ID: 999380357

View in Genome Browser
Species Human (GRCh38)
Location 5:151117161-151117183
Sequence CAGGGGCATCGTGAGGAGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 330}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999380357 Original CRISPR CAGGGGCATCGTGAGGAGGG AGG (reversed) Exonic
900180669 1:1309648-1309670 CAGGGTGACCGTCAGGAGGGTGG - Intronic
900400319 1:2470362-2470384 CAGGGCCAGCTTGAGCAGGGAGG + Intronic
900564213 1:3324414-3324436 CAGGAGCATCGCGGGGAGTGTGG - Intronic
900667406 1:3824834-3824856 CAGTGGCACCGTGGGAAGGGAGG + Intronic
900667413 1:3824857-3824879 CAGTGGCACCGTGGGAAGGGCGG + Intronic
900944619 1:5822835-5822857 CAGAAGCATGGTGAGGACGGAGG - Intergenic
901536066 1:9883667-9883689 CAGGAGGACCATGAGGAGGGAGG - Intronic
901670552 1:10853684-10853706 CAGGGCCATGGTGATGATGGTGG - Intergenic
901744547 1:11363795-11363817 CAGGGACTTCCTGAGAAGGGCGG + Intergenic
902707025 1:18212689-18212711 CAGGGGCATGTTGAGCAGAGGGG - Intronic
902881699 1:19375728-19375750 CAGAGGCAGCGTGAAGAGTGAGG + Intronic
903888226 1:26553553-26553575 CAGGGCCATCCTGAGGTGGGTGG + Intronic
903974056 1:27137833-27137855 CAGGGGCACATTGGGGAGGGAGG - Intronic
905016542 1:34782080-34782102 CAGGGACATTGTGGGGCGGGAGG + Intronic
905346991 1:37318100-37318122 CAAGGGCAACGGGAGGAGGAAGG - Intergenic
905617033 1:39408653-39408675 CCGGGCCAGCGGGAGGAGGGCGG + Intronic
905798611 1:40829504-40829526 CAGGGGCACCTTCAGGAAGGTGG - Intronic
906531048 1:46524250-46524272 CAGAGGCATCAAGAGGAGGAGGG - Intergenic
907794504 1:57701542-57701564 CAGGGGTAGGGGGAGGAGGGAGG + Intronic
912046151 1:105460528-105460550 TATGGGCATCGTGAGCAGGAGGG + Intergenic
912956441 1:114156900-114156922 CTGGGGCAAAGGGAGGAGGGAGG + Intergenic
913165768 1:116182975-116182997 TAGGGCCAACGTGAGGAGTGTGG + Intergenic
913465712 1:119140636-119140658 CAGCGCCATCTTGAGAAGGGCGG + Exonic
914681163 1:149939186-149939208 GAGGGGCAGCCGGAGGAGGGAGG + Exonic
916399267 1:164428544-164428566 CTGGGGGATAGGGAGGAGGGAGG + Intergenic
916713316 1:167431108-167431130 CAGGGGCATGGGAAGGTGGGCGG - Exonic
917732206 1:177886103-177886125 CAGGGTCATAGAGAGGAGTGAGG - Intergenic
919703378 1:200653883-200653905 CAGTGGCAACGAGGGGAGGGGGG - Intronic
922131832 1:222787604-222787626 CAAGGGCGTCCTGAGGAGGACGG - Intergenic
922703331 1:227775052-227775074 CGGGGGCGTCCTGAGGAGGGGGG + Intronic
923407139 1:233673268-233673290 CAGGGACATGGTCAGCAGGGAGG - Intergenic
923526226 1:234775000-234775022 CAGGGGCATGGTGGGGAAGAAGG - Intergenic
1063115011 10:3067161-3067183 CAGGGGCAGCGTCCGGAGGAGGG - Intronic
1063121326 10:3106947-3106969 CAGGGGCAGGGTGAGGAGAGGGG - Intronic
1064458099 10:15507553-15507575 CTGGGGCATGGTGACGGGGGAGG - Intergenic
1065342769 10:24723023-24723045 CGGGGGAATCGTGGGGAGGTGGG - Intronic
1066481282 10:35798104-35798126 CAGGAGCCTGATGAGGAGGGCGG + Intergenic
1067289252 10:44929464-44929486 GAGGTGGATCCTGAGGAGGGGGG - Intronic
1070156678 10:73839732-73839754 CAGGGGCAGGCTGAGGAGGTAGG + Intronic
1070696004 10:78563558-78563580 CAGGGGTACCGTGAGGGAGGTGG - Intergenic
1072683623 10:97524086-97524108 CAGGGGCACTGTGATCAGGGTGG - Intronic
1072826581 10:98612922-98612944 CCGGGGCATGATGAGGAAGGGGG - Intronic
1072985236 10:100133907-100133929 CAGGGGGATGGAGAGGAGGAAGG - Intergenic
1075714429 10:124547960-124547982 CAGGGGCATCAGGCGGTGGGCGG - Intronic
1075923090 10:126229206-126229228 CAGGGGCTTCCGGTGGAGGGAGG + Intronic
1076085462 10:127626169-127626191 CAGGGGCTTAGTGGGTAGGGGGG - Intergenic
1077590695 11:3488816-3488838 CAGGGGGATTGCGAGGAGTGGGG + Intergenic
1080592575 11:33736476-33736498 CAAGGGCATCCTGAGGGGCGGGG - Intergenic
1081442135 11:43092469-43092491 CAAGGGCATGGTGAGGAGCTGGG - Intergenic
1081868387 11:46372112-46372134 CAGGGGCTTCATGAGCGGGGAGG - Exonic
1081869082 11:46375193-46375215 CCGAGGCATAGTGAGGAGAGGGG - Intronic
1083341638 11:61962119-61962141 CTGGGGCATGGTGAGGAAGACGG + Intronic
1083609798 11:63999395-63999417 CAGGGGTAGCCTGAGGCGGGTGG + Exonic
1083644647 11:64165443-64165465 AGGGGGCAGCGTGAGGAAGGCGG - Intronic
1083822696 11:65181897-65181919 GAGGGGCGGCGGGAGGAGGGCGG + Intronic
1083879872 11:65543119-65543141 CAGGGGCATCGGCTGGTGGGTGG - Exonic
1084123201 11:67081663-67081685 CATGGGCCTCGCGAGGAGTGGGG - Intergenic
1084274265 11:68043680-68043702 CAGGGGCCTGGGGAGCAGGGCGG - Intronic
1084366775 11:68706548-68706570 CTGGGGCACCGAGTGGAGGGAGG - Intergenic
1084383497 11:68828291-68828313 CAGGGGCTTCTTGGAGAGGGGGG + Intronic
1085171088 11:74450523-74450545 GTGGGGGAGCGTGAGGAGGGTGG + Intergenic
1085535046 11:77212559-77212581 CAGGAGTATGGTGAGGAGGCTGG + Intronic
1087230241 11:95653048-95653070 CAGGGGAATGGGGAGGAGAGTGG + Intergenic
1089455162 11:118621604-118621626 GAGGGGCGTCTTGAGGAGGGTGG + Intronic
1091251308 11:134146494-134146516 GAGGGGCGTTGAGAGGAGGGTGG + Intronic
1091545879 12:1501010-1501032 CAGGGGTAGCGTGAAGAGGCCGG - Intergenic
1091590900 12:1842541-1842563 AGGGGGCCTGGTGAGGAGGGAGG - Intronic
1092218339 12:6697499-6697521 CAGGGGTATTGGGATGAGGGCGG + Exonic
1095569230 12:43664178-43664200 CAGGGGCAAACTGAGGTGGGTGG - Intergenic
1097905804 12:64918548-64918570 CAGGCACATTGTGAGGTGGGAGG + Intergenic
1098976579 12:76908491-76908513 GAGGGGGATGGTGAGGTGGGAGG - Intergenic
1100322596 12:93509880-93509902 CTGGGGGATGGTGATGAGGGAGG - Exonic
1103797038 12:123510245-123510267 CTGGGGCATAGAGAGGAGAGAGG - Intronic
1104437589 12:128768199-128768221 CAGAGGGCGCGTGAGGAGGGCGG - Intergenic
1105281391 13:18964774-18964796 TAGGGGCATCTTGAGCAGGCAGG - Intergenic
1105771240 13:23614098-23614120 CAGAGGCACAGAGAGGAGGGGGG - Intronic
1106504749 13:30361284-30361306 GAGGGGCACCGTGAGAAGGCAGG - Intergenic
1107787238 13:43969292-43969314 CAGGGGCTTCATGAGGGGGGAGG - Intergenic
1108516035 13:51203730-51203752 TAGGGGCATAGTGAGAAAGGGGG - Intergenic
1108637086 13:52345842-52345864 CAGAGGCAACTTGAGGTGGGGGG + Intergenic
1109011860 13:56959358-56959380 GAGGGACATCCTGAGGAGTGGGG - Intergenic
1113400908 13:109992565-109992587 CTGGAGCAGCCTGAGGAGGGGGG - Intergenic
1113608967 13:111629802-111629824 CAGGGGCACCGGGAGGTGTGGGG - Intronic
1113843106 13:113371463-113371485 GAGGGGCCTCAGGAGGAGGGAGG - Intergenic
1113843237 13:113371780-113371802 GAGGGGCCTCAGGAGGAGGGAGG - Intergenic
1113843276 13:113371879-113371901 GAGGGGCCTCAGGAGGAGGGAGG - Intergenic
1114183571 14:20384004-20384026 CAGGGGCCTGGGCAGGAGGGAGG - Intronic
1114646262 14:24258250-24258272 CAGGGGCATGGTGGGGAGTGGGG + Intronic
1115511051 14:34138178-34138200 CAGGGGCATGGGAAGGAGAGTGG + Intronic
1119204482 14:72783883-72783905 CAGGGGCAGCGGCAGGATGGGGG + Intronic
1120530165 14:85622243-85622265 CTGGGAGATCGGGAGGAGGGTGG - Exonic
1121109568 14:91303340-91303362 CGGGGGCCTCGTGAGAAGGGTGG - Intronic
1122646937 14:103201105-103201127 CAGGGGGATAGTGGGGAGGGGGG - Intergenic
1124510025 15:30316011-30316033 CAGGGGCTTCATGAAGAGGGTGG - Intergenic
1124732865 15:32214542-32214564 CAGGGGCTTCATGAAGAGGGTGG + Intergenic
1125531417 15:40415956-40415978 CAGGGGCATGGAGAGGAGATGGG - Intronic
1126269075 15:46791564-46791586 CAGGAAAATCGTGAGGAGGAGGG + Intergenic
1126348367 15:47718852-47718874 CAGGGGCATGGTGAGGAGGAAGG + Exonic
1128156286 15:65393945-65393967 CAGGGGAAGGGTGAGGAAGGAGG - Intronic
1128517063 15:68348990-68349012 TGGGGGCATCGTCAGGAGGTGGG + Intronic
1129606221 15:77026312-77026334 CAGGGCCTTAGTGATGAGGGTGG + Intronic
1129672837 15:77616614-77616636 CAGGTGCAGGGGGAGGAGGGAGG - Intronic
1130195524 15:81777147-81777169 CTGGGGCATGGTCAGGACGGTGG - Intergenic
1132255695 15:100373898-100373920 GAGGGGCGTCGGGAGGCGGGGGG + Intergenic
1132590861 16:725928-725950 CAGCGTGCTCGTGAGGAGGGAGG - Intronic
1133027499 16:2995151-2995173 CAGGGCCATTCTGAGGTGGGGGG - Intergenic
1133269000 16:4601579-4601601 CAGGAGCATTGTTGGGAGGGGGG - Intergenic
1134122801 16:11596696-11596718 CAGGGGGAGAGGGAGGAGGGGGG + Intronic
1134199599 16:12187174-12187196 CAGGGGCATCTTGTGAATGGTGG - Intronic
1134955761 16:18381500-18381522 CAGGGGCTAGGTGAGGGGGGAGG + Intergenic
1135398252 16:22147476-22147498 CTGGGGCATCAGGAGGAGGGAGG + Intronic
1136293514 16:29289570-29289592 CTGGGACCTCCTGAGGAGGGTGG + Intergenic
1136318626 16:29468188-29468210 AAGGGGCTTCCAGAGGAGGGAGG + Intergenic
1136390017 16:29958092-29958114 CTTGAGCATGGTGAGGAGGGAGG + Intronic
1136433198 16:30207534-30207556 AAGGGGCTTCCAGAGGAGGGAGG + Intronic
1137306674 16:47207466-47207488 AAGGGGAATAGTGAGGAGTGGGG + Intronic
1137564025 16:49522124-49522146 CAGTGGCATGGGGATGAGGGAGG + Intronic
1139324824 16:66144481-66144503 CAGGCAGATTGTGAGGAGGGGGG - Intergenic
1139327803 16:66165566-66165588 CAGTGGCATGGTGAGAGGGGAGG - Intergenic
1139783428 16:69370474-69370496 AAGGCGCACCGTGAGGAGGTAGG + Exonic
1139962819 16:70727757-70727779 CAGGAGCATGGGGAGGATGGAGG + Intronic
1141033741 16:80610994-80611016 CTGGGGCCTGGTGAGGATGGTGG - Intronic
1141166705 16:81665684-81665706 CAGGGGCATGGTGTGGAGACAGG - Intronic
1141441324 16:84031511-84031533 CAGGGGAACAGTGAGGAGGCCGG - Intronic
1141570222 16:84929596-84929618 GAGGGGCATGGAGAGGAGGAAGG + Intergenic
1142099394 16:88263576-88263598 CTGGGACCTCCTGAGGAGGGTGG + Intergenic
1142256281 16:89015276-89015298 CAGGGGCTGGATGAGGAGGGGGG + Intergenic
1142610972 17:1109113-1109135 CAGCGGCGGCGGGAGGAGGGAGG + Intronic
1142623789 17:1180095-1180117 CGGGGGCGTCCTGCGGAGGGCGG - Intronic
1143101322 17:4506316-4506338 CAGGGGCCTGGGGAAGAGGGTGG - Intronic
1143126226 17:4642411-4642433 CAGGGGCGGCGGGGGGAGGGGGG - Intergenic
1147285657 17:39401322-39401344 CTCGGGCGGCGTGAGGAGGGCGG - Intronic
1147873113 17:43601788-43601810 CAGGGTAATCGTGAGGAGGCAGG - Intergenic
1148142356 17:45337912-45337934 CAGCAGCAGTGTGAGGAGGGAGG + Intergenic
1148369064 17:47081082-47081104 CATGTGCATCCTGAGGAGTGGGG - Intergenic
1148751403 17:49947616-49947638 CAGGGACTCTGTGAGGAGGGTGG - Intergenic
1150293063 17:63992972-63992994 CAGGGGCAGAGTCAGGAGGGAGG + Intergenic
1150666005 17:67139013-67139035 CAGGGGCATACAGAGGAAGGAGG + Intronic
1151522429 17:74640017-74640039 CATGGGCGTGGTGAGGTGGGGGG - Intergenic
1151954290 17:77373008-77373030 CCGGGCCATGGCGAGGAGGGCGG - Intronic
1152103114 17:78314271-78314293 CAGGGTGAGCGGGAGGAGGGAGG + Intergenic
1152345914 17:79751595-79751617 CAGGGGCTGGGGGAGGAGGGTGG + Intergenic
1152595291 17:81234813-81234835 CAGGGGCAGCGTGGGGTGGCAGG - Intronic
1152630320 17:81408080-81408102 CAGGGGCAGCAGGAGGAAGGGGG - Intronic
1153290152 18:3493034-3493056 CAGGAGCATGTTGAGGAGGAGGG + Intergenic
1153482609 18:5562739-5562761 CAGGGGCTTCGTGGAGAGAGAGG - Intronic
1155068223 18:22287317-22287339 CAGGGGCAGGGAGAGGAAGGTGG - Intergenic
1156858608 18:41811945-41811967 CAGGGGGATGTTGAGAAGGGTGG + Intergenic
1158145132 18:54303914-54303936 CAGGGCCATTGTGGGGTGGGGGG - Intronic
1161012773 19:1968307-1968329 CAGGGGCAGCCTGGGGAGGAGGG - Intronic
1161719930 19:5897083-5897105 GGGGGGCATCGTGAGGACTGAGG - Intronic
1162443415 19:10707450-10707472 CAGGGGCCTGGTGAGGGGGTAGG - Intronic
1162953883 19:14088004-14088026 CAGGGGCAGACTGAGAAGGGGGG + Exonic
1163071885 19:14849816-14849838 CAGTTGCAGCGTGAGGAGTGGGG - Intergenic
1163389509 19:17021888-17021910 CAGGGGCATGGGAGGGAGGGAGG - Intronic
1164210531 19:23093800-23093822 CAGGGGCATGGTGGGAAGGAAGG + Intronic
1164219593 19:23181482-23181504 CATTGGCATCGTGAGGATAGTGG + Intergenic
1165992600 19:39825280-39825302 CAGAGGCATGGTGGGGAAGGGGG - Intergenic
1165992764 19:39825777-39825799 CAGGGTCATCAGGAGGCGGGAGG + Exonic
1166232991 19:41436514-41436536 CTGGGGCATCGTGAGGGCTGTGG - Intronic
1167117437 19:47496506-47496528 CAGGGGTGTTGTGGGGAGGGAGG + Intronic
1167664837 19:50818044-50818066 GCGGGGCCTCGGGAGGAGGGCGG + Intergenic
1168246485 19:55115235-55115257 CAGGGCTGTGGTGAGGAGGGGGG - Intronic
1168330270 19:55564021-55564043 CAGGGGGATCGTGAGGTCAGAGG - Intergenic
924980332 2:214076-214098 CAGGGGCCTCGGGGGGAAGGAGG - Intergenic
925034292 2:673896-673918 CAGGGGGAAGGTGGGGAGGGTGG + Intronic
925386084 2:3462804-3462826 CAGGGGCACCCGGGGGAGGGGGG - Intronic
927825797 2:26309485-26309507 CAGGGGCAGCGTAAGCAGGGTGG - Intronic
928399777 2:30969408-30969430 CAGGGGCAAGTTGGGGAGGGAGG + Intronic
928706249 2:33952765-33952787 CGGGGGCAGGGTGTGGAGGGTGG + Intergenic
929083254 2:38142422-38142444 CAGGGGCAGGGTGTGGTGGGGGG - Intergenic
929885509 2:45874335-45874357 CAGGGGCTTCGTGATGACGCTGG + Intronic
929929256 2:46239477-46239499 CTGGGGCTTCAGGAGGAGGGAGG - Intergenic
931825993 2:66001757-66001779 GTGGGGCAATGTGAGGAGGGAGG - Intergenic
932432790 2:71685700-71685722 CAGGGCCAGCGTGGGGAGGCAGG + Intronic
932727019 2:74188332-74188354 CAGTGGAAGTGTGAGGAGGGTGG - Intergenic
932734088 2:74242185-74242207 CTGGGGCAAAGTGAGGAAGGTGG - Intronic
933286439 2:80389418-80389440 ATGGGGGATAGTGAGGAGGGAGG - Intronic
933717982 2:85376097-85376119 CATGGTCATCGTGGGGCGGGGGG + Intronic
933810763 2:86031456-86031478 CCGGGGCTGCGTCAGGAGGGCGG + Exonic
933942356 2:87255002-87255024 CAGAGGCCTCCTGAGTAGGGGGG - Intergenic
935191032 2:100779056-100779078 CAGGGGCCTCGTTAGCATGGGGG + Intergenic
936337870 2:111606567-111606589 CAGAGGCCTCCTGAGTAGGGGGG + Intergenic
936744506 2:115558543-115558565 CAGGGGCATCCTGAACTGGGTGG + Intronic
937700045 2:124853811-124853833 CAGGGCCTACGTGAGGATGGAGG - Intronic
937982886 2:127625296-127625318 CAGGGGCATCCTGGGGAAGGGGG + Intronic
938143283 2:128813254-128813276 GTGGGGAATAGTGAGGAGGGAGG - Intergenic
938614530 2:132983698-132983720 CATGGGAGTCGGGAGGAGGGGGG + Intronic
939341750 2:140905220-140905242 CAGGGGCTTGGGGAGGGGGGCGG - Intronic
940255531 2:151724301-151724323 CAGGGGCATCAGGAGGAAGCAGG + Exonic
944215238 2:197247989-197248011 AAGGGGAATGATGAGGAGGGAGG - Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
945144645 2:206724877-206724899 CAGGGGCTGAGAGAGGAGGGTGG - Intergenic
946428282 2:219611527-219611549 AAGGAGCATCGTGAGCATGGTGG + Intronic
947433737 2:230054070-230054092 CAGGTGCAGCCTGAGGTGGGGGG + Intronic
947526042 2:230877300-230877322 CAGGGGCCTCTGGAGGAGGGAGG + Intronic
948824059 2:240565950-240565972 CAGTGGCTTGGAGAGGAGGGAGG + Intronic
948887656 2:240892189-240892211 CAGGGCCATCGTCAGGAGGTAGG - Intronic
1168764728 20:373839-373861 CAGGGGCCTCCAGAGAAGGGAGG + Intronic
1171373165 20:24674603-24674625 GAGGGGCATGGTGCGGAGGGAGG + Intergenic
1171893636 20:30740803-30740825 GGGGGGCAAGGTGAGGAGGGGGG + Intergenic
1172116236 20:32575037-32575059 CAGAGGCATAGTGAGGTGAGGGG - Intronic
1172221281 20:33276726-33276748 CAGGGACAGCCTGAGGAGGAGGG + Intronic
1172221515 20:33277464-33277486 CAGGGGCAAAGGAAGGAGGGTGG - Intronic
1172699269 20:36843018-36843040 CAGTGGCAGCATGAGGAGGGAGG - Intronic
1173655963 20:44700546-44700568 CAAGGGCAGCGTGAGGACTGTGG - Intergenic
1173729819 20:45320267-45320289 CGGGGGGATGCTGAGGAGGGAGG + Intergenic
1173824168 20:46036804-46036826 CTGGGGCTTTGTGGGGAGGGAGG + Intronic
1174838731 20:53881573-53881595 CAGGGGCCTAGTCAGGAGGCTGG - Intergenic
1176285799 21:5018886-5018908 CATGGGCATCCTTTGGAGGGTGG - Intergenic
1176409119 21:6438232-6438254 CAGGGGCCTGCTGAGGACGGAGG - Intergenic
1177355440 21:19999874-19999896 AAGGGGCTGCATGAGGAGGGTGG + Intergenic
1178329963 21:31680107-31680129 GAGGGACATCTTGAGGAAGGTGG - Intronic
1179175502 21:39005096-39005118 CAGGGGGATTGGCAGGAGGGTGG + Intergenic
1179484927 21:41704107-41704129 CGGGGGCATGGTGGGGTGGGGGG - Intergenic
1179684612 21:43046554-43046576 CAGGGGCCTGCTGAGGACGGAGG - Intergenic
1179871382 21:44244589-44244611 CATGGGCATCCTTTGGAGGGTGG + Intergenic
1181236031 22:21448172-21448194 CAGGGGAACCATGAGGAGGGTGG + Exonic
1182254886 22:29031044-29031066 CAGGGGCAGCGGCAGGAGCGGGG - Intronic
1182431346 22:30300745-30300767 CAGGGTCAACGAGAGGAGAGTGG - Intronic
1183770406 22:39920432-39920454 CAGGAGCCCCGTGAGAAGGGTGG - Intronic
1183948299 22:41339040-41339062 CAGGGGCATCGTGGGCGTGGAGG - Exonic
1184653639 22:45930635-45930657 CAGGAGCAGCCTGAGGAAGGTGG - Intronic
1185018988 22:48362578-48362600 CAGGAGCTGTGTGAGGAGGGTGG + Intergenic
1185056948 22:48586106-48586128 CAGAGGCTTCCTGAGGAGGAAGG + Intronic
1185095404 22:48803604-48803626 CAGGGGCCTCCTCAGGTGGGAGG + Intronic
1185277714 22:49956950-49956972 CAGGTGGATCGGCAGGAGGGAGG + Intergenic
1185390389 22:50557922-50557944 AAGAGGCACCGTGATGAGGGAGG - Intronic
949681018 3:6514566-6514588 AAGGGGCATAGTGTGTAGGGTGG - Intergenic
950387419 3:12671079-12671101 GAGGGGCACCAAGAGGAGGGAGG + Intergenic
953414413 3:42707442-42707464 CAGGGGCTCCCTGAGGAGTGGGG + Intronic
953493766 3:43369673-43369695 CAGGGCCATGGTATGGAGGGGGG + Intronic
953775666 3:45814802-45814824 CAGGGAGATAGTGAGGTGGGTGG - Intergenic
954572774 3:51656030-51656052 CCGGGGCATCATGGGGATGGGGG - Exonic
954870579 3:53764661-53764683 CAGGGGCAGCGGGAGGAGCAGGG - Intronic
954873672 3:53786715-53786737 CAGGGGCAGAGTGGGGCGGGTGG - Intronic
958822285 3:98989173-98989195 CAGTGGCAGGGTCAGGAGGGAGG - Intergenic
959737166 3:109672771-109672793 GAGGGGCATGGAAAGGAGGGGGG - Intergenic
961642272 3:128371924-128371946 CAGTGGCCTTGAGAGGAGGGAGG + Intronic
961672836 3:128547468-128547490 GAGGAGCTTCATGAGGAGGGAGG + Intergenic
962845195 3:139267693-139267715 AAGGGGCATAGTGAGGAGAGTGG + Intronic
965521011 3:169668224-169668246 CTGGGGGAGCGAGAGGAGGGTGG + Intergenic
965722599 3:171678063-171678085 CAGGGGCAGAGTGGGAAGGGCGG + Intronic
967818615 3:193819477-193819499 CAGGGGCATAGCGAGGAACGGGG + Intergenic
968578147 4:1377433-1377455 TAGGGACAGTGTGAGGAGGGAGG + Intronic
968658291 4:1787934-1787956 AAGGGGCATCCTGAAGAGGGCGG + Intergenic
968816237 4:2823349-2823371 AAGGGGCAAGGTGGGGAGGGAGG - Intronic
969347879 4:6580581-6580603 CAGCTGCATCTTGAGGAGGAGGG - Intronic
969564120 4:7967608-7967630 CAGGGGCTTCCGGTGGAGGGAGG - Intronic
970043182 4:11819967-11819989 CAGGGACTTCCTCAGGAGGGAGG + Intergenic
971139084 4:23904123-23904145 CAAGGGCATGGTGACGTGGGAGG + Intergenic
972436295 4:39038746-39038768 CAGGAGAATGGTGTGGAGGGAGG - Intergenic
972639390 4:40911883-40911905 TAGGGGCAGAGGGAGGAGGGAGG - Intronic
981938224 4:150256184-150256206 CCGGGGCAGCGGGAGGAGGGTGG - Exonic
985063062 4:186097107-186097129 CAGGGGCTCCCTAAGGAGGGAGG - Intergenic
985073792 4:186192423-186192445 AAGTGGCAGCGAGAGGAGGGCGG - Intronic
985279032 4:188269042-188269064 CCTGGGCATAGGGAGGAGGGAGG - Intergenic
985279048 4:188269092-188269114 CCTGGGCATAGGGAGGAGGGAGG - Intergenic
985279064 4:188269142-188269164 CCTGGGCATAGGGAGGAGGGAGG - Intergenic
985279080 4:188269192-188269214 CCTGGGCATAGGGAGGAGGGAGG - Intergenic
985279096 4:188269242-188269264 CCTGGGCATAGGGAGGAGGGAGG - Intergenic
985279112 4:188269292-188269314 CCTGGGCATAGGGAGGAGGGAGG - Intergenic
985279128 4:188269342-188269364 CCTGGGCATAGGGAGGAGGGAGG - Intergenic
985279144 4:188269392-188269414 CCTGGGCATAGGGAGGAGGGAGG - Intergenic
985279160 4:188269442-188269464 CCTGGGCATAGGGAGGAGGGAGG - Intergenic
985279176 4:188269492-188269514 CCTGGGCATAGGGAGGAGGGAGG - Intergenic
985279192 4:188269542-188269564 CCTGGGCATAGGGAGGAGGGAGG - Intergenic
985279208 4:188269592-188269614 CCTGGGCATAGGGAGGAGGGAGG - Intergenic
985279224 4:188269642-188269664 CCTGGGCATAGGGAGGAGGGAGG - Intergenic
985279240 4:188269692-188269714 CCTGGGCATAGGGAGGAGGGAGG - Intergenic
985279256 4:188269742-188269764 CCTGGGCATAGGGAGGAGGGAGG - Intergenic
985587889 5:750410-750432 AGGGGGCCTCGTGAGGATGGAGG - Intronic
986082078 5:4405473-4405495 CAGGGGAAGCTTGAGTAGGGAGG + Intergenic
986929926 5:12805362-12805384 CAGGGGCAGCGTCTGGAGGCTGG - Intergenic
990037927 5:51345484-51345506 CAGGAGCATAAGGAGGAGGGAGG + Intergenic
990509919 5:56480971-56480993 CAGGGGCGGGGTGGGGAGGGGGG + Intronic
991348359 5:65694106-65694128 TAGGGGCATGGTCAGGAGGTTGG + Intronic
992367418 5:76106779-76106801 AAGGGGGATTGTGAGTAGGGAGG - Intronic
992875199 5:81047302-81047324 AAGGTGTATCCTGAGGAGGGAGG + Intronic
993876092 5:93308748-93308770 CAGGGGTGGTGTGAGGAGGGTGG + Intergenic
994965868 5:106670061-106670083 CAGGGCCACTGTGGGGAGGGTGG + Intergenic
997836702 5:137200179-137200201 CAGGGACATCTGGTGGAGGGTGG - Intronic
998695931 5:144639591-144639613 TAGGGGCATGGTGGGGTGGGAGG - Intergenic
999149562 5:149417765-149417787 AAGGGGCCTCGGGAGGAAGGTGG - Intergenic
999380357 5:151117161-151117183 CAGGGGCATCGTGAGGAGGGAGG - Exonic
1000903693 5:166937382-166937404 CAGGGGCATGGTGACAAGAGAGG + Intergenic
1001835355 5:174826656-174826678 CAGGGCCCGGGTGAGGAGGGAGG + Intergenic
1002533700 5:179864575-179864597 GAGGGGGATCCTGGGGAGGGGGG + Intronic
1004627447 6:17390200-17390222 CAGGAGCAAGGGGAGGAGGGAGG - Intergenic
1005946896 6:30602053-30602075 CAGGGACATCATGAGGCCGGTGG + Exonic
1006081754 6:31572052-31572074 CAGGGGAATCGTGGGCTGGGAGG - Exonic
1006334630 6:33414176-33414198 CAGGGGAGTCCTGAGGTGGGAGG - Intronic
1006617901 6:35342411-35342433 CCGGGGCAGCGTGCGGTGGGCGG + Intergenic
1007163645 6:39812584-39812606 CAGGGGCAGGGTGGGGAGGCGGG - Intronic
1007512030 6:42381145-42381167 CAGGGGCTTCCTGAGGACAGAGG + Intronic
1011792463 6:90913425-90913447 CAGGGGGATGGTGAGGAGGAGGG - Intergenic
1013459252 6:110358955-110358977 CAGCGGGTTGGTGAGGAGGGGGG + Intergenic
1015227589 6:130875461-130875483 CAGGGGCTTGGTGAGCAAGGGGG - Intronic
1015952719 6:138570005-138570027 CAGGGGCAACTTGTGAAGGGAGG - Intronic
1017068594 6:150552075-150552097 CAGGGGGACTGTGGGGAGGGTGG + Intergenic
1017637368 6:156456211-156456233 GAGGGGGATGGGGAGGAGGGGGG - Intergenic
1017637465 6:156456398-156456420 GAGGGGGATGGGGAGGAGGGGGG - Intergenic
1017643474 6:156516728-156516750 CAGGGGCAGGGTGGGGAAGGAGG - Intergenic
1018441803 6:163820568-163820590 CAGGTGCATGGGGATGAGGGAGG - Intergenic
1018491116 6:164294540-164294562 CACTGGCATGGTGAGGATGGGGG - Intergenic
1020853563 7:13388993-13389015 CAGGGGCACCATGATCAGGGTGG - Intergenic
1022412592 7:30150677-30150699 CAGTGGCTTCATGAGGAGGTGGG + Intronic
1025108664 7:56194249-56194271 CTGGGGCTTGGTGAGGAGGCAGG + Intergenic
1029483148 7:100824818-100824840 CAGGGCACTCGTGGGGAGGGAGG - Intronic
1029750378 7:102539626-102539648 CAGGAGGACCGTGAGGAGGACGG + Intronic
1029768330 7:102638734-102638756 CAGGAGGACCGTGAGGAGGACGG + Exonic
1032000920 7:128264882-128264904 CTGGGGCTTTGTCAGGAGGGAGG + Intergenic
1033722057 7:144071149-144071171 CAGGGGTATTGGGAGGAGGTGGG - Intergenic
1033740891 7:144274972-144274994 AAGTGGCATGGGGAGGAGGGTGG - Intergenic
1033753015 7:144374641-144374663 AAGTGGCATGGGGAGGAGGGTGG + Intronic
1033820707 7:145131124-145131146 GTGGGGGATGGTGAGGAGGGGGG + Intergenic
1034202220 7:149289816-149289838 GAGGGGCATGGAGAGTAGGGTGG - Intronic
1034426443 7:151016643-151016665 CAGGGGCATGTGGAGGGGGGTGG - Intronic
1035693764 8:1577836-1577858 CAGGGGCAGGTTGAGGAGGAAGG - Intronic
1036125385 8:6057435-6057457 CAAGGGCATGGTGATGGGGGTGG - Intergenic
1036797698 8:11768328-11768350 CAGGGGCATCCTGGGGGTGGGGG + Intergenic
1037903693 8:22703148-22703170 CGGGGGCAGGGTGCGGAGGGTGG + Intergenic
1038844998 8:31221007-31221029 CAGGGGCAGCGCGATGAGGCGGG - Intergenic
1039971761 8:42326460-42326482 CAGTGGCACCGGGAGGAGGGTGG - Intronic
1042146945 8:65739949-65739971 CAGAGGCAATGTCAGGAGGGAGG - Intronic
1042862621 8:73329378-73329400 CAAGAGCATCGTGAGGAATGTGG + Intergenic
1045582794 8:103499386-103499408 GAGGGAGAACGTGAGGAGGGAGG - Intergenic
1046129883 8:109954228-109954250 CAGTGGCAGGGTGAGGTGGGGGG + Intergenic
1047915795 8:129582548-129582570 CTGGGGCATTGTGATGAAGGAGG - Intergenic
1048136673 8:131752900-131752922 GAAGGGCACAGTGAGGAGGGAGG + Intergenic
1048906651 8:139095622-139095644 ACGGGGCATGGAGAGGAGGGAGG + Intergenic
1049081118 8:140444351-140444373 GAAGGGCATCTTGAGGAGAGAGG - Intronic
1049558182 8:143294084-143294106 GAGGGGCAGCAGGAGGAGGGGGG - Intronic
1049579744 8:143405949-143405971 CAGGGGCCTCCTGAGGACGGGGG - Intergenic
1049684935 8:143935562-143935584 GAGGGGCCTGGTGGGGAGGGTGG - Intronic
1050059091 9:1687045-1687067 CATGGGACTCGTGAGGAAGGTGG + Intergenic
1053004343 9:34594122-34594144 CAGGGGCACCATTAGGAGGGGGG + Intergenic
1053372793 9:37576469-37576491 GAGGGGCACCGGGAGGCGGGAGG + Intronic
1054663186 9:67716127-67716149 CAGGGACAGGGTGAGGAGCGTGG + Intergenic
1054947364 9:70810192-70810214 CAGGGTGATGGAGAGGAGGGTGG - Intronic
1054947398 9:70810326-70810348 CAGGGTGATGGAGAGGAGGGTGG - Intronic
1054947414 9:70810393-70810415 CAGGGCGATGGAGAGGAGGGTGG - Intronic
1056753605 9:89368587-89368609 CAGGGGCCCCAAGAGGAGGGAGG + Intronic
1057706370 9:97397968-97397990 CAGAGGCAGCGAGAGGAGGAGGG - Intergenic
1060051802 9:120383390-120383412 CAGTGGCAGCTTGAGGCGGGTGG - Intergenic
1061091375 9:128428465-128428487 AAGGGGCACCGTGGGGAGGCAGG - Intronic
1061646727 9:132009014-132009036 CACGGGCAGAGTGGGGAGGGAGG - Intronic
1062281354 9:135753290-135753312 CAGGGGCCTTGTGAGCAGTGAGG + Intronic
1062477348 9:136735282-136735304 CAGGGCCCTCGGGAGGTGGGGGG + Intergenic
1062509007 9:136894585-136894607 TGGGGGCATCATGAGGATGGAGG + Intronic
1062695414 9:137873442-137873464 CAGGAGCCTAGTGTGGAGGGCGG + Intergenic
1186443247 X:9604127-9604149 CAGGGGAATTGGGAGAAGGGTGG - Intronic
1186483167 X:9911598-9911620 CTGGGGCTGCGTTAGGAGGGAGG + Intronic
1189052858 X:37664720-37664742 CAGGGCCTACTTGAGGAGGGAGG - Intronic
1189379076 X:40488977-40488999 CAGGCGCCTCTGGAGGAGGGTGG - Intergenic
1189559938 X:42182063-42182085 CAGGGTCAGCGTGAGGAGGAGGG + Intergenic
1191929844 X:66359235-66359257 GAGGGGCAGTGTGAGGTGGGGGG + Intergenic
1193824093 X:86201274-86201296 CAGGGTCTTCTTGAGGGGGGTGG + Intronic
1196411865 X:115428117-115428139 CAGGGGCAACGGGAGTAGGAAGG + Intergenic
1200082015 X:153581927-153581949 TAGGGGCTTCCTCAGGAGGGTGG - Exonic