ID: 999377807

View in Genome Browser
Species Human (GRCh38)
Location 5:151098980-151099002
Sequence CAGTTAAGGTAGTTGCATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999377807_999377811 12 Left 999377807 5:151098980-151099002 CCAGAATGCAACTACCTTAACTG No data
Right 999377811 5:151099015-151099037 AAAATGCATGCTGAGGCATTAGG No data
999377807_999377812 13 Left 999377807 5:151098980-151099002 CCAGAATGCAACTACCTTAACTG No data
Right 999377812 5:151099016-151099038 AAATGCATGCTGAGGCATTAGGG No data
999377807_999377810 5 Left 999377807 5:151098980-151099002 CCAGAATGCAACTACCTTAACTG No data
Right 999377810 5:151099008-151099030 TATGTGGAAAATGCATGCTGAGG No data
999377807_999377813 16 Left 999377807 5:151098980-151099002 CCAGAATGCAACTACCTTAACTG No data
Right 999377813 5:151099019-151099041 TGCATGCTGAGGCATTAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999377807 Original CRISPR CAGTTAAGGTAGTTGCATTC TGG (reversed) Intergenic
No off target data available for this crispr