12:110821038-110821060 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1102859088 12:116319954-116319976 AACAGGGAGGAGAAAGGAGCAGG + Intergenic
1102897040 12:116606684-116606706 AAGAAGAAGAAGAAAAGAAAAGG + Intergenic
1102974978 12:117200190-117200212 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
1103200131 12:119081492-119081514 GAGAACAAGGGGAAAGGAGCAGG + Intronic
1103219488 12:119231946-119231968 AGGAAGAAGAAGAAAGAAGGAGG - Intergenic
1103286168 12:119803397-119803419 AAGAAAAACAAGAAAGGAGGCGG + Intronic
1103404561 12:120666221-120666243 AGGAAGAAGAAGAAGGGAGGGGG + Intronic
1103610703 12:122122523-122122545 AAGAAAAAGAAAAAAGTAGCAGG - Intronic
1103741872 12:123096593-123096615 AGGAAGGAGCAGAGAGGAACAGG + Intronic
1103951182 12:124552021-124552043 AAGAAAAAGTAAAAAGGGGCTGG + Intronic
1104181297 12:126384157-126384179 ATTAAGAAGCACAAAGGAACTGG - Intergenic
1104349080 12:128029284-128029306 GAGGAGCAGCAGAATGGAGCAGG - Intergenic
1104349845 12:128035697-128035719 AAGAAAATGCAGAAAGGAGATGG + Intergenic
1104366700 12:128184531-128184553 AAGAAGACGCCTAAAGGAGCCGG + Intergenic
1104455906 12:128911962-128911984 GAAAAAAAGAAGAAAGGAGCAGG - Intronic
1104504601 12:129319268-129319290 AGGAAGCAGCAGAAAGGCCCTGG - Intronic
1104509605 12:129365568-129365590 AAGAGGAACCAGGATGGAGCAGG + Intronic
1104979264 12:132566421-132566443 AAGAAGAAGAAGAAACTAGGAGG + Intronic
1105347841 13:19590177-19590199 GAGAAGCAGCAGCATGGAGCAGG + Intergenic
1105450343 13:20493666-20493688 AAGAAGAAGAAAGAAGGAGAAGG + Intronic
1105585216 13:21737294-21737316 AAGAAGCAGGAGAAAGGAGCAGG - Intergenic
1105738330 13:23295702-23295724 AAGAAGGAGGAGGAAGGAGGAGG - Intronic
1105908151 13:24834659-24834681 AAGAAGCAGCAGAAAGGCCCTGG + Intronic
1105930664 13:25048976-25048998 AGGAAGCAGCAGAAAGGCCCTGG + Intergenic
1105945747 13:25187985-25188007 GGGAAGAATCAGAAAGGAGATGG - Intergenic
1106085929 13:26541603-26541625 AAGGAGAAACCCAAAGGAGCTGG - Intergenic
1106114331 13:26803938-26803960 AAGAGCAACCAGAAAGGAGCAGG + Intergenic
1106456850 13:29935341-29935363 AGGATGCAGCAGAAAAGAGCTGG + Intergenic
1106626450 13:31425486-31425508 AAGATGAGGCTGTAAGGAGCAGG + Intergenic
1106777983 13:33026892-33026914 ATCAAGAAGCAGAGAGAAGCTGG - Intronic
1106938246 13:34747733-34747755 AGGAAGCAGCAGAAAGGCCCTGG - Intergenic
1107003051 13:35573722-35573744 AAGAAGAAACTGAAAACAGCAGG + Intronic
1107112489 13:36712860-36712882 CACAAGAAGCTGAAAGGAACGGG - Intergenic
1107264290 13:38533872-38533894 CAGAAGAAGAAGAAAGGGGGAGG + Intergenic
1107356182 13:39569809-39569831 TAGAACTAGCAGAAATGAGCAGG + Intronic
1107405586 13:40109576-40109598 ACGAAGAAGGAGAAGGGAGAGGG + Intergenic
1107668587 13:42718680-42718702 AAGAAGGAGGAGAAAGAAGAGGG + Intergenic
1107897120 13:44976299-44976321 GAGAAGGAGAAGAAAGGAGGAGG + Intronic
1108070888 13:46627574-46627596 AAGAAGAAGAGGGAAAGAGCAGG - Intronic
1108623162 13:52203552-52203574 GAGAAGCAGCAGCATGGAGCAGG + Intergenic
1108663561 13:52607488-52607510 GAGAAGCAGCAGCATGGAGCAGG - Intergenic
1109039132 13:57309079-57309101 AAGAAAAAGGAGAAAGAAGTGGG - Intergenic
1109344245 13:61095766-61095788 CAGAAGAAGCTGAAAGAGGCTGG - Intergenic
1110217548 13:73039727-73039749 AAGAAGAAGAAGAAATGACTTGG - Intergenic
1110418179 13:75275074-75275096 ATGAAAAAGCAAAAAGGAGCAGG - Intergenic
1110545532 13:76751141-76751163 AAGAGGAACCAGAAAAGACCAGG - Intergenic
1110561772 13:76917590-76917612 AGGAAGCAGCAGAAAGGCCCTGG + Intergenic
1110661295 13:78061460-78061482 AAGAAGCAGCAGAAAGGCTCTGG - Intergenic
1110684180 13:78352221-78352243 AAATAGAAGAAGAAAAGAGCTGG - Intergenic
1110799296 13:79676255-79676277 AAGAAATACCTGAAAGGAGCAGG - Intergenic
1110852729 13:80263153-80263175 AAGAAGCAGCAGAAAGGCCCTGG - Intergenic
1110870217 13:80443533-80443555 GAGAAAAAGAAGAAAGGAGGAGG - Intergenic
1110950461 13:81482759-81482781 ATGAGGATGCAGAAAGGAGAAGG - Intergenic
1111069144 13:83140767-83140789 AAGAACTAGAAGAAAGGAACTGG - Intergenic
1112015706 13:95329904-95329926 GAGGAAAAGCAGAAAGGACCTGG - Intergenic
1112035473 13:95492832-95492854 AGGAAGCAGCAGAAAGGTCCTGG - Intronic
1112408946 13:99145752-99145774 AAGAAGAAGAAGAAAAATGCAGG + Intergenic
1112437212 13:99399155-99399177 AAGAAGTTGCAGAGAGGAGGCGG - Intergenic
1112620565 13:101050181-101050203 AAGAAGAAGAATAGAGGTGCTGG - Intergenic
1112737986 13:102442971-102442993 AGGAAGCAGCAGAAAGGCCCTGG + Intergenic
1112762120 13:102703239-102703261 AGGAAGGAGCAGAAGAGAGCAGG - Intergenic
1112945215 13:104919821-104919843 AGGAAGCAGCAGAAAGGCCCTGG + Intergenic
1113198352 13:107835947-107835969 AAGCAGAAGCAGCACAGAGCCGG + Intronic
1113258606 13:108534779-108534801 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
1113265916 13:108617889-108617911 AAGAAGAAGCAGAGTGGAAAAGG - Intronic
1113270024 13:108662917-108662939 AGGAAGCAGCAGAAAGGTCCTGG - Intronic
1113282122 13:108799863-108799885 AAGAGGAAGAAGAAGGGAGGAGG + Intronic
1113285646 13:108845497-108845519 AGGAAGAGGCAGGGAGGAGCAGG + Intronic
1113898839 13:113784551-113784573 AAGAAGGAGGAGAAGGGAGGAGG + Intronic
1114038133 14:18648848-18648870 AAGAAGATGAAGAAAGAAGAAGG - Intergenic
1114803414 14:25805523-25805545 ATGAAGTAGCAGTAGGGAGCAGG - Intergenic
1114881905 14:26796717-26796739 AAGAAGAAAGAGAAAGAAGGAGG + Intergenic
1115018529 14:28646379-28646401 AAGAAGAAGAAGAAAGGAGAAGG + Intergenic
1115095398 14:29630085-29630107 GAGAAGAAGAAGAAAGGAGAAGG - Intronic
1115263424 14:31476214-31476236 AAAAAGAGGAAGGAAGGAGCAGG - Intergenic
1115275658 14:31606046-31606068 AAGAAGAAGAAGAATGGAGGAGG - Intronic
1115864274 14:37726069-37726091 AGGAAAAAGCAGAAAAGAGGAGG - Intronic
1115917210 14:38329312-38329334 AAGAAGAAGGAGAAAGGATTTGG + Intergenic
1115989468 14:39137497-39137519 AACAAGAAGTCTAAAGGAGCTGG + Intergenic
1116125177 14:40774900-40774922 AAGAAGAGGCACCAATGAGCTGG - Intergenic
1116282414 14:42926394-42926416 AACAGGAAGCAGAAAAAAGCAGG - Intergenic
1116306942 14:43268109-43268131 AAGAAGAAGAAGAAAGGAACTGG + Intergenic
1116418087 14:44702247-44702269 AAAAAGATGGAGAAAGAAGCTGG + Intergenic
1116423581 14:44762560-44762582 AAGAAGAAGTAGAAGGCAACTGG - Intergenic
1116900519 14:50358061-50358083 AAGAAAAAGAAAAAAGGAGGAGG - Intronic
1117510883 14:56449298-56449320 AGGAAGCAGCAGAAAGGCCCTGG - Intergenic
1117833845 14:59781215-59781237 GTGAACAAGCAGAAGGGAGCTGG - Intronic
1118036358 14:61872587-61872609 GAGAAGAAACAGGAAGGGGCAGG - Intergenic
1118162214 14:63301898-63301920 AGGAAGAAGCAGAAAGGCCCTGG + Intergenic
1118260645 14:64243784-64243806 AAGAACCATCAGAAAGGAGCGGG - Intronic
1118677215 14:68200015-68200037 AAGAAAAAGCAAAAAGGAAAAGG - Intronic
1119118176 14:72046583-72046605 AGGAAGAAGAGGAGAGGAGCAGG - Intronic
1119171076 14:72536869-72536891 AAGGAGGAGGAGGAAGGAGCTGG - Intronic
1119543753 14:75457282-75457304 AAGAAGCACCAGGAAGGAGGAGG + Intronic
1119800544 14:77441096-77441118 GGGAAGAAGCAGAAGGGAGCAGG + Intronic
1119878738 14:78082638-78082660 AAGAGGGAGAAGGAAGGAGCTGG - Intergenic
1119925383 14:78488764-78488786 ATGAAGAAGAAGAAAGGGGAGGG + Intronic
1119996836 14:79262458-79262480 AGGAGGAAGGAGAAAGGAGGAGG + Intronic
1119996843 14:79262493-79262515 ATGAGGAAGGAGAAAGGAGGAGG + Intronic
1120222139 14:81746724-81746746 AAGGAAAAGCAGAAAGGGGGTGG - Intergenic
1120610370 14:86634335-86634357 AAGAAGAAGAAAAATGGAGAAGG + Intergenic
1120719076 14:87870902-87870924 AAGAAGAAGAAGGAAGAAGAAGG - Intronic
1121119700 14:91368954-91368976 AGGAAGGAGGAGAAAGGAGATGG - Intronic
1121459754 14:94065824-94065846 AAGAAGCAGCAGAAAGGCCCTGG + Intronic
1121600143 14:95197254-95197276 AGGAAGAAGAAGAAAAGAGGAGG + Intronic
1121600144 14:95197257-95197279 AAGAAGAAGAAAAGAGGAGGAGG + Intronic
1122038154 14:98963172-98963194 AAGAAGAAGAAGAGAGGAAGAGG + Intergenic
1122038161 14:98963298-98963320 AAGGAGAAGGAGAAAGAAGAAGG + Intergenic
1122350820 14:101088998-101089020 AAGAAGAAGCAGACAGGGAGGGG - Intergenic
1122643655 14:103177346-103177368 AATCTGAAGCAGAAAGGAGCTGG + Intergenic
1122662164 14:103303720-103303742 AAGAAGAAGCAGCTAGGGGAAGG + Intergenic
1202844535 14_GL000009v2_random:156042-156064 AAGAAGAAGCAGGAAGCTGGGGG - Intergenic
1202913926 14_GL000194v1_random:146283-146305 AAGAAGAAGCAGGAAGCTGGGGG - Intergenic
1202878728 14_KI270722v1_random:36419-36441 AAGAAGAAGCAGGAAGCTGGGGG + Intergenic
1123792327 15:23734258-23734280 AAGAAAAAGAAGAAAGAAGAGGG + Intergenic
1123792337 15:23734330-23734352 AAGAAGGAGAAGAAAGAAGAAGG + Intergenic
1124037233 15:26065833-26065855 AAAGAGAAGCAGAGAGGAACTGG - Intergenic
1124216678 15:27813110-27813132 AGGAACAAGGAGAAAGGGGCAGG + Intronic
1124555507 15:30721430-30721452 GAGAAGCAGGAGAAAGGAGATGG - Intronic
1124675754 15:31684265-31684287 GAGAAGCAGGAGAAAGGAGATGG + Intronic
1124716160 15:32064307-32064329 AAGTAGAAGGATCAAGGAGCAGG - Intronic
1124872126 15:33553589-33553611 TAGAATAAGGAGCAAGGAGCAGG + Intronic
1125049735 15:35283047-35283069 AAGAAGAAGAAGGAAGAAGAAGG - Intronic
1125056019 15:35359537-35359559 AGGAAGCAGCAGAAAGGCCCTGG - Intronic
1125187104 15:36943771-36943793 GGGAAAAAGCACAAAGGAGCTGG + Intronic
1125385311 15:39130676-39130698 ATGAAGAAACAGGAAGCAGCTGG + Intergenic
1125508389 15:40280403-40280425 TATATGAAGCAGAAAGCAGCGGG - Intronic
1125713238 15:41804134-41804156 AAAAATAAGCAGAAAGTGGCCGG - Intronic
1125762915 15:42109953-42109975 AAGAAGAAGAAAAAAGGAGGAGG - Intergenic
1126052313 15:44697177-44697199 GAGAAGAAAAAGAAAGGAGGAGG - Intronic
1126179684 15:45773055-45773077 AAGATGAAGCTGAAAGGCACAGG - Intergenic
1126539049 15:49802280-49802302 AAAAAAAAGAAGAAAGGAGGTGG + Intergenic
1127122102 15:55780576-55780598 AAGAAGAAGAAGAAAGGAGGAGG + Intergenic
1127525334 15:59786963-59786985 AGGAAGCAGCAGAAAGGCCCTGG - Intergenic
1127797708 15:62452792-62452814 AAGGACAGGCAGAAGGGAGCAGG - Intronic
1127950429 15:63800140-63800162 AAAAAGAAGAAGAAAGAAACTGG + Intronic
1128095618 15:64952324-64952346 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095622 15:64952357-64952379 AAGAGGAAGAAGAAAGAAGAAGG - Intronic
1128095628 15:64952432-64952454 ACTAAGAAGAAGAAAGGAGGAGG - Intronic
1128095631 15:64952461-64952483 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095748 15:64953691-64953713 AAGGAGAAGAAGAAAGAAGAAGG - Intronic
1128095772 15:64954055-64954077 AAGAGGAAGAAGAAAGAAGAAGG - Intronic
1128259300 15:66221341-66221363 GAGAAGAAGCAGGACTGAGCTGG - Intronic
1128569924 15:68726516-68726538 GGGAAGAGACAGAAAGGAGCCGG - Exonic
1128827118 15:70729550-70729572 AGGAAGCAGCAGAAAGGCCCTGG - Intronic
1128867847 15:71128755-71128777 AAAAAGAAGAATAAAGGAGGGGG + Intronic
1129601845 15:77003664-77003686 AAAAAGAAGAAGAAGGAAGCGGG + Intronic
1130096305 15:80858762-80858784 AATAAGAAGCCAAAAGGAGAAGG - Intronic
1130171781 15:81522702-81522724 AGGAAGAAGGGGAAAGGAGAAGG + Intergenic
1130522738 15:84675706-84675728 AAGAAGGAATAGAAAGCAGCAGG - Intronic
1130662272 15:85840167-85840189 ACGAAGAAGCTGGAAGGAGCAGG + Intergenic
1131131368 15:89902783-89902805 AAGAAAAACCAGTAAGGACCAGG + Intronic
1131139772 15:89967750-89967772 AAGAAGAAGAAGAAAGCAGCCGG + Intergenic
1131591846 15:93758342-93758364 AAGAAGGAGGAGGAAGGAGAAGG + Intergenic
1131641898 15:94301988-94302010 ATGAAGAAGAAGGAAGGAGTTGG + Intronic
1132025255 15:98399617-98399639 AAGAAGAAACCGCAGGGAGCTGG + Intergenic
1132085255 15:98903310-98903332 AAGAAGAAGGAAAAAGTAGATGG + Intronic
1132831886 16:1932468-1932490 AGGGAGAAGCAGAAAGGGACAGG + Intergenic
1133392422 16:5421001-5421023 AAAAAGAAGAAGGAAGGAGGAGG - Intergenic
1133392823 16:5423000-5423022 AGGAAGGAGGAGAAAGGAGAGGG + Intergenic
1133580716 16:7141991-7142013 AAGAAGAAGGAGGAAGAAGAAGG - Intronic
1133616402 16:7480810-7480832 TGGAGGAAGCAGAAAGCAGCTGG + Intronic
1133720167 16:8487443-8487465 AGGAAGAGCCAGAAAGGAACTGG + Intergenic
1133750249 16:8719738-8719760 AAAAAGAAGAAGAAAGAAGGAGG + Intronic
1133750250 16:8719741-8719763 AAGAAGAAGAAAGAAGGAGGAGG + Intronic
1134127995 16:11629608-11629630 AAGAAGAGGAAGGAAGGAGCCGG - Intronic
1134206497 16:12242560-12242582 GAAAAGAAGAAGAAAAGAGCCGG - Intronic
1134227747 16:12404494-12404516 CAGGAGAAGCAGGAAGCAGCTGG - Intronic
1134324287 16:13192883-13192905 GAGAAGAAGAAGAAAGAAGGAGG + Intronic
1134324288 16:13192886-13192908 AAGAAGAAGAAAGAAGGAGGAGG + Intronic
1134328149 16:13225899-13225921 AAGAAGAAGAAGAAAGGAAAAGG - Intronic
1134610260 16:15602597-15602619 ACAAAGAAGAAGAAAGGAGGAGG + Intronic
1134904850 16:17971580-17971602 AAGAAGAGGAAGAAAGAGGCAGG + Intergenic
1135232085 16:20718111-20718133 AAGAAGAAGAAGAAAAGAAAAGG + Intronic
1135524903 16:23206676-23206698 AGAAAGAAGCAGAAAGAATCTGG + Intronic
1135604002 16:23807546-23807568 AAGAAGAAGAAGAAAATAGAAGG - Intergenic
1135650253 16:24200223-24200245 AAGAACAACCAGAAATGAGCAGG - Intronic
1135731740 16:24900378-24900400 AAGAAGCAGGAGAAAAGAGATGG + Intronic
1136047051 16:27623198-27623220 AAGAAACAGCAGGAAGGAGCAGG + Intronic
1136539105 16:30918737-30918759 AAGGAGAAGAAGGAAGGAGGAGG - Intergenic
1136539119 16:30918826-30918848 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1136611766 16:31370931-31370953 AAGAAGAACCTGAAAAGAGGAGG - Intronic
1137354145 16:47743121-47743143 AAGAAGGAGAAGAATGGGGCTGG - Intergenic
1137379488 16:47984084-47984106 AAGGATAAGCAGACATGAGCTGG + Intergenic
1137418721 16:48311923-48311945 AAGAAGAAGCTGTCAGGGGCAGG - Intronic
1137436772 16:48461160-48461182 AGGAAGAAAAAGAAAGGAGGAGG - Intergenic
1137530599 16:49276562-49276584 AAGAAGAGGGAGAAAGAAGAGGG + Intergenic
1137623549 16:49892986-49893008 AAAAAGAAGAAGAGATGAGCTGG + Intergenic
1137679215 16:50324520-50324542 AGGAAGAAGCAGAAGAGTGCAGG - Intronic
1137706943 16:50542132-50542154 AAAAATAAGCAGGAAGAAGCAGG - Intergenic
1137775670 16:51052481-51052503 AGGAAGAAACAGAATGGGGCAGG - Intergenic
1137930123 16:52579010-52579032 AGGAAGGAGCAGAAAGGAGAGGG + Intergenic
1137968378 16:52959217-52959239 AAGAAGAAATAGAAAGAAGGAGG - Intergenic
1138059233 16:53872227-53872249 AAGAAGCACCAGAATGCAGCAGG - Intronic
1138798077 16:59993691-59993713 AGGAAGCAGCAGAAAGGCCCTGG - Intergenic
1138918628 16:61499546-61499568 AAGAAGTAGAACAAAGGAGAAGG - Intergenic
1139138603 16:64234097-64234119 AACAAGAAGTAGAGAAGAGCTGG + Intergenic
1139165570 16:64561397-64561419 AAGGAGAAGAAGAAAGAAGGAGG + Intergenic
1139165780 16:64563531-64563553 AAGAAGAAGAAGAAAAGAGGAGG + Intergenic
1139165781 16:64563534-64563556 AAGAAGAAGAAAAGAGGAGGAGG + Intergenic
1139196297 16:64922018-64922040 AAGGAGAAAGAGAAAGGAGGAGG - Intergenic
1139968278 16:70757661-70757683 AAGCAGAAGCAGGGAGGACCCGG + Intronic
1140111686 16:72010164-72010186 ACGAGGCAGGAGAAAGGAGCAGG - Intronic
1140357595 16:74319534-74319556 AAGAAGAAGAAAGAAGGAGAAGG - Intergenic
1140357601 16:74319578-74319600 AAGAAGGAGAAGAAAGGAGGAGG - Intergenic
1140409256 16:74731868-74731890 AAAAAGAAAAAGAAAGGACCAGG - Intronic
1140534923 16:75700960-75700982 AAGAGGAAGCAGTAGGGAGGAGG + Intronic
1141278932 16:82613266-82613288 GAGAAGCAGCAGAAATGAGGAGG - Intergenic
1141371727 16:83493231-83493253 CTGAAGAAGCAGAAAGAAGTTGG + Intronic
1141372406 16:83500367-83500389 AAGAAGAAGAAGAAAGAAGAAGG - Intronic
1142181404 16:88672638-88672660 CAGGGGAAGCAAAAAGGAGCTGG + Intergenic
1142251412 16:88993671-88993693 GAGAAGAAGGGGAAAGGAGGAGG - Intergenic
1142502327 17:340004-340026 GAGCAGAGGCACAAAGGAGCTGG + Intronic
1142788283 17:2242713-2242735 AAAAAGAATAAGAAAGAAGCAGG + Intronic
1142892042 17:2950032-2950054 AAGAAGAAGAAGAAAAGAAATGG - Intronic
1143114381 17:4574054-4574076 AAGAGAAAGGAGACAGGAGCAGG - Intergenic
1143192166 17:5047997-5048019 AAGAAGAAGAAGAAAAGAAATGG - Intronic
1143254015 17:5542584-5542606 AAAGTAAAGCAGAAAGGAGCAGG - Intronic
1143361129 17:6372192-6372214 AAGAAGCAGCAGGAGGGAGGCGG + Intergenic
1143391549 17:6561714-6561736 AGGAAGAGGCAGAAGGGAGGAGG - Intergenic
1143395407 17:6590978-6591000 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1143564098 17:7711213-7711235 TAGAAAAATCAGGAAGGAGCTGG - Exonic
1143567433 17:7732714-7732736 TGGAAAAAGCAGAAAGGAGAAGG - Intronic
1143629573 17:8130347-8130369 AAGAAGAAGAAGAAAAGAAAAGG + Intergenic
1143656944 17:8300443-8300465 AGGAAGAAGAAGAAAGAAGAAGG - Intergenic
1143794681 17:9327172-9327194 AAGAAGAAGAAGGAAGAAGAAGG + Intronic
1144051137 17:11498026-11498048 AAGAAAGAGAAGAAAGGAGTGGG + Intronic
1144401676 17:14909193-14909215 AAGAAGCAGCAGAAAGTCTCTGG + Intergenic
1144746787 17:17621370-17621392 AAGAAGAAGGAGGAAGAAGAAGG + Intergenic
1145213026 17:21029129-21029151 CAGAAGAAAGAAAAAGGAGCAGG + Intronic
1146208739 17:30925541-30925563 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1146610512 17:34300870-34300892 AATGAGAAACAGAAAGAAGCTGG + Intergenic
1146655813 17:34634564-34634586 AAGAAGAGGCAGAGAGGGACAGG + Intronic
1147238315 17:39073974-39073996 AGGCAGAAGTAGAAAGCAGCAGG - Intronic
1147337417 17:39735951-39735973 AAGTAGAAGCACAGAGGAGAGGG - Intergenic
1147580185 17:41623629-41623651 AGGAGGAGGCAGAAAGGAGGGGG - Intronic
1147775511 17:42898097-42898119 TGGAGGAAGCAGAAAGGGGCTGG + Intergenic
1147776490 17:42905529-42905551 AAGAAGAAAAGGAAAGGAGAAGG + Intronic
1148171833 17:45527378-45527400 CAGAGGGAGCAGAATGGAGCTGG + Intergenic
1148277541 17:46319011-46319033 CAGAGGGAGCAGAATGGAGCTGG - Intronic
1148299748 17:46536876-46536898 CAGAGGGAGCAGAATGGAGCTGG - Intronic
1148335837 17:46840946-46840968 AAGTGGAGGCAGAAAGCAGCCGG + Intronic
1148364188 17:47041186-47041208 CAGAGGGAGCAGAATGGAGCTGG - Intronic
1148841052 17:50497491-50497513 AAAAAGAAGCAGAAGGGGCCAGG + Intergenic
1148975972 17:51528465-51528487 ACAAAGAAGAACAAAGGAGCAGG - Intergenic
1149103389 17:52933050-52933072 AAGAAGAAGCAGAAAGTCAAGGG + Intergenic
1149333106 17:55606802-55606824 AAGAAGCAGGAGGAAGGAGGAGG - Intergenic
1149797906 17:59538419-59538441 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1149797932 17:59538565-59538587 AAGAATAAGGAGAAAGAAGAAGG - Intergenic
1150000701 17:61437160-61437182 AAGAAGAAGAAGAAGAGAGAAGG - Intergenic
1150398368 17:64837950-64837972 AAGAAGAAGAAAAAATTAGCTGG - Intergenic
1150498181 17:65625333-65625355 AAGAGGAATCAGAGAGGACCAGG - Intronic
1151048300 17:70947725-70947747 AGGAAGCAGCAGAAAGGCCCTGG + Intergenic
1151053887 17:71010097-71010119 AAAAAAAAGAAGAAGGGAGCAGG - Intergenic
1151410819 17:73927221-73927243 AAGAAGAAGGAGAGAGGGACGGG + Intergenic
1151519449 17:74617710-74617732 AGGCAGGAGCAGAGAGGAGCTGG + Intronic
1151930357 17:77228165-77228187 AAAACGAAGGAGACAGGAGCAGG - Intergenic
1152053893 17:78006599-78006621 AAGAAGAAGAAGGAAGAAGGAGG - Intronic
1152358099 17:79816175-79816197 AAGAAGAACCGTAAAGGAGTAGG - Intergenic
1152835293 17:82526269-82526291 AAGAAGAAGTAAGAAGGAGGGGG + Intronic
1153100639 18:1465160-1465182 GAGAAGAAGAAGAAAGGAGAAGG - Intergenic
1153177051 18:2387820-2387842 ATGAAGAAGCAGAAAAAAGAAGG + Intergenic
1153496022 18:5700441-5700463 CTGAAGAAGCTGAAAGGAGATGG + Intergenic
1153626128 18:7023811-7023833 AATAGGAAGCAGCAAGGAGTCGG - Intronic
1153630777 18:7067790-7067812 AAGAAGCAGCAGGGAAGAGCAGG - Intronic
1154053295 18:10983974-10983996 AGGAATAAGAAGAATGGAGCAGG + Intronic
1154190968 18:12231024-12231046 TGGAAGAGGCAGAAAAGAGCAGG - Intergenic
1154366236 18:13711602-13711624 GAAAAGCAGAAGAAAGGAGCTGG - Intronic
1155090740 18:22507276-22507298 AAGAATCACCAGAAAGGAGCAGG + Intergenic
1155122681 18:22838973-22838995 ATGAAGGGGCAGAAATGAGCAGG - Intronic
1155392791 18:25352624-25352646 AAAAAGAAAAAGAAAGGAGGGGG + Intergenic
1155830204 18:30507455-30507477 AAGAAAAATCAGAAAGGTTCAGG + Intergenic
1156072986 18:33236506-33236528 AAGAAGCAACAGAAAGAAACTGG - Intronic
1156113254 18:33754137-33754159 ATGAAGAAGAAGAAAGAAACTGG - Intergenic
1156392698 18:36665744-36665766 GTGAAGAAGCAGAGAGGAGATGG + Intronic
1156634696 18:39012869-39012891 AAGAAGAAGAAGAAAGGAAGTGG + Intergenic
1156689430 18:39688964-39688986 AAGAAAAAGAAAGAAGGAGCTGG + Intergenic
1157214684 18:45773115-45773137 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1157237596 18:45979145-45979167 AAGAAGAAGAAGAGAGGAGGAGG - Intergenic
1157237605 18:45979188-45979210 AAGAAGAAGGAGAAGGGAGAGGG - Intergenic
1157423231 18:47563374-47563396 AACAAGAGGCAGACAGAAGCAGG - Intergenic
1157621038 18:49017636-49017658 GAAAAGAAAAAGAAAGGAGCCGG - Intergenic
1157680129 18:49598546-49598568 GAGGAGAAGGAGAAAGAAGCAGG - Exonic
1157736857 18:50057410-50057432 AGGAATAACCAGAAAGGAACAGG + Intronic
1157768668 18:50325148-50325170 AAGAAGAAGGAAGAAGGAGAAGG - Intergenic
1157768670 18:50325161-50325183 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1158206204 18:54995921-54995943 AAGAAGCAGCAGAATGGATCTGG - Intergenic
1158353069 18:56583885-56583907 AAGAAAAAGAAAAAAGGAGGTGG + Intergenic
1159383382 18:67691075-67691097 AGGAAGCAGCAGAAAGGCCCTGG - Intergenic
1159413570 18:68113833-68113855 AAGAAGAAGAAAAAAGGAAAAGG + Intergenic
1159599088 18:70411556-70411578 AAGAAGAAAGAGAAAGATGCTGG - Intergenic
1159631787 18:70757339-70757361 AAGAAGGAAGAGAAAGGAGAGGG + Intergenic
1159783786 18:72690745-72690767 AAGTAGAAGCAGAAGGAAGCAGG + Intergenic
1159971303 18:74657893-74657915 AAGAAGAAGAAGAAAGGAAAAGG - Intronic
1160278323 18:77461074-77461096 TGGAAAAAGCAGAAAAGAGCTGG - Intergenic
1160281673 18:77496607-77496629 CAGAGGAAGTAGGAAGGAGCTGG - Intergenic
1160925359 19:1542274-1542296 AAGAAGGAGAAGGAAGGAGGAGG - Intergenic
1161403989 19:4081744-4081766 AAGGAGGAGCAGAGAAGAGCAGG - Intergenic
1161404044 19:4081929-4081951 AAGAAGGAGCAAGAAGGAGGAGG - Intergenic
1161508432 19:4657063-4657085 AAGAAGATGCAAAAATTAGCCGG + Intronic
1161548015 19:4894079-4894101 AAGAAGAAGAAGAAGACAGCCGG + Intronic
1161630060 19:5349551-5349573 AAAAAAAAGCAGAAATGAGACGG - Intergenic
1161647590 19:5463394-5463416 AAGAAGAAGAAAGAAGGAGAAGG - Intergenic
1161697144 19:5775683-5775705 AAGAAAGAGCAGGGAGGAGCAGG + Intronic
1161701161 19:5796346-5796368 AAGAAGAAGAAGAAAGGAGGAGG - Intergenic
1161803547 19:6429514-6429536 AGGAGGAAGGAGAAAGGAGGAGG + Intronic
1161803570 19:6429612-6429634 AAAAAGGAGGAGAAAGGAGGAGG + Intronic
1161905842 19:7155916-7155938 AAGAAGAAAAAGAAAGAAGAAGG + Intronic
1161934330 19:7362197-7362219 AAGAAGAAGGAGAAAAGAAGAGG + Intronic
1162304737 19:9865143-9865165 GAGAAGAAGAAGAAGGGAGGTGG - Intronic
1162404094 19:10463068-10463090 AAGAAGAAAGAGAAAGAAGAAGG - Intronic
1162581596 19:11534569-11534591 AAGAAGAAGAAATAAGGAGAAGG + Intergenic
1162647796 19:12062851-12062873 CAGAACCAGCAGAAGGGAGCCGG - Intergenic
1163071841 19:14849355-14849377 AAGAAGAAGAAGAAAAGAAGAGG - Intergenic
1163354899 19:16803933-16803955 AAAAAGAAAAAGAAAGTAGCTGG + Intronic
1163387239 19:17007372-17007394 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1163703957 19:18801524-18801546 AAGAAGAAGAAGAAGGGAGGGGG - Intergenic
1164211924 19:23106132-23106154 AAAAAGAAGAAGAAAGCAGAAGG + Intronic
1164249960 19:23467725-23467747 AAGAAAAAGAAGAGAGGAGAAGG - Intergenic
1164292322 19:23879639-23879661 AAGAAGAAAAGGAAAGGAGAAGG + Intergenic
1164292442 19:23880368-23880390 AAGAAGAAGCAGAGGAGAGAAGG + Intergenic
1164292718 19:23881941-23881963 AAGAGGAGGAAGAAAGGAGAAGG + Intergenic
1164292724 19:23881975-23881997 AAGAGGAGGAAGAAAGGAGAAGG + Intergenic
1164442080 19:28286547-28286569 AAAAAGAAAAAGAAAGGGGCAGG + Intergenic
1164493087 19:28732142-28732164 AAGGAGAAGGAGAAAGAAGGAGG + Intergenic
1164631762 19:29766501-29766523 AAGAAGAAGGAAGAAGGAGGAGG - Intergenic
1164718639 19:30415046-30415068 AAGCAGAAGCAGGAAGAAGAAGG - Intronic
1164784568 19:30919829-30919851 AAGGAGAAGAAAGAAGGAGCAGG + Intergenic
1164944528 19:32282331-32282353 AAGAAAAAGCTGAAAGATGCTGG - Intergenic
1165128628 19:33618534-33618556 AAGAAGAAGAAGAAAAGAAGAGG - Intergenic
1165143369 19:33716176-33716198 AATATGAACCAGAAAGGAGCTGG - Intronic
1165203652 19:34165651-34165673 GAGAAGAAGCAGGATTGAGCAGG - Intergenic
1165361951 19:35342159-35342181 AAGAAGAAGAAGGAAGGAGAAGG - Intronic
1165416052 19:35694163-35694185 AAGAAGGAGGAGAAAGGAAGAGG - Intergenic
1165935869 19:39388713-39388735 GACAAGAGGCAGCAAGGAGCAGG + Intronic
1166031156 19:40130003-40130025 TGGAAGGAGAAGAAAGGAGCAGG + Intergenic
1166195626 19:41203811-41203833 AAGAAGGAGAAGAAAGATGCAGG - Intronic
1166338871 19:42125492-42125514 AAGAAGGACAAGAAGGGAGCTGG + Intronic
1166757191 19:45200476-45200498 AAAATTAAGCAGAAAGGGGCTGG - Intronic
1166813298 19:45526878-45526900 AAGATGAGGGAGAAAGGAGAAGG + Exonic
1166873326 19:45883635-45883657 TTGAAGGAGCAGAAGGGAGCGGG + Exonic
1166901534 19:46067672-46067694 ATGAACAAGCAGAATGGAGGAGG + Intronic
1166944684 19:46389808-46389830 AAGCAGGAGCAGGAAGGGGCAGG - Intronic
1167449839 19:49560615-49560637 AAGAAGAAGGACACAGGTGCAGG - Exonic
1168098299 19:54127926-54127948 AAGAAGAAAAAGAAAGGGGGTGG + Intronic
1168220562 19:54957323-54957345 AAGAAGAAGAAGAAAGGAGTAGG - Intronic
1168341454 19:55625577-55625599 TAAAAGAAGAAGAAAGGAGGAGG - Intergenic
1202654351 1_KI270708v1_random:5453-5475 AAGAAGAAGCAGGAAGCTGGGGG + Intergenic
925172024 2:1755750-1755772 AAAAGGAAGGAGAAAGGGGCTGG - Intergenic
925188027 2:1862891-1862913 GAGAAGAAGGAGAAAGGAGGAGG + Intronic
925793599 2:7519071-7519093 AGAAAGAGGGAGAAAGGAGCGGG + Intergenic
925851158 2:8083552-8083574 GAGAAGAACCAGAAAAGAGGAGG + Intergenic
925860070 2:8166080-8166102 AAGCAGACGCAGAGAGGAGAGGG - Intergenic
926266880 2:11331001-11331023 AGGAAGGAGCAGAAAGAAGGAGG + Intronic
926594860 2:14779151-14779173 AAGATGAAACAGAAAAGAGTGGG + Intergenic
926661745 2:15474541-15474563 AAGAAGAAGAAGAAAAAAACAGG - Intronic
926725054 2:15991206-15991228 AAGAAGAAGAAGAAGGTGGCCGG - Intergenic
926796026 2:16619588-16619610 GAAAAGAAGTAGAAAGGAGGAGG - Intronic
926984673 2:18609914-18609936 AAGAAGACGAAGCAAAGAGCTGG - Intergenic
927205454 2:20606617-20606639 AAGAAGAAGAAGAAAGACGCTGG - Intronic
927279999 2:21296576-21296598 AAGAAGTACCAGATAGGAACAGG + Intergenic
927310123 2:21620972-21620994 AGGAAGAAGCAGAATTAAGCAGG - Intergenic
927488866 2:23507292-23507314 AAGAAAATGAACAAAGGAGCAGG + Intronic
927631626 2:24779347-24779369 AAAAAGCAGCAGAACTGAGCAGG - Intergenic
927715654 2:25350511-25350533 AAGAAGAAGAAGAATGGCACTGG - Intergenic
928131476 2:28654759-28654781 AAGAAGAGGGAGAAAGCAGCCGG + Intergenic
928470207 2:31568225-31568247 AACAAGAAGGAGAGAAGAGCTGG - Intronic
928772627 2:34720130-34720152 AGGAAGCAGCAGAAAGGCCCTGG - Intergenic
928781921 2:34833757-34833779 AACAACAAGAAGAAAGGAGCAGG + Intergenic
928822225 2:35374999-35375021 AAGAAGCACCAGAAAGGACAAGG + Intergenic
929015015 2:37485260-37485282 AAGAAGAAGGAGGAAGAAGAAGG - Intergenic
929237787 2:39624889-39624911 AAGAAAAAGTAAAAAGAAGCAGG - Intergenic
929568601 2:43006038-43006060 AAGGAGAAGCAGAAATGAGAAGG - Intergenic
929626917 2:43418864-43418886 GAGAAAAAGCAGAAATGAGAAGG + Intronic
929674441 2:43911497-43911519 AAGAAGAAGAAGAAAAGAAAAGG - Intronic
929679667 2:43979579-43979601 AAGAAAAAGAAGAAAATAGCCGG - Intronic
929733854 2:44524513-44524535 AAGAAAAAAAAGAAAGGAGGAGG - Intronic
929855561 2:45635931-45635953 AAGAAGAAGAAGAAGGGTGGGGG + Intergenic
930263328 2:49171768-49171790 AAGGAGAATCAGAAAAGAGTGGG + Intergenic
930551190 2:52836662-52836684 ATCCAGAAGCAGAAAGGAGCAGG + Intergenic
930879800 2:56258209-56258231 AAGATGAAGAAGAATGAAGCTGG + Intronic
930915992 2:56688874-56688896 AAGTATAAGCTGAAAGGAGGAGG + Intergenic
931144124 2:59498066-59498088 GAGGAGAAGGAGAAAGGAGGAGG - Intergenic
931477376 2:62603014-62603036 AAGAAGAAGAAAGAAGGAGGAGG - Intergenic
931477377 2:62603017-62603039 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
931553032 2:63468237-63468259 AAGATGATGAAGAAGGGAGCAGG - Intronic
931679676 2:64735413-64735435 AAAAAGTAACAGAAAGGAACAGG + Intronic
931707889 2:64962600-64962622 AAGAAGAAGCAGGCAGCAGAAGG - Intergenic
931809486 2:65840960-65840982 AAGAAGAAGCAGAGAGTAGAGGG - Intergenic
931880875 2:66569384-66569406 AACAAGAAGCAGTCAGGAGGTGG + Intronic
931967677 2:67551338-67551360 AAGGAGAAGCAACAAGGAGAAGG + Intergenic
931992918 2:67809287-67809309 AGGAAGCAGCAGAAAGGCCCTGG + Intergenic
932100814 2:68897444-68897466 AGGAAGCAGCAGAAAGGCCCTGG - Intergenic
932212248 2:69942027-69942049 AAGAAGAAACAGAAAAGACCAGG - Exonic
932488527 2:72103614-72103636 GAGAAGAGCCAGCAAGGAGCAGG - Intergenic
932757773 2:74420752-74420774 AAGAAGAAGAAGAAAGAAAACGG - Intronic
933229222 2:79786757-79786779 GAGATGAAGCAAAAAGTAGCAGG - Intronic
933342854 2:81044621-81044643 AAGAAGAAAAGGAAAGGAGAAGG + Intergenic
933477141 2:82805180-82805202 AATAAAAAGCAGAAAAAAGCAGG + Intergenic
933498477 2:83081950-83081972 AATAAGCAGCAAAATGGAGCTGG - Intergenic
933661725 2:84933056-84933078 AAGAAGAAGAAGTAGGGGGCAGG + Intergenic
933993465 2:87650365-87650387 AAGAGGAAGGAAAAAGTAGCTGG - Intergenic
934535313 2:95128556-95128578 AAGAAAAAGAAGAAAGAAGAAGG + Intronic
934535323 2:95128606-95128628 AAGAAGAAAGAAAAAGGAGGAGG + Intronic
934535328 2:95128635-95128657 AAGAAGAAAGAAAAAGGAGGAGG + Intronic
934535339 2:95128700-95128722 AGGAAGAAGGAGAAAGAAGGAGG + Intronic
935100719 2:99992990-99993012 AAGAAGGAACAGAAAGGGGAGGG - Intronic
935192113 2:100786592-100786614 AGGCAGAAGCAAAAAGCAGCAGG - Intergenic
935285965 2:101563941-101563963 GAGAAGGAGAAGAAAGGAGAAGG + Intergenic
935311901 2:101792627-101792649 AATAAGAAGAAGAAAGAAGAAGG - Intronic
935317973 2:101856080-101856102 AAGAAGAAGAGGAGAGGAGACGG + Exonic
935451153 2:103210963-103210985 AAGAAGAAGAAGAAAGGAGGAGG - Intergenic
936300394 2:111300518-111300540 AAGAGGAAGGAAAAAGTAGCTGG + Intergenic
936655525 2:114481886-114481908 AAGAAGGAGAAGAGAGGAGAAGG + Intronic
936731293 2:115384447-115384469 AAGAAGAAGAAGGAAGAAGAAGG + Intronic
936768099 2:115878042-115878064 AAGTAGAAGGAAAAAGGAGGAGG - Intergenic
937069356 2:119050807-119050829 AGGAAGAAGCAGAAAGGCCCTGG - Intergenic
937250876 2:120522914-120522936 AAGAACAAGCAGCATGGGGCTGG + Intergenic
937327125 2:120996723-120996745 ACGAAGAAGAAGAAAGAAGAAGG - Intergenic
937400189 2:121575746-121575768 GAGGAGAGGCAGAAAGGAGGAGG + Intronic
937468999 2:122159203-122159225 AAGAAGAGGCAGAGAGGAGAGGG + Intergenic
937571311 2:123365691-123365713 CAGTAGCAGCAGAAAGCAGCAGG + Intergenic
938038920 2:128059608-128059630 AAGAAGAAGAAGAATGTGGCCGG + Intergenic
938191086 2:129281271-129281293 AATAAGAAACAAAAATGAGCTGG - Intergenic
938598368 2:132811936-132811958 AAGAAGCAGCAGAAAGGCCCTGG - Intronic
938737472 2:134199492-134199514 AAGAAAAAAAAAAAAGGAGCAGG - Intronic
939373847 2:141338305-141338327 AAGAGGAAGCAGAAGAAAGCAGG + Intronic
939520014 2:143218035-143218057 AAGAGGAAGCAGAGAAGAACAGG + Intronic
939585507 2:143999427-143999449 AAAAAAAAGTAGAAAGGAGTAGG + Intronic
939629541 2:144516486-144516508 AGGAGGAAGGAGAAAGGAGATGG - Intronic
939977852 2:148739813-148739835 AAGAAGAAGAAGAAAAGAAAAGG - Intronic
939987010 2:148839421-148839443 GAGAAGAAAGAGAAAGGAGCAGG - Intergenic
940034804 2:149302248-149302270 AAGAAGCAGCAGAAAGGCACTGG - Intergenic
940256058 2:151730447-151730469 AAATAGATGCAGAAAGGAACTGG + Intronic
940431256 2:153592905-153592927 AAGAAGCAGCAGAAAGGCCCTGG + Intergenic
940465225 2:154018904-154018926 AAAAAGGAGAAGAAAGGAACAGG + Intronic
940585031 2:155636936-155636958 AATAATAATCAGAAAGTAGCTGG - Intergenic
940857054 2:158737596-158737618 AAAAAGAAAAAGAAAGGAGTTGG + Intergenic
941273210 2:163456758-163456780 AAGGAGAAGCAAAGAGGAGGGGG + Intergenic
942087590 2:172457889-172457911 ATGAAGAAGCAGAAAGCAGATGG + Intronic
942495320 2:176534044-176534066 CAGAGGAAGCAGAAGGGATCAGG + Intergenic
942507366 2:176657125-176657147 AGGAAGAAGAAGAAAGAAGTGGG + Intergenic
942743099 2:179202258-179202280 GAGAAAAAGCAGAAAGTAGCGGG - Intronic
942867543 2:180693278-180693300 AATAAAAAGAAGAAAGGAGGCGG + Intergenic
943188149 2:184640252-184640274 GAGAAGAAGAAGAAAGGAGGAGG + Intronic
943417505 2:187627248-187627270 AAGAAGAAGGAAAAAAGAGGAGG - Intergenic
943617921 2:190115216-190115238 AAGGAGAAGTAGAAAGGAGAGGG + Intronic
943621245 2:190150381-190150403 AGGAAGCAGCAGAAAGGACCTGG - Intronic
943891342 2:193290401-193290423 AGGAAGCAGCAGAAAGGCCCTGG - Intergenic
943913532 2:193598621-193598643 AAGAAGAAGAAGAAAACTGCAGG + Intergenic
944165682 2:196717593-196717615 AAGAAGCAGGATAAAGGGGCGGG + Intronic
944257737 2:197640853-197640875 AAGTAAAAGCAGAGAGGAACAGG - Intronic
944280996 2:197897197-197897219 AAGAGGAAGAAGAAAGAAGAAGG - Intronic
944372795 2:199005909-199005931 AAAAAAATGGAGAAAGGAGCTGG - Intergenic
944574483 2:201078312-201078334 AAGAAGAAGAAGTTAGGAGCAGG + Intronic
945139456 2:206668354-206668376 AAGCAGAAGAAGAAAAGAACTGG - Intronic
945155166 2:206830432-206830454 AAGAAGAAGAAGAAGGGGGGAGG + Intergenic
945864438 2:215161190-215161212 AGGAAGCAGCAGAAAGGCCCTGG + Intergenic
946050047 2:216855019-216855041 AGGATGAAGCAGAAAGGCACTGG - Intergenic
946528533 2:220546585-220546607 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
946756331 2:222951526-222951548 AAGAAAAAGCAGGAAGGACTTGG - Intergenic
946779575 2:223179090-223179112 AAGAAGACCCAAAAAGGAGATGG + Intronic
946832114 2:223737525-223737547 AAGGAGAAAGAGAAAGGAGAGGG - Intergenic
947142145 2:227029288-227029310 AAGAGGAAGGAGGAAGGGGCTGG - Intronic
947761774 2:232608632-232608654 AAGAAAAACCAGAAAACAGCCGG + Intronic
947960641 2:234233911-234233933 AAGAAGAAGAAAAAGGGAGGGGG - Intergenic
948051571 2:234982863-234982885 AGGAAGAGGCAGGAAGGAGCAGG + Intronic
948127211 2:235572968-235572990 AAGAAGAAGAAGAAAAAAGATGG - Intronic
948229742 2:236341363-236341385 TAGGAGGAGGAGAAAGGAGCGGG + Intronic
948488303 2:238295253-238295275 AAGAAGAAGAAAGAAGGAGAAGG - Intergenic
948513055 2:238484901-238484923 AAGATGAACCAGAAAATAGCTGG - Intergenic
948617010 2:239205662-239205684 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
948721598 2:239904245-239904267 AAGAAGAAGAAGAAAGGAAGAGG - Intronic
948780500 2:240318894-240318916 AAGAACCACCAGAAAGCAGCAGG + Intergenic
1169043338 20:2515016-2515038 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1169047474 20:2545673-2545695 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1169210331 20:3762913-3762935 AAGAAGAAAAATAAAGGAGAGGG + Intronic
1169241673 20:3986551-3986573 AAACAGAAGAAGAAAGGCGCTGG - Intronic
1169275947 20:4233883-4233905 AACAAGAAACAGAGAGGAGCGGG - Intronic
1169336301 20:4759984-4760006 AGGAAGTAGCAGAAAGGCCCTGG - Intergenic
1169416380 20:5420323-5420345 AAGAAGAAGCAGATAAGGCCAGG - Intergenic
1169517568 20:6333699-6333721 AGGAAGCAGCAGAAAGGCCCTGG - Intergenic
1169571609 20:6912662-6912684 AAGAAGAAGCCCAAAGGGACAGG + Intergenic
1169765567 20:9144645-9144667 AAGAAGAAGAAGAAAGAAGGAGG + Intronic
1169765568 20:9144648-9144670 AAGAAGAAGAAAGAAGGAGGAGG + Intronic
1169807816 20:9577428-9577450 CAGATGAAGCAGAAATGAGGAGG - Intronic
1169825119 20:9759195-9759217 AAGATGATGCAGAATGTAGCTGG + Intronic
1169940833 20:10935271-10935293 GAGGAGAAGCAGAAAAAAGCTGG - Intergenic
1169949574 20:11028679-11028701 AAGAAAAAGGAAAAAGGAGAAGG - Intronic
1170375922 20:15699919-15699941 AAGAAGCAGCAGAAAGGCCCTGG - Intronic
1170532648 20:17309898-17309920 AAGAAGAAGAAGAAAGGGAAGGG + Intronic
1170973598 20:21140121-21140143 AGGAAGAAGCAGAAAGAAATGGG - Intronic
1171218929 20:23375902-23375924 AGGAAGAAAGAGAAAGTAGCAGG - Exonic
1171364830 20:24616639-24616661 AAGGCGGAGCAGAAAGGAGCAGG + Intronic
1171387859 20:24782298-24782320 AAAAGAAAGCGGAAAGGAGCAGG + Intergenic
1171907216 20:30908959-30908981 AAGAAGAAAAAGAAAAGAACGGG - Intergenic
1172161409 20:32871145-32871167 AAGAAGAAGTAGAGAGGGCCGGG - Intronic
1172182141 20:33010014-33010036 AACAAGAAGCATAAAGGCGGTGG - Intronic
1172228935 20:33323965-33323987 TAGAAGAAGGGGAAAGGGGCGGG + Intergenic
1172325007 20:34027782-34027804 AAGAAGAACCATAAAAGACCTGG + Intronic
1172353492 20:34262126-34262148 AAGAAGAAGAAGAAAGAAAGAGG + Intronic
1172471151 20:35197424-35197446 AAGAAGAGGGAGAAAGGTGAGGG - Intergenic
1172545147 20:35754939-35754961 AAGAAGAAGAAGAAGAAAGCAGG - Intergenic
1172571684 20:35975598-35975620 AAGAATAAAAAGAAAGGAACAGG - Intronic
1172811659 20:37652346-37652368 AAGAAGAAGAAGAAAGAGCCAGG - Intergenic
1172850462 20:37958968-37958990 AACAAGAAAGAGAAAGGAGCTGG - Intergenic
1172928638 20:38564902-38564924 AAGAAGAAGAAGGGAGGAGGAGG - Intronic
1172928639 20:38564905-38564927 AAGAAGAAGAAGAAGGGAGGAGG - Intronic
1173069800 20:39752388-39752410 AACAAGAGGCAGAAAGAAACAGG - Intergenic
1173359632 20:42330795-42330817 AAGAACAAGCAGAATGCTGCAGG + Intronic
1173376920 20:42493887-42493909 ATGAAGAGGAAGAAATGAGCTGG - Intronic
1173453354 20:43184894-43184916 CAGTAGAGGCAGAAATGAGCAGG - Intronic
1173459944 20:43235047-43235069 AAGATGACGCAGAAAAGTGCAGG + Intergenic
1173762765 20:45578503-45578525 GAGAGAAAGCACAAAGGAGCTGG + Intronic
1173984068 20:47247461-47247483 AGGAAGAAGCACAAACTAGCAGG + Intronic
1174011660 20:47454639-47454661 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1174070253 20:47894665-47894687 CAGAAGACCCAGAAAGGAGCTGG + Intergenic
1174101069 20:48126543-48126565 CCGGAGACGCAGAAAGGAGCTGG - Intergenic
1174153602 20:48502870-48502892 CTGGAGAACCAGAAAGGAGCTGG - Intergenic
1174156141 20:48516561-48516583 CAGAAGACCCAGAAAGGAGCTGG - Intergenic
1174242953 20:49152952-49152974 TTAAAGAAGCACAAAGGAGCCGG + Intronic
1174243006 20:49153264-49153286 AAAAAGAAGCACAAAGGGCCGGG + Intronic
1174379393 20:50146922-50146944 AACAAGAATCAGAAAGGGGAAGG - Intronic
1174504235 20:51006437-51006459 AAGAAGAAAAAGAAAGGAAAGGG - Intronic
1174662534 20:52226673-52226695 AAGAAGAAGGAGAGAGAAGGTGG - Intergenic
1174764753 20:53242537-53242559 AAGAAGAAGCAGAGAGTAAGAGG + Intronic
1174799266 20:53549547-53549569 AAGTAAAAGAAAAAAGGAGCAGG + Intergenic
1174978935 20:55369882-55369904 AAGAAGAAGCAGAGGAAAGCGGG + Intergenic
1175024135 20:55883327-55883349 AAGGGGAAGCACAAAGGAGCAGG - Intergenic
1175068969 20:56316019-56316041 AAGAAGCAGCGGAAAGGCCCTGG + Intergenic
1175438637 20:58974000-58974022 AAGAAGAAGAAGGAAGAAGAAGG + Intergenic
1175452061 20:59077765-59077787 AGGAGGAAGGAGAAAGGAGAAGG + Intergenic
1175473085 20:59247275-59247297 AAGAAAAAGCACGAAGGTGCTGG - Intronic
1176214416 20:63941502-63941524 AAGAGGAAGCAGAAGTGGGCCGG + Intronic
1176552325 21:8231572-8231594 AAGAAGAAGAAAAAAAGAACGGG - Intergenic
1176571230 21:8414164-8414186 AAGAAGAAGAAAAAAAGAACGGG - Intergenic
1176579144 21:8458726-8458748 AAGAAGAAGAAAAAAAGAACGGG - Intergenic
1176633281 21:9160958-9160980 AAGAAGAAGCAGGAAGCTGGGGG - Intergenic
1177095134 21:16823266-16823288 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1177146315 21:17410831-17410853 AAGCAGAAGGAGAAAAGAGCAGG + Intergenic
1177174531 21:17689688-17689710 AGGAAGCAGCAGAAAGGCCCTGG - Intergenic
1178150824 21:29791489-29791511 AAGAAGAAGGAGAAGGGAAGTGG + Intronic
1178493427 21:33068580-33068602 AGGAAGATGGAGAAATGAGCAGG + Intergenic
1178524371 21:33314186-33314208 AACAAGAAGCAAAAAAGAGGCGG + Intergenic
1178569452 21:33721893-33721915 AAGAAGAAGAAAAAATTAGCTGG - Intronic
1178600686 21:33991987-33992009 AGGGAGAAGCAGAAAGGTGCAGG + Intergenic
1178999562 21:37444073-37444095 GAGAAGCAGAAGAAAGGAACGGG - Intronic
1179081848 21:38178722-38178744 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1179195862 21:39161736-39161758 ATGAAGATGCAGGAAGGAGAGGG + Intergenic
1179238552 21:39568400-39568422 AAAAAAAAACAGAAAGCAGCTGG - Intronic
1179257589 21:39730133-39730155 TAGCAGAAGCAGGAAGAAGCAGG - Intergenic
1180148645 21:45936233-45936255 AAAAAGAGGCAGAAGAGAGCAGG + Intronic
1180389144 22:12208972-12208994 AAGAAGAAGCAGGAAGCTGGGGG - Intergenic
1180416797 22:12725499-12725521 AAGAAGAAGCAGGAAGCTGGGGG + Intergenic
1180462259 22:15575889-15575911 AAGAAGATGAAGAAAGAAGAAGG - Intergenic
1180591727 22:16944244-16944266 AGGAAGCAGCAGAAAGGCCCTGG + Intergenic
1180971598 22:19818980-19819002 AGGAAGCAGCAGACAGGGGCAGG - Intronic
1181018232 22:20083640-20083662 ATGAAGAAGCCACAAGGAGCAGG - Intronic
1181026307 22:20129731-20129753 AAAATGAAGCAGAAAGCAGGAGG - Intronic
1181599144 22:23938822-23938844 ATGAATAAGCTGAAAGGAACAGG + Intergenic
1181747744 22:24967600-24967622 AAGAGGAGGCAGAGAGCAGCAGG + Intronic
1181868766 22:25881171-25881193 GAGAAGAAGCAGAAAAGAGATGG - Intronic
1181883413 22:25999632-25999654 GAGAAGGAGGAGAAAGGAGGAGG - Intronic
1181960163 22:26617039-26617061 AAGCAGACGGGGAAAGGAGCTGG - Intronic
1182080033 22:27522358-27522380 AAGATGAAGCAGGAACCAGCTGG + Intergenic
1182158992 22:28103165-28103187 AGGCAGAAGCAGAGAGAAGCTGG - Intronic
1182183547 22:28376888-28376910 AAGAAGCACCAGAAAGAAACAGG + Intronic
1182253889 22:29024018-29024040 AAGAAGAACAGGAAAAGAGCTGG - Intronic
1182544202 22:31064166-31064188 AGGAAGAAGCAGAACTGGGCAGG + Intronic
1183342570 22:37289839-37289861 AGGAAGCAGCTGGAAGGAGCAGG + Intronic
1183641657 22:39096470-39096492 TAGAAGCCACAGAAAGGAGCAGG - Intergenic
1183680407 22:39325417-39325439 AGGAAGAAGAAGAAAGAAGAAGG + Intergenic
1183778819 22:39985410-39985432 CCGAAGAAGGAGAAAGGTGCAGG - Intergenic
1183821935 22:40353303-40353325 AAGAAGAAGAAGAAAGGAGAAGG - Intronic
1184185662 22:42863330-42863352 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1184321436 22:43744823-43744845 GAGAGGAAGCAGAAAGAAGGAGG + Intronic
1184345969 22:43913155-43913177 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1184345972 22:43913239-43913261 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1184505603 22:44899623-44899645 GAGAAGAAGAAGGAAGGAGAAGG - Intronic
1184772809 22:46607783-46607805 AAAACAAACCAGAAAGGAGCTGG - Intronic
1184959363 22:47917900-47917922 AAGGAGAAGGAGGAAGGAGAGGG - Intergenic
1184989879 22:48160183-48160205 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
1185300219 22:50075726-50075748 AAAAAGAAGCAGAACGGAAATGG + Intronic
949671754 3:6404297-6404319 AAGAGGAAGCAGAGAGGAACAGG + Intergenic
949710881 3:6870001-6870023 AAAAAGAAGAGGAAAGGAGAAGG - Intronic
949732225 3:7126725-7126747 AAGGAGAAGCAGAGAGGAGGGGG - Intronic
949763868 3:7504289-7504311 AAGAAGAAGTACAAAGAAGCAGG - Intronic
949828791 3:8191614-8191636 AAGAGGAAGAAGAAAGAAGAAGG - Intergenic
949828793 3:8191640-8191662 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
949890720 3:8731993-8732015 AAGAAGAAAGAGGAAGGGGCAGG - Intronic
950358923 3:12436784-12436806 AGAAAGAGGGAGAAAGGAGCAGG - Intergenic
950753926 3:15156202-15156224 AAGAATAAGTAAAAAGGAACAGG - Intergenic
951322827 3:21267951-21267973 AAGCTAAAGCAGAAAGGAGGAGG + Intergenic
951557456 3:23935150-23935172 AAAAAGAAGCAGAAACCATCAGG + Intronic
951940578 3:28074336-28074358 AAGAAGAAGAAGAAACGAAGAGG + Intergenic
952097293 3:29968508-29968530 AGGAAGCAGCAGAAAGGCCCTGG - Intronic
952119592 3:30226302-30226324 AAGAAGAAGATGACAGGAGAGGG - Intergenic
952184642 3:30955437-30955459 AAAAAGAGGCAGAAAGGGACCGG - Intergenic
952344475 3:32471027-32471049 AAGAAGAAGAAGATAGAAGAAGG + Intronic
952399166 3:32947995-32948017 AAACCTAAGCAGAAAGGAGCAGG - Intergenic
952412856 3:33064935-33064957 TAGAAGAAGGAGAATGGGGCAGG + Intronic
952924005 3:38308163-38308185 AAGAAGAAGAAAGAAGGAGGAGG + Intronic
953084625 3:39654466-39654488 AGGAAGCAGCAGAAAGGCCCTGG - Intergenic
953353135 3:42230853-42230875 AAGATGCATTAGAAAGGAGCGGG - Intergenic
953367169 3:42354750-42354772 GTGAAGAAGAAGAAAGGAGGAGG - Intergenic
953637313 3:44674120-44674142 AAGAGAAAGCACAAAGAAGCAGG - Intergenic
953801387 3:46026563-46026585 AAGAAGAAGAAAAATGGATCTGG - Intronic
954006644 3:47596596-47596618 AAGAAGAAGAAGAAAAAAGATGG + Intronic
954212872 3:49108338-49108360 AAGGAGAAGCGGCAAGGAGCTGG + Intronic
954348607 3:50023214-50023236 AAGAAGAAGAAGAAAGCAGGAGG - Intronic
954744814 3:52781352-52781374 AAGAAGCAGCAGAAAAGAAGAGG - Intronic
954746892 3:52792470-52792492 AAGAAAAAGCAGAAAGCCTCTGG - Intergenic
955033860 3:55247606-55247628 AAAGAGAAGGAGAAAGGAGGAGG - Intergenic
955307444 3:57848500-57848522 AGGAAGAAGAAGAAAGAAGAAGG - Intronic
955307471 3:57848649-57848671 AAAAAGAAGAAGGAAGGAGGAGG - Intronic
955752276 3:62195219-62195241 AGGAAGAAGCAGAAAGCATTGGG - Intronic
956054460 3:65283911-65283933 AAGAGGAAGGAGGCAGGAGCAGG - Intergenic
956198806 3:66683947-66683969 AAGAAGAAAGAAAAAGGAGGAGG - Intergenic
956198816 3:66684017-66684039 AAGAAGAAGAAAAGAGGAGGAGG - Intergenic
956198817 3:66684020-66684042 AAGAAGAAGAAGAAAAGAGGAGG - Intergenic
956202630 3:66722314-66722336 AAGAAGAAGGAGAAAGAGGGAGG - Intergenic
956266694 3:67404363-67404385 AACAAGAAGCAGTAAAGAGAAGG + Intronic
956705731 3:71997445-71997467 AAGAAGAAGAAGAAAGGAGGAGG + Intergenic
956741582 3:72280001-72280023 GAGAGAAAGAAGAAAGGAGCAGG + Intergenic
956995789 3:74824999-74825021 AGGAAGCAGCAGAAAGGCTCTGG - Intergenic
957156894 3:76555409-76555431 AAGAAGAAGAAAGAAGGAGAAGG + Intronic
957427813 3:80063443-80063465 AGGAAGCAGCAGAAAGGCCCTGG + Intergenic
957462876 3:80545125-80545147 AAGTAGAAAGAGAAGGGAGCAGG + Intergenic
957509631 3:81170435-81170457 AAGAGGAAGCAGACAGCAGGAGG + Intergenic
957632858 3:82740560-82740582 ATGGAGAAGCAGAGAGGAGAGGG + Intergenic
957751724 3:84427547-84427569 AAGAAGAAGAAGAAAAAAACAGG + Intergenic
957757029 3:84503484-84503506 AAGAAGAAGCAGAGTGAAGGTGG - Intergenic
957894077 3:86397456-86397478 AAGAGGAAGAAGAAAGGAAGAGG - Intergenic
958725562 3:97901741-97901763 AAGAACAAGGAGGTAGGAGCAGG - Intronic
958962531 3:100523673-100523695 GAGAAGGAGGAGAAAGGAGGGGG - Intronic
958962540 3:100523704-100523726 GAGAAGGAGGAGAAAGGAGGAGG - Intronic
958962545 3:100523726-100523748 GAGAAGGAGGAGAAAGGAGGAGG - Intronic
959172305 3:102858156-102858178 AAGAAGAAGGAAGAAGGAGAAGG - Intergenic
959436064 3:106316874-106316896 AGGAAGCAGCAGAAAGGCTCTGG + Intergenic
959550935 3:107656623-107656645 AAAAAGAAACAGAACAGAGCAGG - Intronic
959595985 3:108128899-108128921 AAGGAGAGGCAGAAGGAAGCAGG + Intergenic
960010440 3:112829032-112829054 AACCAGATGCAGAAAGAAGCAGG + Intronic
960529921 3:118753013-118753035 GAGGAGAAGGAGAAAGGAGAAGG + Intergenic
960654975 3:119993157-119993179 AAGAAAATGCACAAACGAGCAGG + Intronic
960680168 3:120239388-120239410 AAGAAGAAGAAGAAGGGAGGAGG - Intronic
960764374 3:121110032-121110054 AATAAAAAGCAGAAAAAAGCAGG - Intronic
960865461 3:122194958-122194980 AGTAAGAAGAAGAAAGGAGGAGG - Intronic
961360085 3:126361455-126361477 AAGGAGCAGCACCAAGGAGCAGG + Intergenic
961375085 3:126459664-126459686 GAAAAAAAGCAGAGAGGAGCGGG - Exonic
962066092 3:131981749-131981771 AGGAAGCAGCAGAAAGGCCCTGG - Intronic
962163984 3:133029687-133029709 AAGAAGAAACAGAAAGAACGTGG + Intergenic
962563086 3:136628552-136628574 TAGGAGAAGAAGAAGGGAGCAGG - Intronic
962693580 3:137925926-137925948 GAGAAGCAGCAGAAAGCAGGTGG + Intergenic
962770416 3:138606199-138606221 AAGAAGAAGAAGAAAGGAAGAGG + Intergenic
963115749 3:141727636-141727658 AAGAAGGAGAAGAAAGGACAAGG + Intergenic
963559908 3:146851313-146851335 AAGGAAAAGGAGAAAGGAGGAGG + Intergenic
964113390 3:153110454-153110476 AAGAAAAAGTATAAAGAAGCTGG - Intergenic
964248030 3:154676965-154676987 ATGGAGAAGTAGAAAGGAGCTGG - Intergenic
964316724 3:155452631-155452653 AAGTACAAGAAGGAAGGAGCTGG + Intronic
964561097 3:157997421-157997443 AAGTAGAAGCAGAAGGCAGAAGG - Intergenic
964601356 3:158504039-158504061 AAGAAGCAGCAGAAAGGCCCTGG - Intronic
964763446 3:160156157-160156179 AAGAAGCAGGAGAAAGGAAATGG - Intergenic
965321994 3:167262013-167262035 AGGAAGAAGCAGAAAGGCCCTGG - Intronic
965670830 3:171146199-171146221 AAGAAGATGCAGGCAGGAGCGGG - Intronic
965695015 3:171399300-171399322 AAGTAGATGCAAACAGGAGCAGG + Intronic
965711736 3:171562713-171562735 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
965783851 3:172315983-172316005 AAAAAGAAGAAGAAAGAAGAAGG - Intronic
965853403 3:173058917-173058939 AAAAAAAAGGTGAAAGGAGCTGG - Intronic
966110279 3:176392820-176392842 AAGAAGAAGCTGAAAGTACTGGG - Intergenic
966258052 3:177941849-177941871 GAGAAGAAACAGAAAGGAGGTGG - Intergenic
966377579 3:179312631-179312653 AAGAAGAAGAATAAAGATGCAGG - Intergenic
966540755 3:181087370-181087392 AAGAAGAAGGAAAGAGGAGGTGG + Intergenic
966541310 3:181093382-181093404 AACAAAAAGCAGGTAGGAGCTGG + Intergenic
966895108 3:184439084-184439106 AAGGAGAAGGAGAAAGGGGGAGG + Intronic
966954742 3:184864126-184864148 AAGGAGAAGGAGAAGGGAGGGGG + Intronic
967332819 3:188308960-188308982 GAGGAGAAGGAGAAAGGAGAAGG - Intronic
967446246 3:189570040-189570062 AAGAAGAAACCGAATGTAGCTGG - Intergenic
967937069 3:194737622-194737644 GAGAAGAAGAAGACAGGAGGAGG - Intergenic
967987685 3:195107513-195107535 AAGAAGGAGGAGGAAGGAGGAGG + Intronic
968257305 3:197287618-197287640 AAGAAAAAGGAAAAAGGAGGAGG + Intronic
968336501 3:197918029-197918051 AAGAAGGAGGAGAAATGGGCTGG - Intronic
968376544 4:47593-47615 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
968937565 4:3620168-3620190 AAGAAGAAACAGAGAGGACCAGG + Intergenic
968938138 4:3624317-3624339 AGGAGGAAGGAGAAAGGAGCAGG + Intergenic
969104442 4:4794622-4794644 CAGAAGAAGCAGGATGGAGAGGG - Intergenic
969537786 4:7767270-7767292 AAGAGGGAGCAAAAGGGAGCGGG + Intronic
969653121 4:8479219-8479241 AAGGTCAAGCAGAAATGAGCTGG - Intronic
969717930 4:8877427-8877449 AAGAAGAAGGAGAAAAGAGGAGG + Intergenic
970166861 4:13247755-13247777 AAGTAGAAGGAGAAAGAAGATGG - Intergenic
970219690 4:13797972-13797994 AAGAAGGAGAAGAAAGAAGGAGG + Intergenic
970346679 4:15159260-15159282 AGGAAGCAGCAGAAAGGCCCTGG - Intergenic
970565383 4:17327159-17327181 AAGGAGAAGCAGAGATGAGGTGG - Intergenic
971001950 4:22333144-22333166 AAGGAGAAGCAGGCAGGAGCTGG - Intergenic
971012174 4:22450250-22450272 AAAAAGAAGCATAAAGGATGGGG - Intronic
971251415 4:24975986-24976008 AAAAAGAAGGAGAAGGGAGAGGG + Intronic
971420268 4:26467987-26468009 AAGAAGAAGAAGAAGAAAGCGGG + Intergenic
971480900 4:27114298-27114320 AAAAGGAAGCAGAAAAGAGAAGG - Intergenic
971586761 4:28414512-28414534 AATAAGAAGAAGAAAGAAGGGGG - Intergenic
971655248 4:29336000-29336022 AAGAAAAAGGAGGAAGGAGGAGG - Intergenic
971760622 4:30760231-30760253 AGGAAGAAGTAGAGAGGAGCAGG + Intronic
971901095 4:32658676-32658698 AGGAAGCAGCAGAAAGGCCCTGG - Intergenic
972615720 4:40696050-40696072 AACAGGAAGAAGAAAGGATCTGG - Intergenic
972695369 4:41439910-41439932 AAGAAAAAACAAAAAGGAGGAGG + Intronic
973071682 4:45868123-45868145 AAGAATAAGTAGAAAGCTGCTGG + Intergenic
973095003 4:46185997-46186019 AAGAAGAGACACAAAGCAGCAGG + Intergenic
973161883 4:47029961-47029983 AAGAAGAAGAAAAAAAGAGAAGG - Intronic
973191615 4:47392095-47392117 AAAAAAACGCAGAAAGGAGAAGG + Intronic
973238835 4:47934982-47935004 AAGAAGAAAAAGAAAGGAAAAGG + Intronic
973306686 4:48659957-48659979 AAGAAGAAGAAGAAAGGAGGAGG + Intronic
973715472 4:53671346-53671368 AAGATAAAGGAGGAAGGAGCTGG - Intronic
973782302 4:54300258-54300280 AGGAAGCAGCAGAAAGGCCCTGG + Intergenic
974279588 4:59775236-59775258 AAGAGGAAGATGAAAGGAGGAGG - Intergenic
974949321 4:68569440-68569462 AGGAAGTAGCAGAAAGGTACTGG + Intronic
974958354 4:68671634-68671656 AGGAAGTAGCAGAAAGGCACTGG + Intergenic
974993848 4:69128557-69128579 AAGAAGTAACAGAAAGGAGGGGG + Intronic
975021736 4:69499685-69499707 AATAGAAAGCAGAAAGAAGCAGG - Intronic
975028213 4:69578507-69578529 AAGAAGAAGAAAGAAGGAGGAGG - Intergenic
975028214 4:69578510-69578532 GAGAAGAAGAAGAAAGAAGGAGG - Intergenic
975391468 4:73822890-73822912 AAGAAGAGGGAGAAAGGGGAGGG + Intergenic
975498385 4:75058406-75058428 AACAAGAAGGAGAGAAGAGCTGG + Intergenic
975525728 4:75348309-75348331 AAGAAGAATCAGAAATGGGTGGG + Intergenic
975565392 4:75748733-75748755 AAGAAGAAGCAGAAAACGCCTGG + Intronic
975680111 4:76867897-76867919 AGGAAGCAGCAGAAAGGCCCTGG + Intergenic
975905836 4:79210775-79210797 AAAAAGAAGAAGAAAGGCTCTGG + Intergenic
976195488 4:82527941-82527963 AAGAAGAAAAGGCAAGGAGCAGG + Intronic
976274027 4:83258055-83258077 AAGAAGAGCCAGAAGGCAGCAGG + Intergenic
976323235 4:83740273-83740295 AAGAGGAAACAAAAAGGAGATGG + Intergenic
976374830 4:84333721-84333743 AAGAAAAAACAGAAAAGATCAGG - Intergenic
976425018 4:84893186-84893208 AAGAAGCAGCAGAATAGAGGAGG - Intronic
976598890 4:86919619-86919641 AAAAAGAAGCAGAATGGGGCCGG - Intronic
976633843 4:87267529-87267551 AATAAGAAGGAGAAGGGAGATGG - Intergenic
976703530 4:87997264-87997286 AAGAACTACCAGAAAGAAGCAGG - Intergenic
976777200 4:88719676-88719698 AAGGAGAAGAAAAAAGGAGGAGG - Intergenic
976856384 4:89609750-89609772 AGGAAGCAGCAGAAAGGCTCTGG + Intergenic
976909273 4:90280393-90280415 AAGAAGAAGAAGAAAAAAACAGG - Intronic
977014461 4:91675833-91675855 CAGAGGAAGCAGGAAGGAACAGG + Intergenic
977084781 4:92579347-92579369 AAAAAGAAACAAAAAAGAGCTGG - Intronic
977160986 4:93634905-93634927 AAGAAGTAGGAGAAAAGAGGGGG - Intronic
977325016 4:95564175-95564197 AAACAGAATCAGAAAGGAGCTGG - Intergenic
977476725 4:97519835-97519857 AAGAAAAAGGAGAAAGGACAAGG + Intronic
977622310 4:99151357-99151379 GAGAAAAAGCTGAAAGCAGCAGG - Intronic
977746693 4:100558218-100558240 AGGAAGCAGCAGAAAGGCCCCGG + Intronic
977858379 4:101924523-101924545 AAACAGAAGCAGAAAGGGTCAGG + Intronic
977904615 4:102461111-102461133 AGGAAGTAGCAGAAAGGCACGGG - Intergenic
978090728 4:104711559-104711581 AGCAAGAAGAAGAAAGAAGCTGG + Intergenic
978119872 4:105065524-105065546 AAGATGAAGAAGGAAGGGGCAGG + Intergenic
978127442 4:105151430-105151452 AAGAAGAAACAGATAGTAGGTGG + Intronic
978237937 4:106482617-106482639 AAAAAAAAGGAGAGAGGAGCGGG - Intergenic
978268539 4:106858990-106859012 AAGAAGAAGAAGAAAGAAGGAGG + Intergenic
978386465 4:108180450-108180472 AAGAGGAAGCAAAAAGAAGAGGG + Intergenic
978425328 4:108576407-108576429 AAGAAGATGCAGAACAGAGAGGG - Intergenic
978477401 4:109146576-109146598 AAGAATAAAGAGAAAAGAGCAGG - Intronic
978529778 4:109702101-109702123 AGGAAGAAGAGGAAGGGAGCAGG + Intronic
978595904 4:110376896-110376918 AAAAAGAAGGAGAAAGAAGGAGG - Intronic
978670595 4:111243953-111243975 AGGAAGCAGCAGAAAGGCCCTGG + Intergenic
978726794 4:111978132-111978154 AGGAAGAAGCAGAAAGGCCCTGG - Intergenic
979288183 4:118950407-118950429 AAGCAGAAGCAGAGAGCAGAAGG + Intronic
979704750 4:123708831-123708853 AAGAAGCTGCAGAAAGGCCCTGG + Intergenic
979757092 4:124354480-124354502 AAGAAGAAGAAGAAAGTTGGAGG - Intergenic
979794998 4:124834830-124834852 AGGAAGAAGCAGAAAGGCCCTGG - Intergenic
980021413 4:127714480-127714502 AAGAGGAAGGAGACAGGAGATGG - Intronic
980026257 4:127770929-127770951 AAGAAGAAGAAGAACAGAGGAGG - Intronic
980087288 4:128404076-128404098 AGGAAGCAGCAGAAAGGCCCTGG - Intergenic
980425672 4:132624654-132624676 AAGAAGAAGGAAAAAGAAGGAGG - Intergenic
980582946 4:134776013-134776035 ACTTAGAAGAAGAAAGGAGCTGG - Intergenic
980615607 4:135219497-135219519 AAGAAGAAATAAAAAGGAGAGGG - Intergenic
980719027 4:136668808-136668830 AAGGAAAAGGAGAAAGCAGCTGG - Intergenic
980742570 4:136972059-136972081 AAGAAGAAGGAGGAAGAAGAAGG + Intergenic
980805388 4:137806216-137806238 AACAATAAGCAGAAAGGCACAGG + Intergenic
980910775 4:138992443-138992465 AAGAAGAAGAAGAAAAGAAGGGG + Intergenic
981018248 4:139998086-139998108 GAGAAGACAGAGAAAGGAGCAGG - Intronic
981025092 4:140069713-140069735 AAGAAGAAAGAAGAAGGAGCCGG + Intronic
981120131 4:141040025-141040047 ATGGAGAAGGAAAAAGGAGCGGG - Intronic
981346537 4:143683497-143683519 AAGAAGCAGCAGAAAGGCCCTGG + Intronic
981403702 4:144342477-144342499 AATAAGAAGCATCAAAGAGCAGG + Intergenic
981500518 4:145446362-145446384 AAGAATCACCAGAAAGGAGCAGG + Intergenic
981559634 4:146033061-146033083 TAGAAGAAGCAGCAAGGCCCTGG + Intergenic
981640070 4:146931975-146931997 AAGAAAAAGCAGAAAGAAGAAGG - Intronic
981690512 4:147503416-147503438 AACAGGAAGCAGGAAAGAGCAGG + Intronic
981760894 4:148193144-148193166 AAGAAGCAGCAGCAAGGTCCTGG - Intronic
981879289 4:149590437-149590459 AAAAAGAAGTTGAAAGAAGCAGG - Intergenic
982077784 4:151755767-151755789 AAGAAGAAGCAAAAATCAGTGGG - Intronic
982090815 4:151878536-151878558 AAGAAGACGGAAAAAGCAGCGGG + Intergenic
982190032 4:152844082-152844104 ACGAAGCAGCAGAAAGGCCCTGG - Intronic
982464265 4:155710695-155710717 AAGAAGCAGGAAAAAGGGGCAGG + Exonic
982864991 4:160499399-160499421 AAAAAGAAGAAGAAACGAGGGGG + Intergenic
982977638 4:162086304-162086326 AGGAAGAGGGAGAAAGGAGGGGG - Intronic
983111419 4:163754901-163754923 AGAAGGAAGCAGAAAGGAGACGG + Intronic
983426715 4:167593458-167593480 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
984266801 4:177505908-177505930 AGGAAGCAGCAGAAAGGCCCTGG - Intergenic
984527650 4:180875912-180875934 AGGAAGCAGCAGAAAGGCCCTGG - Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
984703985 4:182834580-182834602 AAGAAGGAGGGGAAAGGAGAAGG - Intergenic
985061222 4:186081433-186081455 AGGACGGAGCAGAAGGGAGCTGG + Intronic
985160326 4:187037522-187037544 AAGAAGAAGAAGAAGTGAGTAGG + Intergenic
985381013 4:189394821-189394843 AGGAAGGTGCAGAAAGGAGAGGG - Intergenic
985563310 5:602802-602824 GAGAAGAGGCACAGAGGAGCCGG - Intergenic
985690136 5:1304316-1304338 AAGGAGAAGGAGAAGGGAGAAGG - Intergenic
986009680 5:3700897-3700919 AAGAAGAAGAAGGAGGGAGGAGG - Intergenic
986143542 5:5054682-5054704 AAGAAAAAGAAGAAAGAAGAAGG + Intergenic
986362441 5:6993221-6993243 AAGAAGAAGAAGAAAGGAGCGGG - Intergenic
986391053 5:7288684-7288706 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
986989107 5:13531201-13531223 AAGAAGAAGTAGGAAGGGGAGGG - Intergenic
987207187 5:15639904-15639926 AAGAACAAGCAGCACAGAGCTGG - Intronic
987453457 5:18114672-18114694 AAGAAGGAGGAGATAAGAGCTGG - Intergenic
987518602 5:18948267-18948289 AAGAAGGAGAAGGAAGGAGATGG + Intergenic
987622640 5:20355117-20355139 AAGAGAAAGGGGAAAGGAGCTGG - Intronic
988139331 5:27215796-27215818 AAGAAAAAGTAGATAGGATCAGG + Intergenic
988344511 5:30020607-30020629 AGGAAGCAGCAGAAAGGCCCAGG + Intergenic
988632079 5:32942330-32942352 AAGGAGAAGGAGAAGGGAGGAGG + Intergenic
988632089 5:32942416-32942438 AGGAAGAAGAAGAAAGAAGAAGG + Intergenic
988902125 5:35745145-35745167 AGGAAGTAGCAGAAAGGCACTGG + Intronic
988967091 5:36430306-36430328 AATAAAAAACAGAAAGAAGCAGG - Intergenic
988991099 5:36671909-36671931 GAGAGGAAGCAGGAAGGTGCTGG - Intronic
989143474 5:38225057-38225079 GAGGAGAAGGAGAAAGGAGGAGG + Intergenic
989192629 5:38686131-38686153 ACGAAGATGCAGCAAGGAGAAGG + Intergenic
989654445 5:43731115-43731137 AAGAAGAAGAAGAAGAGAGAGGG - Intergenic
989734507 5:44687765-44687787 AAGAGGAAGCAGAGAGAAGTGGG + Intergenic
989756218 5:44958775-44958797 AAAAAGAAGGAGGAAGGAGAAGG - Intergenic
990335743 5:54770773-54770795 AACAGAAAGTAGAAAGGAGCTGG + Intergenic
990474409 5:56147872-56147894 AAGAAGAAGAAGAAAGGAGAAGG - Intronic
990494956 5:56338072-56338094 AAGAAGAAGAAGACAGAAGGAGG - Intergenic
991603827 5:68380369-68380391 AAGAAGAATTAGGAAGGAGAAGG - Intergenic
991685456 5:69178056-69178078 AAGAAGAAACAGAAAACAGGGGG - Exonic
992078456 5:73213242-73213264 AAGAAGAAGAAGGAAGAAGAAGG + Intergenic
992572018 5:78068348-78068370 AAGAAGAAGAAAGAAGGAGAAGG + Intronic
993158504 5:84258262-84258284 AGGAGGAAGCAGAAATGAGCAGG + Intronic
993158810 5:84262302-84262324 AAGAAGAAGGAGAAAGGAATAGG + Intronic
993250387 5:85513547-85513569 AGGAAGCAGCAGAAAGGCCCTGG - Intergenic
993346813 5:86794333-86794355 GAGAAGAAGCAAAAAAGAGATGG - Intergenic
993389296 5:87298431-87298453 AAGAAGAAACAGGAAGGAACAGG + Intronic
993418886 5:87674875-87674897 AGGAGAAAGGAGAAAGGAGCAGG - Intergenic
993678198 5:90843217-90843239 AAAAAGAAGAAAAAAGGAGAGGG + Intronic
993717159 5:91286907-91286929 AATAAGCAGCAGAAAAGAACTGG + Intergenic
993916955 5:93755705-93755727 AGGAAGCAGCAGAAACGCGCTGG + Intronic
993964676 5:94346646-94346668 ACGAAGCAGCAGAAAGGCCCTGG + Intronic
994143625 5:96368145-96368167 AAGGAAAAGCAGAAAGGAAAGGG - Intergenic
994721935 5:103390427-103390449 AATAGGTAGGAGAAAGGAGCAGG - Intergenic
994913679 5:105945617-105945639 AAAAAGAAGAAGAAAGAAGAGGG + Intergenic
995541990 5:113194680-113194702 AAGAAAAAGAAGAAAGGGGAAGG + Intronic
995567903 5:113450992-113451014 TAAAAGAAGCAGAAAGGATGTGG - Intronic
995672981 5:114628086-114628108 AAGAAAAAGCAGAGAGGAGCTGG + Intergenic
995735854 5:115298386-115298408 GAGAAGAAGGAGAAGGGAGAAGG + Intergenic
995735886 5:115298542-115298564 AAGAAGAAAAAGAAAGAAGGAGG + Intergenic
995817712 5:116191120-116191142 AGGAAGCAGCAGAAAGGCCCTGG + Intronic
995818546 5:116200515-116200537 AAGAAGAAAGAGAAAAGAACAGG - Intronic
995872805 5:116760250-116760272 ACGAAGAAGAAGAAAACAGCTGG + Intergenic
996127538 5:119744008-119744030 AAGAAGAAGAAGAAAGGAGGAGG + Intergenic
996325330 5:122267039-122267061 AGGAAGCAGCAGAAAGGCCCTGG + Intergenic
996343751 5:122467583-122467605 AAGAAAAAGAAGAAAGAAGGAGG + Intergenic
996504891 5:124257688-124257710 AGGAAGCAGCAGAAAGGCCCTGG - Intergenic
996569657 5:124918572-124918594 AATAACAAGCAAAAAGAAGCAGG - Intergenic
996590897 5:125146941-125146963 AGGAAGAAGCAGGGAGAAGCAGG - Intergenic
996606568 5:125329977-125329999 AAGAAGAAGAAGGAAGAAGAAGG + Intergenic
996898898 5:128520911-128520933 AATACGAAGCAGAAAGGAAAAGG + Intronic
997405357 5:133641913-133641935 AAGAAGAAGAAAGAAGGAGGAGG - Intergenic
997405358 5:133641916-133641938 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
997760833 5:136446080-136446102 AGGAAGCAGCAGAAAGGCCCTGG + Intergenic
997783983 5:136689475-136689497 AAGAAAAAGAAAAAAAGAGCTGG + Intergenic
997800970 5:136861717-136861739 AAGAGGAAGCAAGAAAGAGCAGG - Intergenic
998006414 5:138659852-138659874 AAGGAGAAGGAGAAAGGAGATGG - Intronic
998154289 5:139775663-139775685 AAAAGGAAGAAGAAAGGAGAAGG - Intergenic
998174775 5:139895003-139895025 AAGAAGAAGGGGAAGGGAGGAGG + Intronic
998509328 5:142698195-142698217 AATATGAGGCAGAAGGGAGCGGG + Intergenic
998601999 5:143593979-143594001 AAGGAGAAAAAGAACGGAGCCGG + Intergenic
998720152 5:144936181-144936203 AAGAAGAAGAAGAAATGAGGAGG + Intergenic
998734799 5:145124834-145124856 AAAAACAAACAGAAAGAAGCAGG - Intergenic
998940747 5:147280086-147280108 AAGAAGCAGCAGAAAGGCCCTGG + Intronic
998997328 5:147879952-147879974 AAGTGGCAGCAGAAAGGAGGTGG + Intronic
999124084 5:149233715-149233737 ATAAAGAGGCAGAAAGGAGAAGG + Intronic
999376614 5:151091170-151091192 AAGAAGAAGCAGAAAGGAGCTGG - Intronic
999444673 5:151629846-151629868 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
999476498 5:151904319-151904341 AACAAGCAGCAGAAAGCAGTGGG - Intronic
1000046786 5:157528397-157528419 AGGAAGAGGCAGACAGAAGCAGG + Intronic
1000143858 5:158433749-158433771 GAGAAGAAAGAGAAAGGAGAGGG - Intergenic
1000302118 5:159965664-159965686 AGGAAGAAGGAGGAAGGAGGGGG + Intronic
1000388111 5:160694620-160694642 AAAATGAAACAGAAAGGAACTGG - Intronic
1000811159 5:165863653-165863675 AAGGAGAAGCAGAAGGGATCTGG - Intergenic
1000882452 5:166713917-166713939 AAGAGGAAGCAGGAAAGAGAGGG + Intergenic
1001426536 5:171626156-171626178 AAGAAGAAGAAGAAAGGTGAAGG - Intergenic
1001432168 5:171670940-171670962 AAGACTGAGCAGAAAGGAGGTGG - Intergenic
1001579661 5:172790030-172790052 AAGAAGAATCTGGAAGGAGGAGG + Intergenic
1001737807 5:174021114-174021136 AAGAAGAAGGAGAAGGAAGAAGG + Intergenic
1001737811 5:174021143-174021165 AAGAAGCAGAAGGAAGGAGAAGG + Intergenic
1002023306 5:176379787-176379809 AAGAGGAGGCAAAAAGGAACTGG - Exonic
1002042305 5:176523525-176523547 AAGAAGAAGAAGAAAAGAAGAGG - Intergenic
1002484960 5:179528898-179528920 CAGAACCAGCAGCAAGGAGCAGG - Intergenic
1002952475 6:1828340-1828362 CAGAAGAAGCAGAGAGAAGAAGG + Intronic
1002969129 6:1996116-1996138 AAGAGGAAGGAGGAAGGAGGAGG - Intronic
1002969410 6:1998413-1998435 AAGAAGAGGAAGAAAGGGACAGG + Intronic
1003138625 6:3453811-3453833 AAGTAGAAGCAGAAAGTGGAAGG - Intronic
1003358692 6:5402069-5402091 AAGAAGAATCAGAAAGAAAGTGG - Intronic
1003450782 6:6229919-6229941 AGGAAGCAGCAGAAAGGCCCTGG + Intronic
1003516275 6:6821477-6821499 GAAAAGAAAGAGAAAGGAGCTGG + Intergenic
1003603930 6:7542476-7542498 AAGTAAAAGAGGAAAGGAGCGGG + Intronic
1003831528 6:10017351-10017373 AAGAAAACGCAGCAAGGAGAGGG - Intronic
1003953711 6:11142876-11142898 AAGAAGAAGAAAGAAGGAGAGGG - Intergenic
1004266450 6:14152075-14152097 AAGAGGAAGAAGGAAGGAGGAGG - Intergenic
1004629499 6:17407845-17407867 ATGAAGAAGCAAAAGGGGGCTGG + Intronic
1005051984 6:21693293-21693315 AAGAAGGAAAAGAAAAGAGCTGG + Intergenic
1005072401 6:21874149-21874171 AGGAAGCAGCAGAAAGGCCCTGG + Intergenic
1005088499 6:22032073-22032095 AAAAAGAAGAAGAAGGAAGCGGG - Intergenic
1005191521 6:23228985-23229007 AGGAAGCAGCAGAAAGGTCCTGG - Intergenic
1005509572 6:26500432-26500454 AGGACCAAGGAGAAAGGAGCTGG - Intergenic
1005979187 6:30823371-30823393 AAGAAGAAGAAGAAATGGGCTGG - Intergenic
1005997580 6:30940756-30940778 CAGAGGAACCAGAAAGGAGCAGG - Intergenic
1006024208 6:31137158-31137180 AAGAAAAAGAAGAAAGAGGCCGG + Intronic
1006155164 6:32009815-32009837 GAGGAGATGCAGAACGGAGCCGG - Intergenic
1006161470 6:32042549-32042571 GAGGAGATGCAGAACGGAGCCGG - Exonic
1006320998 6:33319395-33319417 GAGAAGAAGCAAACAGGATCAGG - Exonic
1006508811 6:34510396-34510418 AAGAAGAGGCAGGCAGGGGCTGG - Intronic
1006617746 6:35341380-35341402 AAAGAGAAGCAGAAAGAAGGGGG + Intergenic
1006861280 6:37172933-37172955 AAAAACAAGCACAAAGAAGCTGG - Intronic
1007126500 6:39430150-39430172 GAGAAGAAGCATAAAGAAGAGGG - Intronic
1007184872 6:39961215-39961237 AATGAGAAACAGGAAGGAGCTGG - Intergenic
1007389008 6:41539076-41539098 CAGGAGAACCAGGAAGGAGCTGG + Intergenic
1007415245 6:41687820-41687842 AAAGAGAAGGAGAGAGGAGCTGG + Intronic
1007748252 6:44056484-44056506 CTGAAGAAGGAGAAAGGAGATGG + Intergenic
1007874415 6:45079460-45079482 AAGAAGAAGGGGAAAGGAGGAGG + Intronic
1007880634 6:45162232-45162254 AAGAAGAAGAAGAAAGAGCCAGG + Intronic
1008065640 6:47044919-47044941 AAGAAGAAGAAGAAAGGCCTGGG + Intergenic
1008328675 6:50218898-50218920 AAGAAAGAGAAGAAAGGGGCTGG - Intergenic
1008918931 6:56822555-56822577 AAGAACCATCAGAAAGGAGTAGG + Intronic
1008999454 6:57696759-57696781 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1009349054 6:62651941-62651963 AAGAAAAAGCAGAGAGAAGAGGG - Intergenic
1009453070 6:63824731-63824753 AGGAAGCAGCAGAAAGGCCCTGG + Intronic
1009471239 6:64030241-64030263 AAGAAGAAGTCGAAGGGAGAAGG + Intronic
1009590935 6:65670088-65670110 AAGGAGAAACAGAAAGGTGCAGG - Intronic
1009961464 6:70527764-70527786 AAGAAGGAGCAGAACGAAGAGGG - Intronic
1009968679 6:70604169-70604191 AGGAAGCAGCAGAAAGGTCCTGG + Intergenic
1010136053 6:72554642-72554664 AAAAAGAATCACACAGGAGCTGG - Intergenic
1010440667 6:75890157-75890179 AAGAGGAAGCAGAAAGGCTGAGG + Exonic
1010451789 6:76012326-76012348 AAGAAGAACCAGGAAAGAGCAGG - Intronic
1010485669 6:76410457-76410479 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1010679146 6:78779952-78779974 AAGAAGAAGTAGAAAGGAAGAGG - Intergenic
1011133248 6:84073248-84073270 AGGAAGAAGAAGAAAGGCCCTGG - Intronic
1011168532 6:84478987-84479009 AGGAAGCAGCAGAAAGGCCCTGG + Intergenic
1011568061 6:88701143-88701165 AAGAAGAAGAAGAAGGTAGATGG + Intronic
1011789838 6:90885984-90886006 AGGAAGCAGCAGAAAGGCGCTGG - Intergenic
1011798752 6:90985686-90985708 AAGAAGAAGAATAAAGGAAATGG - Intergenic
1012494379 6:99818516-99818538 AAGAAGAAGAAGAAGGGGGAGGG - Intergenic
1012581479 6:100875248-100875270 TTAAAGAAGGAGAAAGGAGCAGG + Intronic
1012754282 6:103205342-103205364 AAGAAGAAGTAGAAAGAAGTAGG - Intergenic
1013179199 6:107703907-107703929 AAGAAGAAGAAGAGAGGTGGAGG + Intergenic
1013404818 6:109833343-109833365 ATGAAGATGGAGAAAGGAGGAGG + Intergenic
1013496343 6:110701244-110701266 AAGAAAAAGAAAAATGGAGCCGG + Intronic
1013700904 6:112768239-112768261 GAGGAGAAGCAGACAGGAGGTGG - Intergenic
1013901089 6:115156670-115156692 AAGAAGCAGGAGAAAGGCACTGG - Intergenic
1014207568 6:118672785-118672807 AAGAAGGAGGAGGAAGGAGGAGG + Intronic
1014568080 6:122975774-122975796 AAATGGAAGCAGGAAGGAGCTGG - Intergenic
1014613240 6:123569661-123569683 TAGAAGGAGGAGAGAGGAGCAGG + Intronic
1014738672 6:125123930-125123952 AGGAAGCAGCAGAAAGGCCCTGG + Intronic
1015452022 6:133380928-133380950 GAGAAGAGGAAGAAAGGAGGAGG - Intronic
1015577801 6:134691157-134691179 AAGAAGAACAAGAAAAGAGGAGG + Intergenic
1015666522 6:135636112-135636134 AAGAAGAAGGAAGAAGGAGGAGG - Intergenic
1015793357 6:136986314-136986336 GAGAGGAAGCAGAGAGAAGCAGG - Intergenic
1015982757 6:138855863-138855885 AAGAAGAAAAAGAAAGGACTTGG + Intronic
1016161309 6:140883954-140883976 AAGAGGGAGGAGAAAGGAGGAGG - Intergenic
1016476636 6:144434412-144434434 AAGATGAAGGAGAGAGAAGCTGG + Intronic
1017009963 6:150056790-150056812 AATAAAAAGCAGGGAGGAGCCGG - Intergenic
1017013988 6:150085135-150085157 AAGGAGAAGCAGGAAAGAGGAGG + Intergenic
1017726895 6:157282558-157282580 GAGATGAGGCAGAGAGGAGCAGG - Intergenic
1017849723 6:158294684-158294706 AGGAAGAGGAAGAAAGGAGGAGG - Intronic
1017997405 6:159544335-159544357 AAGAAGAAACAGCAATGAGCTGG - Intergenic
1018009303 6:159655284-159655306 AAGAAGCAGCGGAAAGGCGCTGG + Intergenic
1018159185 6:161021317-161021339 CAGAAGCAGCAGGCAGGAGCAGG - Intronic
1018378105 6:163232539-163232561 AATAAGAAGCAGAGATGAGAAGG + Intronic
1018457102 6:163962377-163962399 TGGAAGATGCAGAAAGGTGCAGG + Intergenic
1018593468 6:165453377-165453399 AAGTAGAGACAGAAAGTAGCAGG + Intronic
1018623881 6:165758681-165758703 AAGAAGGAGAAGGAAGGAGAAGG + Intronic
1018803026 6:167237949-167237971 AGGAGGAAGTAGAGAGGAGCGGG + Intergenic
1018880064 6:167868922-167868944 AAGAAGAAGAAGAAATTAGCCGG - Intronic
1019030670 6:169008140-169008162 AAGCAGAGGCAGAACGAAGCAGG + Intergenic
1019484067 7:1280426-1280448 AAGAAGAAGAAGGAAGAAGGAGG + Intergenic
1019969144 7:4526137-4526159 AAGAGGAAGAAGAAAGGGGAAGG + Intergenic
1019988160 7:4673400-4673422 AAAAAGAAAAAGAAAGTAGCTGG + Intergenic
1020333804 7:7045970-7045992 GAGAAGAAGGAGAGAGGAGAAGG - Intergenic
1020577346 7:9949887-9949909 AAGAAGAAGAAGAAGGAAGAGGG + Intergenic
1020828136 7:13058019-13058041 GAGGAGAAGCAGAAAGAAGGAGG - Intergenic
1020909457 7:14110346-14110368 GAGAATAAGCAGAAAGGAGTAGG - Intergenic
1020915148 7:14184112-14184134 AGGAAGCAGCAGAAAGGCCCTGG + Intronic
1021013180 7:15497058-15497080 TAGAAGAAGAAGATATGAGCTGG + Intronic
1021252088 7:18342196-18342218 AGGAAGAATCAGAGAGGAGAGGG - Intronic
1021663738 7:22950269-22950291 AAGAAGAAGAAAAAAGGAAGAGG - Intronic
1022215234 7:28253204-28253226 AAGGAGAAGGAGAAGGAAGCAGG - Intergenic
1022551907 7:31248752-31248774 GTGAAGAAGGAGAAAGAAGCAGG - Intergenic
1022743307 7:33143859-33143881 AAGAAGATACACAAATGAGCTGG - Intronic
1022898434 7:34776955-34776977 AAGAAGGAGAAGGAAGGAGTAGG - Intronic
1023026590 7:36056396-36056418 GAGAAGAAGCAGGAGGAAGCAGG + Intergenic
1023149129 7:37183196-37183218 AAGGAGAAGGAGGAAGGAGGAGG + Intronic
1023159038 7:37279658-37279680 AGGAAGCAGCAGAAAGGTCCTGG + Intronic
1023214496 7:37847531-37847553 AAGAAGAAGGAGAAAGAAGAAGG + Intronic
1023498887 7:40827494-40827516 AATCAGAAGCAGATTGGAGCTGG - Intronic
1023596587 7:41835520-41835542 AAGAAAGAGGAGAAAGGAGAAGG - Intergenic
1023701161 7:42893096-42893118 AGGAAGCAGCAGAAAGGCCCTGG + Intergenic
1023751110 7:43373452-43373474 AAGAAAGAAAAGAAAGGAGCCGG - Intronic
1023783331 7:43679774-43679796 AAGAAGCAGCAGAAAGGAAAAGG + Intronic
1024032258 7:45471412-45471434 AAGAAGAAGAAGAAAGAAGGAGG + Intergenic
1024112910 7:46164438-46164460 ATGAAGAAGCTGGAAGGAGCTGG - Intergenic
1024545379 7:50513304-50513326 AGGAAGCAGCAGAAAGGCACTGG + Intronic
1024924471 7:54598727-54598749 GAGAAGGAGCAGAAAGGAAGAGG + Intergenic
1024999546 7:55303652-55303674 AAAAAGAAGAAGAAAGAAGAAGG + Intergenic
1025011921 7:55404301-55404323 AAGAAGAAGAAAGAAGGAGGAGG - Intronic
1025088428 7:56042352-56042374 GGAAAGAAGCAGAAGGGAGCCGG + Intronic
1025233148 7:57216410-57216432 CAGAAGACCCAGAAAGGAGCTGG + Intergenic
1025797791 7:64756172-64756194 TAGAAAAAGCAGGAAGGAGGAGG - Intergenic
1026129922 7:67611932-67611954 AGGAAGAGGCAGAAGGGAGATGG - Intergenic
1026154131 7:67812497-67812519 GAGAAGCAGCAGCTAGGAGCAGG - Intergenic
1026205741 7:68255663-68255685 AAAGAAAAGGAGAAAGGAGCAGG - Intergenic
1026251047 7:68670974-68670996 TAGAATAAGAAGAAAGGAGATGG - Intergenic
1026306447 7:69146334-69146356 AAGAAGAGGGAGGAAGGAGGAGG - Intergenic
1026328681 7:69333343-69333365 AAGCAGAAGTAGAAAGGATCGGG + Intergenic
1026349675 7:69504686-69504708 AAGAAGAAGAAGAAAGGAAGAGG + Intergenic
1026381227 7:69801298-69801320 AAAAATAAACAGAAAGGAGATGG + Intronic
1026628979 7:72021333-72021355 AAGAAGAAGGAGAAACGCCCAGG + Intronic
1026950309 7:74342391-74342413 AAAAAGAAACTGAAAAGAGCAGG + Intronic
1026988233 7:74568351-74568373 AAAAAGAAGGAGAAAGGGCCGGG + Intronic
1026988279 7:74568664-74568686 AAGAAGAAAAAGAAAGAAACAGG + Intronic
1027165246 7:75829632-75829654 AAAAAAAAGCAAAAATGAGCTGG - Intergenic
1027165892 7:75834104-75834126 AAAAAAAAGCAAAAATGAGCTGG + Intergenic
1027350549 7:77306853-77306875 AGGAAGTAGCAGAAAGGCACTGG - Intronic
1027615129 7:80413394-80413416 AAGAAGAAACAGACAGAAGGAGG - Intronic
1027821540 7:83051756-83051778 AAGAAGAAGAAGAAAGTTGAAGG + Intronic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1028199526 7:87944890-87944912 AAGAAGAAGAAGGAAGGAGGAGG - Intronic
1028629172 7:92914904-92914926 AAGAAGAATCAAAGAGGAGCTGG + Intergenic
1028662673 7:93298433-93298455 AAATGGAAGCACAAAGGAGCCGG + Intronic
1029186701 7:98744230-98744252 AGGAGGAAGCAGAAAGGTTCAGG - Intergenic
1029261360 7:99304888-99304910 AAGAAGAAATTGAAAGGACCAGG + Intergenic
1029520253 7:101056309-101056331 AAGGAGAAGAAGAAAGTCGCAGG - Intronic
1029677086 7:102077236-102077258 AAGCAGCAGCAGGGAGGAGCTGG + Intronic
1029731762 7:102443081-102443103 AAGAAGAAGAAGAAAAGAGAAGG - Intronic
1029977512 7:104848648-104848670 AAGGAGAAGGGGAAAGGAGGAGG + Intronic
1030175524 7:106649621-106649643 AAGAAGAAGAAAAAAAGAGGAGG + Intergenic
1030935891 7:115584876-115584898 AGGAAGTAGCAGAAAGGCCCTGG + Intergenic
1031424932 7:121594091-121594113 AGGAAGAAGCAGGAATGAGCGGG + Intergenic
1031618574 7:123908916-123908938 AAGAAGAAGAAGAAGGAAGAAGG + Intergenic
1031642801 7:124186163-124186185 AAGAAGAAGAAGAAAAGAAAAGG + Intergenic
1031694935 7:124839010-124839032 AAGAAAAAGAAGAAAGTTGCAGG + Intronic
1031838616 7:126709482-126709504 AAGAAGAAGGAGGAGGGAGGAGG + Intronic
1031906714 7:127467950-127467972 AAGAGGAAGGAGAGAGGAGAGGG + Intergenic
1032021743 7:128410257-128410279 AACCAGAAGAGGAAAGGAGCTGG + Intergenic
1032523391 7:132562461-132562483 AAGGAGGAGGAGAAAGGAGGAGG - Intronic
1032572845 7:133019257-133019279 AAGAAAAAGCAGAAAAAAGGAGG - Intronic
1032605491 7:133346319-133346341 ATGGAGAAGCAGACAGAAGCAGG - Intronic
1032849929 7:135785321-135785343 AAGAAGAAGAAAGAAGGAGTAGG + Intergenic
1032954247 7:136951900-136951922 AAGAAGAGAGAGAAAAGAGCAGG - Intronic
1033062048 7:138118845-138118867 AAGAAAAAGAAGGAGGGAGCCGG + Intergenic
1033218621 7:139512782-139512804 TAGAAGAAGCAGAAAGGGCTGGG - Intergenic
1033278222 7:139988503-139988525 AAGATGCAGAAGCAAGGAGCTGG - Intronic
1033282301 7:140014916-140014938 AAGAAGAAGAAGAAAGAAGGAGG + Intronic
1033282302 7:140014919-140014941 AAGAAGAAGAAAGAAGGAGGAGG + Intronic
1033318189 7:140315848-140315870 AAGAATAAACAGAAAAGAGTGGG + Intronic
1033324205 7:140363755-140363777 AAAAAAAAAAAGAAAGGAGCGGG + Intronic
1033331467 7:140420447-140420469 AAGAAGGAGCAGAAGGAGGCAGG + Intronic
1033431137 7:141290730-141290752 AAGGAGAGGCCGAAAGGGGCAGG - Intronic
1033541422 7:142359254-142359276 AAAAAAAAACAGAAAGCAGCTGG + Intergenic
1033544422 7:142386975-142386997 AGAAAAAAGCAGAAAGCAGCTGG + Intergenic
1033636678 7:143218402-143218424 GACAAGAAGGAGAAAGGAGAAGG - Intergenic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1033832588 7:145271475-145271497 AAGAAAAAGAAGGAAGGAGAAGG + Intergenic
1033832620 7:145271698-145271720 AAGAATAAGCAGGAAGAAGGAGG + Intergenic
1033838635 7:145346780-145346802 AAGGGGAAGCAGAAAGAATCAGG - Intergenic
1034043722 7:147906058-147906080 GAGAAGAAGCATGACGGAGCTGG + Intronic
1034251555 7:149695541-149695563 AAGAAGAAGAAGAAAGGCAAAGG + Intergenic
1034944920 7:155255652-155255674 AAGAAGAAGGGGAAAGGGGAAGG + Intergenic
1034978913 7:155463445-155463467 AAGAAGAAGAAAGGAGGAGCAGG - Exonic
1035592099 8:824064-824086 AAGAAGAAGGAAAAAGGAAGAGG - Intergenic
1035780995 8:2228477-2228499 CAGAAGAAGGTGGAAGGAGCTGG + Intergenic
1035919818 8:3664673-3664695 ATCAAGAAGCTGAAAAGAGCTGG + Intronic
1036053300 8:5224450-5224472 AAGAGGAAGGACAAAGGAGGAGG + Intergenic
1036402189 8:8418778-8418800 AAGAAGAAACAGACAGGATTTGG - Intergenic
1036543765 8:9746462-9746484 GAGAAGAACTATAAAGGAGCAGG - Intronic
1036988347 8:13563100-13563122 ATGAAAAAGTAAAAAGGAGCAGG - Intergenic
1037277718 8:17199660-17199682 AAGAAGAAGAAGGAGGGAGGAGG - Intronic
1037277727 8:17199745-17199767 AAAAAGAAGAAGAAAGAAGAAGG - Intronic
1037443549 8:18942021-18942043 AAGACGAAGCAGAAAGCTACAGG + Intronic
1037645756 8:20791335-20791357 GAGAAGAAGCAAAAAGCAGCAGG + Intergenic
1037748588 8:21665274-21665296 TAGAAGAAGGTGGAAGGAGCAGG + Intergenic
1037809037 8:22075310-22075332 AAGAAGAAGAAGAAGGGGGAGGG - Intronic
1037902601 8:22696243-22696265 AAGAACTAGTAGAAAGGAGAGGG - Intergenic
1037951017 8:23018863-23018885 GAGAAGAGGGAGAATGGAGCAGG + Intronic
1037965975 8:23134562-23134584 AAGAAGAGGGAGAATGGAGAAGG + Intergenic
1038018163 8:23532168-23532190 AAGAAGACACAGGAAGCAGCAGG - Intronic
1038070657 8:24008998-24009020 AAGAAGCAGGGGAAATGAGCAGG - Intergenic
1038367308 8:26948911-26948933 AGGAAGTAGCAGGAAGGTGCTGG - Intergenic
1038447416 8:27613512-27613534 TTGAAGAAGCAGATAGGAGCCGG - Intronic
1038695337 8:29801534-29801556 AAGAAGAAGAAGAAAAAAGGAGG + Intergenic
1038794841 8:30700760-30700782 AAGAATAAGCAGAGAGGAAAGGG - Intronic
1039252219 8:35679294-35679316 AAGAAAAAGCAGGAAGGGGTGGG + Intronic
1039317329 8:36387885-36387907 AAGAAGAAGAGGAAAGAAGGAGG - Intergenic
1039485217 8:37904542-37904564 ATGGAGGAGCAGAAAGGGGCTGG + Intergenic
1039714513 8:40093041-40093063 AAAAACAAAAAGAAAGGAGCAGG + Intergenic
1039805491 8:40994224-40994246 AAGAAGAAGAAGAAGGAACCGGG - Intergenic
1039806198 8:41001792-41001814 AAGAAGAAGAAGGAAGAAGGAGG - Intergenic
1039806199 8:41001795-41001817 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1039889566 8:41674843-41674865 AAGAACAAGGAGGAAGGAGTGGG + Intronic
1040425627 8:47282842-47282864 AAGAAAAAGAAAAAAGAAGCTGG - Intronic
1040533369 8:48283722-48283744 AAGAAGAAGCAGGAGGGAATGGG + Intergenic
1040627864 8:49172579-49172601 AAAAGGAAGCAGAAGGAAGCTGG - Intergenic
1040711629 8:50195606-50195628 AGGAAGAAGCAGAAAGGCCCTGG - Intronic
1041047606 8:53902175-53902197 AAAAAGAAGCAAAAATTAGCTGG - Intronic
1041170608 8:55138371-55138393 AAGAGGAAAGAGAGAGGAGCTGG + Intronic
1041253610 8:55959267-55959289 AAGAAGATGTAGAAATGACCAGG - Intronic
1041319160 8:56595784-56595806 AAAAAGAATCAGAAAGAAACTGG - Intergenic
1041407498 8:57516226-57516248 AAGAAAATGCAGAAATGAGAAGG - Intergenic
1041799951 8:61787903-61787925 AAAAATAAGCATAAAGGACCAGG - Intergenic
1042122969 8:65507883-65507905 AGGAAGCAGCAGAAAGGTCCTGG - Intergenic
1042264598 8:66895372-66895394 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1042304226 8:67314434-67314456 AGGAAGCAGCAGAAAGGCCCTGG - Intronic
1042505308 8:69553175-69553197 GAGAAAAAGCAGAAAGCAGATGG + Intronic
1042709984 8:71706760-71706782 AAGAAAAGGCAGAAAGAGGCTGG + Intergenic
1042852747 8:73233101-73233123 AAGAAGAAGGAGGAAGGAGAAGG - Intergenic
1042938622 8:74085575-74085597 TTGGAAAAGCAGAAAGGAGCTGG - Intergenic
1042949801 8:74189208-74189230 AAAAAGAAGAAGAAAGAAGGGGG - Intergenic
1043543032 8:81283762-81283784 AAGTAGACTCAGAAAGGAGAAGG + Intronic
1044673377 8:94705462-94705484 AATAAGAAGCAATAAGGAGCCGG - Intronic
1044905940 8:97003085-97003107 AATAGGAAACAGAAAGAAGCAGG - Intronic
1044964502 8:97562110-97562132 AGGAAGGAGGAGAAAGGAGAAGG + Intergenic
1045054499 8:98357697-98357719 AGGAGGAAGCAGAAAGGAGAAGG - Intergenic
1045326589 8:101121949-101121971 AATAAGAAGGAGAAATGAGCTGG - Intergenic
1045497191 8:102718654-102718676 AAGAAGAAATACAAGGGAGCTGG + Intergenic
1045895369 8:107209815-107209837 AAAAGGAAGCAGAAAGCAGGGGG - Intergenic
1046101726 8:109622008-109622030 ATGAAGAGGAAGAAAGGAGGAGG - Intronic
1046266371 8:111836535-111836557 AATAAGCAACAGAAAAGAGCTGG - Intergenic
1046525714 8:115380001-115380023 GAGAAGAAGGAGGAAGGAGGAGG + Intergenic
1046699962 8:117389072-117389094 AAGAAGGAGGAAAGAGGAGCAGG + Intergenic
1046739588 8:117814025-117814047 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1046930417 8:119836409-119836431 TATAAGAAGGAGAAAGGAGAAGG + Intronic
1047028197 8:120847593-120847615 ATGAAGACACAGAAAGAAGCTGG + Intergenic
1047130854 8:122017960-122017982 AGGAAGCAGCAGAAAGGCCCTGG - Intergenic
1047345132 8:124020424-124020446 AAGATGAAGCAGACAGTGGCAGG + Intronic
1047349253 8:124057750-124057772 AAGAGGCAGGAGAAATGAGCTGG - Intronic
1047402330 8:124557504-124557526 GGGGAGAAGCAGAAAGCAGCCGG - Intronic
1047692749 8:127373032-127373054 TAGAAGAGCCAGCAAGGAGCAGG + Intergenic
1047874991 8:129126296-129126318 AAGAAGAAGAAGAAAAAAGAAGG + Intergenic
1048210203 8:132448544-132448566 AAGAAAAAGTAAAAAGGAGGAGG + Intronic
1048234310 8:132675212-132675234 AGGAAGAGGCAGAAAGGCACTGG - Intronic
1048516562 8:135116765-135116787 GAGAAGAAGGAGAAAGGAGCCGG - Intergenic
1048531580 8:135254850-135254872 CAGAAGCAGCAGAGAGGAGAAGG + Intergenic
1048695122 8:137019178-137019200 GAGCAGAAGCAGAAAGCAACAGG + Intergenic
1048772069 8:137905685-137905707 AAGAAAAAGCAGCAGAGAGCAGG + Intergenic
1048963814 8:139600700-139600722 AAGGAGCAGCAAAAAGGGGCAGG + Intergenic
1049294410 8:141823545-141823567 AAGATGAGGCCGTAAGGAGCTGG - Intergenic
1049346332 8:142141076-142141098 AAGAGGAAGCAGGAGGGAGAAGG - Intergenic
1050266062 9:3891080-3891102 AAGAAGAAGAAGAAAGTAGGAGG + Intronic
1050445890 9:5722182-5722204 AAGAAGAAGATGAAATGGGCTGG - Intronic
1050475909 9:6040919-6040941 AAGATGAAGAAGTAAGGAGGAGG - Intergenic
1050475917 9:6040967-6040989 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1050502582 9:6314780-6314802 AAGAAGCAGCAGAAAGGCCCTGG + Intergenic
1050592093 9:7171487-7171509 AAAAAGGAAAAGAAAGGAGCGGG - Intergenic
1050836078 9:10080252-10080274 AAGGAAAATCAGACAGGAGCAGG + Intronic
1050942169 9:11473144-11473166 AAGAAGCAGAAGAAAGAAGAAGG + Intergenic
1050942172 9:11473187-11473209 AAGAAGAAGAAGAAAGTAGAAGG + Intergenic
1050992948 9:12174980-12175002 GAGGAAAAGGAGAAAGGAGCAGG + Intergenic
1051121193 9:13754076-13754098 AGGGAGGAGCAGAAAGGACCAGG + Intergenic
1051247516 9:15126692-15126714 AGGAAGAAGAAGGAAGGAGAAGG + Intergenic
1051362584 9:16294420-16294442 AGGAAGCAGCAGAAAGGCCCTGG + Intergenic
1051427752 9:16950828-16950850 AGTAAGAAGCAGAAACAAGCTGG - Intergenic
1051517608 9:17948253-17948275 AAGAACATGCAGAGAGGAGTTGG - Intergenic
1051520224 9:17979257-17979279 GAAAAGAAAGAGAAAGGAGCAGG - Intergenic
1051562891 9:18462640-18462662 TAGAAGAAGGAAAAAGGGGCCGG + Intergenic
1051705608 9:19876898-19876920 AAAATGAAGCAGAAAACAGCTGG - Intergenic
1051778550 9:20662553-20662575 GAGAGGAAGCAGAATTGAGCAGG - Intronic
1051848871 9:21485809-21485831 AAGAACACCCAGAAAGGAGCAGG - Intergenic
1052235274 9:26205794-26205816 AAAAAGAAGAAGAAAGTAGTTGG - Intergenic
1052381523 9:27776021-27776043 AAGAAGAATCAGACAGGTGAAGG - Intergenic
1052537045 9:29761114-29761136 AAAAAGCAGCAGAAAGGCCCTGG + Intergenic
1052731565 9:32291726-32291748 AGGAAGCAGCAGAAAGGCCCTGG - Intergenic
1052865463 9:33462322-33462344 AAGAAGACTAAGAAAGGAGTGGG + Exonic
1052882223 9:33608747-33608769 AAGTAGAGGCAGAAAAAAGCTGG - Intergenic
1052986583 9:34492311-34492333 CAGAGGAAGCAGCAAGGATCTGG - Intronic
1053242464 9:36507224-36507246 AAGAAGAAGAAGAAATGCCCTGG - Intergenic
1053263604 9:36693995-36694017 GAGAAGGAGGAGAAAGGAGGAGG - Intergenic
1053332337 9:37224864-37224886 AAGAATAACTGGAAAGGAGCAGG + Intronic
1053485724 9:38454622-38454644 AAGTGGAAGCAGAATGGGGCTGG - Intergenic
1053504048 9:38625560-38625582 AAGAAGAGGCAGAAAGAGGATGG - Intergenic
1054453033 9:65413389-65413411 AGGAGGAAGGAGAAAGGAGCAGG - Intergenic
1054453591 9:65417524-65417546 AAGAAGAAACAAAGAGGAGCAGG - Intergenic
1054850689 9:69843636-69843658 AAGAAGAAGAAAGAAGGAGGAGG - Intronic
1054850690 9:69843639-69843661 AAAAAGAAGAAGAAAGAAGGAGG - Intronic
1054870840 9:70045842-70045864 AGGAAGAAACAGGAAGGAACTGG + Intronic
1055254980 9:74358668-74358690 AAGAAGAAGGACATAGGGGCAGG - Intergenic
1055347079 9:75350502-75350524 AGGAAGCAGCAGAAAGGCTCTGG - Intergenic
1055383952 9:75740983-75741005 TAGAAGAAGCATAAAGCTGCCGG + Intergenic
1055522703 9:77097685-77097707 AAGAATATACAGAAAAGAGCTGG + Intergenic
1055671156 9:78607473-78607495 AAGAACAAGCGGCAAGGAGATGG - Intergenic
1055905912 9:81292938-81292960 AGGAAGAAGCAGAAAGGCCCTGG - Intergenic
1056322834 9:85452543-85452565 AGGAAGCAGCAGAAAGGCCCTGG - Intergenic
1056328016 9:85497166-85497188 AAGAAGAAGAAGAAAGGAGCGGG + Intergenic
1056630904 9:88292332-88292354 AAGAAGAAGGGGATAGGAACGGG - Intergenic
1056697627 9:88873345-88873367 AAGAAGAAGAAGGAAGAAGAAGG + Intergenic
1056711379 9:88994514-88994536 AAGCAGCAGCAGAATGGAGAAGG + Exonic
1057056371 9:91964465-91964487 CAGAAAAAGCAGAATGGAGGTGG - Intergenic
1057509863 9:95669317-95669339 AAGAAAACTCAGAAAGGAGTGGG + Intergenic
1057800466 9:98188049-98188071 GAGAAGAGGAAGAGAGGAGCAGG - Intronic
1058268980 9:102945346-102945368 CAGAAGGAGAAGAAAGGAGCAGG - Intergenic
1058298104 9:103334338-103334360 AAGAAGTAGAAGAAAGGAATTGG - Intergenic
1058353884 9:104059457-104059479 AAGAAGAAGAAGGCAGCAGCTGG + Intergenic
1058432470 9:104930865-104930887 GAGAAGAAGGAGAGAGGAGATGG - Intergenic
1058444572 9:105043418-105043440 AAGAGGAAGAAAAAAGGAGGAGG + Intergenic
1058561436 9:106233145-106233167 AAGAAGGAGGAGAAAGGAGGAGG - Intergenic
1058561441 9:106233168-106233190 AAGAAGGAGGAGAAAGGAGAAGG - Intergenic
1059540892 9:115129145-115129167 AAGAAGAGGAAGAAAGGAAAGGG + Intergenic
1059710875 9:116866580-116866602 AAGAAGAAACAGAAAGTAAGAGG + Intronic
1059785693 9:117580792-117580814 ATGAAGAAGAAGAAAAGAGGAGG - Intergenic
1059938908 9:119338731-119338753 AAGAAGAAGAAGAAATTAGCCGG + Intronic
1059951859 9:119472937-119472959 AAGAAAATACAGAAAGCAGCTGG + Intergenic
1060115284 9:120935509-120935531 AAGGAGAAGCAGGACTGAGCAGG - Intergenic
1060153196 9:121301655-121301677 AAGAAAGAAAAGAAAGGAGCAGG + Intronic
1060237264 9:121873633-121873655 AAGAAGAAGAAGAGAGGAGGAGG - Intronic
1060237265 9:121873636-121873658 AAGAAGAAGAAGAAGAGAGGAGG - Intronic
1060603086 9:124890857-124890879 AAGAAGAAGAAGTAATGACCAGG + Intronic
1060619271 9:125048561-125048583 AAGAAGAAGAAGAAAAGGGCAGG + Intronic
1060623598 9:125090475-125090497 AAGAAGGAGAAGGAAGGGGCAGG + Intronic
1060736779 9:126071180-126071202 AAGAGGTAGCTGGAAGGAGCTGG - Intergenic
1060769811 9:126324561-126324583 AAGAAGAAGAAGGAAGGAGAAGG + Intergenic
1060805513 9:126573465-126573487 AAGAAGAAGAAGTAAGGTGCAGG - Intergenic
1060830263 9:126709346-126709368 CAGGAGAAGCAGGAAGGAGCAGG + Intergenic
1061061222 9:128251259-128251281 AGCAAGAAGAAGAAAGGAGGAGG - Intronic
1061290050 9:129645551-129645573 AAAAAGAAAAAGAAGGGAGCGGG - Intergenic
1061537259 9:131257886-131257908 CAGAAGCAGCTGGAAGGAGCAGG + Intergenic
1062368241 9:136222362-136222384 GAGCAGAACCAGACAGGAGCAGG - Intronic
1062573872 9:137197691-137197713 AGGGAGAGGCAGACAGGAGCTGG + Intronic
1062638351 9:137503383-137503405 AAAAAGAAGAAGGAAGGAGGAGG + Intronic
1062638472 9:137504051-137504073 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1062638474 9:137504074-137504096 AAGAAGAAGAAGGAAGAAGAAGG + Intronic
1203756122 Un_GL000218v1:128586-128608 AAGAAGAAGCAGGAAGCTGGGGG - Intergenic
1203473505 Un_GL000220v1:130184-130206 AAGAAGAAGAAAAAAAGAACGGG - Intergenic
1203572686 Un_KI270744v1:146580-146602 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1203649738 Un_KI270751v1:104834-104856 AAGAAGAAGCAGGAAGCTGGGGG - Intergenic
1185535686 X:860005-860027 AAGAAGAAGAAGAAAAGGCCGGG - Intergenic
1185603532 X:1354773-1354795 AAGAAGAGGAAGAAAGGAGGAGG + Intronic
1185617549 X:1432531-1432553 AAGAAAAGGGAGAAAGGGGCCGG + Intronic
1185830196 X:3294303-3294325 AAGGAGAAGGAGAAAGAAGGAGG - Intergenic
1185913792 X:4011645-4011667 AAGGAGGAGCAGGAAGGAGAAGG - Intergenic
1186034470 X:5406137-5406159 AAGATGAAGGAGGAAGGAGAAGG + Intergenic
1186174077 X:6906880-6906902 GCCAAGAAGCAGGAAGGAGCTGG - Intergenic
1186312920 X:8339779-8339801 AAGAAGAAAAAGAAAGAAGAGGG + Intergenic
1186374212 X:8981017-8981039 AAGAAGTTGCAGAAGGCAGCAGG - Intergenic
1186408148 X:9321797-9321819 AAGAAGAAGAAGGAAAGGGCAGG + Intergenic
1186424837 X:9455694-9455716 AAAGAGAAGGAGAAAGGAGGAGG - Intergenic
1186471165 X:9823094-9823116 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1186471172 X:9823126-9823148 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1186471175 X:9823139-9823161 AAGAAGAAGGAAGAAGGAGAAGG - Intronic
1186550981 X:10505379-10505401 ATGAAGAAGCAGAATGGAAGGGG + Intronic
1186619526 X:11224180-11224202 AAGATGAAGAAGAAAGAAGAAGG + Intronic
1186619530 X:11224242-11224264 AAGATGAAGAAGAAAGAAGAAGG + Intronic
1186775208 X:12857652-12857674 AAAAAGAAGAAGAAAGGATTGGG + Intergenic
1186835027 X:13429033-13429055 AAGAAGAAGAAGAAAGAAAAGGG - Intergenic
1186900216 X:14046474-14046496 AACAAGAAGCAGATAGCAACAGG + Intergenic
1187025682 X:15433649-15433671 AAGAGGAAGGAGAAAGAAGGAGG + Intronic
1187025777 X:15434074-15434096 AGGAGGAAGGAGAAAGGAGGAGG + Intronic
1187025794 X:15434156-15434178 AAGAAGGAGGAGAAAGAAGAAGG + Intronic
1187025802 X:15434217-15434239 AAGAAGAAGGAGATAGAAGAAGG + Intronic
1187211414 X:17236108-17236130 AAGAAAAAGAAGAAAGGAGGAGG - Intergenic
1187285748 X:17901872-17901894 AAGAAGAAGAAGAAAAGAAGAGG + Intergenic
1187417902 X:19109045-19109067 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1187681321 X:21770544-21770566 AGGAAGCAGCAGAAAGGCCCTGG + Intergenic
1187705543 X:22006106-22006128 TAGGAGAACCAGGAAGGAGCTGG - Intergenic
1187748286 X:22433167-22433189 AGGAAGCAGCAGAAAGGCCCTGG + Intergenic
1187773713 X:22731002-22731024 AAGAAGCAGCAGAAAGGACCTGG - Intergenic
1188464788 X:30467574-30467596 AAAAAAAAGGAGAAATGAGCAGG - Intergenic
1188602215 X:31981591-31981613 AAGAAGAACCAGAAAGACGAAGG + Intronic
1188738083 X:33742453-33742475 AGGAAGCAGCAGAAAGGCCCTGG - Intergenic
1188831001 X:34896653-34896675 AAGAAGAAGAAGAAAAGAAAAGG - Intergenic
1189218065 X:39344550-39344572 AGGAAGCAGCAGAAAGGCCCTGG + Intergenic
1189363885 X:40373549-40373571 AAGGAGAGGCAGACAGGAGAGGG + Intergenic
1189422794 X:40871557-40871579 AAGACGAAGGGAAAAGGAGCAGG - Intergenic
1189551621 X:42099417-42099439 GAGAAGAAGGAGAAAGGAGGAGG - Intergenic
1189650840 X:43187938-43187960 AAGAAGAAGTAGAAGGGGGCAGG + Intergenic
1189839397 X:45057298-45057320 AAGTAAAAGGAGAAAAGAGCTGG - Intronic
1190047480 X:47124281-47124303 AAGAAGAAAGAGAAAGAGGCCGG + Intergenic
1190054416 X:47173530-47173552 AGGAAGGAGAAGAAAGGAGAGGG - Intronic
1190136304 X:47802244-47802266 AAGGAGGAACAGACAGGAGCAGG + Intergenic
1190283719 X:48948393-48948415 AGGCAGAAAGAGAAAGGAGCTGG + Intronic
1190448826 X:50557579-50557601 AGGAAGCAGCAGAAAGGCCCCGG + Intergenic
1190889871 X:54558634-54558656 AAGAAGATGCAGAAACGTGCAGG + Exonic
1190895574 X:54614584-54614606 AGGAAGCAGCAGAAAGGCCCGGG - Intergenic
1190913434 X:54792195-54792217 GAGAAGAAGAGGAAAGGAGAGGG + Intronic
1191067704 X:56367639-56367661 AAGAAGAATCAAAAAGGCCCTGG - Intergenic
1191080546 X:56505596-56505618 AGGAAGCAGCAGAAAGGCCCTGG + Intergenic
1191112213 X:56812793-56812815 AAGAAGAAGAAGAAAGAAAGAGG - Intergenic
1191151905 X:57228307-57228329 AGGAAGTAGCAGAAAGGCACTGG - Intergenic
1191197258 X:57737470-57737492 AAGAAGGAGGAGAAGAGAGCAGG + Intergenic
1191821800 X:65318383-65318405 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1191965338 X:66751298-66751320 AGGAAGAAGCAGAAAGGCCCTGG - Intergenic
1192185166 X:68941753-68941775 GAGAAGGAGGAGAAAGGAGGAGG + Intergenic
1192185179 X:68941824-68941846 GAGAAGGAGGAGAAAGGAGGAGG + Intergenic
1192272041 X:69589907-69589929 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1192314517 X:70041604-70041626 AAGAAAGGGCAGAAAAGAGCTGG + Exonic
1192474600 X:71429277-71429299 AAAAAAAAGCAGAAGGAAGCAGG + Intronic
1192784970 X:74326292-74326314 GATAAGAAACAGAAAGGGGCTGG - Intergenic
1192924219 X:75738510-75738532 AAGGATAAGGAGAAAGGAGAAGG - Intergenic
1192995239 X:76505951-76505973 AAGGAGCAGCAGAAAGGTCCTGG - Intergenic
1193062668 X:77223016-77223038 AGGAAGCAGCAGAAAGGCCCTGG + Intergenic
1193101751 X:77622451-77622473 AGGAAGTAGCAGAAAGGCACTGG + Intronic
1193102974 X:77636788-77636810 AAGAAGAAGGAGAAGGAAGAAGG + Intronic
1193103000 X:77636897-77636919 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1193103010 X:77636941-77636963 AGGAAGAAGGAGGAAGGAGGAGG + Intronic
1193103015 X:77636978-77637000 AGGAAGAAGAAGGAAGGAGGAGG + Intronic
1193103024 X:77637018-77637040 AGGAAGAAGAAGGAAGGAGGAGG + Intronic
1193253484 X:79319975-79319997 AAGAAGCAGCAGAAAGGCCCTGG - Intergenic
1193275333 X:79579841-79579863 CAGAAGAAAGAGAAAGAAGCAGG - Intergenic
1193438235 X:81506649-81506671 AAGTAGAAGGAAAAAGGAGGTGG + Intergenic
1193779738 X:85686724-85686746 AGGAAGGAGCAGAAAGGTCCTGG - Intergenic
1193851804 X:86546312-86546334 AAGAAGAAGAAGAAAGAGGTAGG - Intronic
1194207853 X:91033043-91033065 AGGAAGGGGCAGAGAGGAGCAGG - Intergenic
1194448556 X:94015185-94015207 AAGAAGCTGCAGAAAGTAGAAGG - Intergenic
1194739324 X:97553687-97553709 AAGAAGAAGAAGAAAATGGCTGG + Intronic
1195310161 X:103624776-103624798 AAGCAGAAACAGAAAAGAGGAGG + Intronic
1195369718 X:104161551-104161573 AAAAAGAAGAAGAAAGAGGCTGG + Intergenic
1196256860 X:113530114-113530136 AAGAAGAAGAAGAAAAGAAAAGG - Intergenic
1196340588 X:114591322-114591344 TTGAAAAAGCAGAAATGAGCTGG + Intronic
1196411784 X:115427512-115427534 AGGAAGAAGAGGAAAGGAGTAGG + Intergenic
1196464733 X:115960388-115960410 AGGAAGCAGCAGAAAGGCCCTGG + Intergenic
1197132298 X:123019642-123019664 AGGAAGCAGCAGAAAGGCCCTGG + Intergenic
1197177838 X:123503867-123503889 AAGAGTAAGCATAAATGAGCAGG + Intergenic
1197433305 X:126393528-126393550 CAGAAGAAGGAGGAAGGAGGAGG + Intergenic
1197645766 X:129015124-129015146 CAGAAGAAGCAGCAAGAAGATGG - Intergenic
1197730329 X:129804303-129804325 AAAAAGAAGCAGACAGGAGAGGG + Exonic
1197779360 X:130144158-130144180 AAGAAGAAGAAGAAAGTAAGAGG - Intronic
1197904823 X:131413424-131413446 AAGAAGAAGAAGAAAGAAAAGGG + Intergenic
1197953602 X:131923390-131923412 AGGAAGCAGCAGAAAGGCCCTGG + Intergenic
1197995559 X:132368700-132368722 AGGATGGAGCAGAAAGGAGAAGG + Intergenic
1197998433 X:132406009-132406031 AAGAATATGGATAAAGGAGCAGG - Intronic
1198101432 X:133425523-133425545 AAGAAGACCCAGCAGGGAGCAGG + Intergenic
1198133979 X:133728344-133728366 AAGGAGAAGGAGAAAGGAGGAGG + Intronic
1198242483 X:134799316-134799338 AAGAAAAAGCTGAAAGCAGCAGG + Intronic
1198431121 X:136567234-136567256 AGGAAGAAGAAGAATTGAGCAGG - Intergenic
1198708964 X:139480563-139480585 AAAAACAAACAGAAAGGAGGAGG - Intergenic
1198843140 X:140880538-140880560 AGGAAGTAGCAGAAAGGCCCTGG + Intergenic
1199434864 X:147802096-147802118 AAGAAGAATCAGAAAACATCAGG - Intergenic
1199668418 X:150120761-150120783 AGGAAGCAGCAGAAAGGCCCTGG + Intergenic
1199721260 X:150544187-150544209 AAAGAGAAGCAGAAAGAATCTGG + Intergenic
1199751538 X:150824078-150824100 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1199751568 X:150824223-150824245 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1199751596 X:150824546-150824568 AGGAAGAAGAAGAAAGAAGGAGG + Intronic
1199751597 X:150824549-150824571 AAGAAGAAGAAAGAAGGAGGAGG + Intronic
1200118686 X:153780566-153780588 TAGAAGAAGCAGGAAGTGGCTGG + Intronic
1200414201 Y:2890819-2890841 AAGAAGAAGAAGAAAGAAAGAGG + Intronic
1200916491 Y:8575778-8575800 GAGAAGAAGCAGACATGTGCTGG - Intergenic
1201461673 Y:14232559-14232581 AAGCAGAAGAAGGAAGGAGGAGG - Intergenic
1201461753 Y:14233089-14233111 AAGAAGAAGAAGAAAAGAAGAGG - Intergenic
1201474283 Y:14364080-14364102 AAGGAGGAGAAGAAAGGGGCAGG + Intergenic
1201498589 Y:14617266-14617288 AAGAAGAAGAAGAAAAAAGCAGG - Intronic
1202175062 Y:22090752-22090774 AAGAAGAAGAAAAAAAAAGCTGG + Intronic
1202216300 Y:22495631-22495653 AAGAAGAAGAAAAAAAAAGCTGG - Intronic
1202326886 Y:23700433-23700455 AAGAAGAAGAAAAAAAAAGCTGG + Intergenic
1202543883 Y:25969619-25969641 AAGAAGAAGAAAAAAAAAGCTGG - Intergenic