ID: 999389454

View in Genome Browser
Species Human (GRCh38)
Location 5:151179703-151179725
Sequence CATTCCCTGCAGTGGCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999389450_999389454 -7 Left 999389450 5:151179687-151179709 CCCGAGTTCATCTCTCCATTCCC No data
Right 999389454 5:151179703-151179725 CATTCCCTGCAGTGGCTGCAAGG No data
999389451_999389454 -8 Left 999389451 5:151179688-151179710 CCGAGTTCATCTCTCCATTCCCT No data
Right 999389454 5:151179703-151179725 CATTCCCTGCAGTGGCTGCAAGG No data
999389449_999389454 16 Left 999389449 5:151179664-151179686 CCTGAGCTGGCACATAGCGACTT No data
Right 999389454 5:151179703-151179725 CATTCCCTGCAGTGGCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999389454 Original CRISPR CATTCCCTGCAGTGGCTGCA AGG Intergenic
No off target data available for this crispr